Application of BACH1 inhibitor in treatment of intrahepatic cholestasis in gestation period

Abstract

The invention discloses application of a BACH1 inhibitor to treatment of intrahepatic cholestasis in a gestation period, and belongs to the technical field of biological medicines. The invention finds that BACH1 gene expression and protein content in placentas of patients with intrahepatic cholestasis in gestation period and mice are increased; according to the present invention, the key effect of the BACH1 in the intrahepatic cholestasis in the gestation period can be proved by increasing the NAD < + > content in the cell mitochondria, promoting the expression of the mitochondrial electron transport chain related gene and increasing the malic acid content in the tricarboxylic acid cycle by inhibiting the expression of the BACH1, and the new target is provided for the treatment of the intrahepatic cholestasis in the gestation period; and great application and popularization values are realized.

Description

Technical Field

[0001] The present invention relates to application of a BACH1 inhibitor in treating intrahepatic cholestasis of pregnancy, and belongs to the technical field of biomedicine. Background Art

[0002] Intrahepatic cholestasis of pregnancy (ICP) is a common obstetric complication that occurs in the second and third trimesters of pregnancy and is characterized by skin itching and elevated serum total bile acid (TBA) levels. ICP poses little risk to the mother, but TBA can pass through the placental barrier and accumulate in the amniotic fluid and fetus, leading to serious complications such as meconium staining of the amniotic fluid, stillbirth, and premature birth. Ursodeoxycholic acid (UDCA) [Lancet. 2019 Sep 7; 394(10201): 849-860] and glutathione precursor S-adenosylmethionine (SAMe) [Cochrane database of systematic reviews 2020 Jul 27; 7(7)] currently used in clinical treatment of ICP do not improve pregnancy outcomes. Therefore, it is particularly important to explore novel and effective treatments for ICP.

[0003] BACH1 (BTB and CNC homology 1) is a transcriptional repressor of the CNC family, which is widely expressed in mammalian tissues. It mainly performs transcriptional repression by forming heterodimers with small Maf proteins and binding to Maf recognition elements in target gene promoters. It plays an important role in enhancing oxidative stress, regulating cell cycle and immune function. At present, the mechanism of action of BACH1 molecules in intrahepatic cholestasis of pregnancy and how it participates in the development of ICP are still unclear. Summary of the invention

[0004] In view of the above-mentioned deficiencies of the prior art, the present invention provides the use of BACH1 inhibitors in the treatment of intrahepatic cholestasis of pregnancy. The present invention finds that BACH1 gene and protein are highly expressed in patients with intrahepatic cholestasis of pregnancy, and aims to improve the placental function and mitochondrial function of intrahepatic cholestasis of pregnancy by knocking out or knocking down the BACH1 gene, thereby alleviating intrahepatic cholestasis of pregnancy.

[0005] The first technical solution provided by the present invention is the use of BACH1 gene or protein as a target in the preparation of a drug for alleviating and / or treating intrahepatic cholestasis of pregnancy.

[0006] In one embodiment, the drug is capable of inhibiting the expression of BACH1 gene or protein.

[0007] In one embodiment, the drug is a vector for gene therapy, including vectors for gene editing, gene expression regulation or gene delivery; or, the drug is a vector for cell therapy, including stem cells, immune cells or repair cells.

[0008] In one embodiment, the drug is a siRNA that specifically knocks down the BACH1 gene, and the siRNA nucleotide sequence is as shown in any one of the groups (1) to (2):

[0009] (1) SEQ ID NO. 1-2;

[0010] (2) SEQ ID NO. 3-4;

[0011] (3) SEQ ID NO.5~6.

[0012] Optionally, the siRNA nucleotide sequence is shown in SEQ ID NO.1-2.

[0013] Specifically, the siRNA comprises:

[0014] The upstream sequence is GCAAUGGAACCUGAAGAAATT (SEQ ID NO. 1) and the downstream sequence is UUUCUUCAGGUUCCAUUGCTA (SEQ ID NO. 2);

[0015] Alternatively, the upstream sequence is GGAGACAGUGAAUCCUGUUTT (SEQ ID NO. 3) and the downstream sequence is AACAGGAUUCACUGUCUCCTT (SEQ ID NO. 4);

[0016] Alternatively, the upstream sequence is GUAGAGCUGCAUUGUGAAATT (SEQ ID NO. 5) and the downstream sequence is UUUCACAAUGCAGCUCUACAA (SEQ ID NO. 6).

[0017] In one embodiment, the dosage form of the drug includes oral solution, injection, tablet, pill, dispersion, capsule, pellet, granule, suspension, emulsion.

[0018] The second technical scheme provided by the present invention is a method for studying the functions of genes related to intrahepatic cholestasis of pregnancy, screening drugs for treating intrahepatic cholestasis of pregnancy, constructing a disease model of intrahepatic cholestasis of pregnancy, or analyzing gene therapy drugs for intrahepatic cholestasis of pregnancy, the method comprising: using siRNA that specifically knocks down the BACH1 gene to reduce the expression of BACH1.

[0019] In one embodiment, the method for screening a drug for treating intrahepatic cholestasis of pregnancy is:

[0020] In the test group, a test compound is added to the culture system, and the expression level of BACH1 in the test group is observed; in the control group, no test compound is added to the same culture system, and the expression level of BACH1 in the control group is observed; wherein, if the expression level of BACH1 in the test group is equal to or lower than that in the control group, it indicates that the test compound is a drug for treating intrahepatic cholestasis of pregnancy.

[0021] In one embodiment, the drug is a siRNA that specifically knocks down the BACH1 gene, and the siRNA nucleotide sequence is as shown in any one of the groups (1) to (2):

[0022] (1) SEQ ID NO. 1-2;

[0023] (2) SEQ ID NO. 3-4;

[0024] (3) SEQ ID NO. 5~6.

[0025] Optionally, the siRNA nucleotide sequence is shown in SEQ ID NO.1-2.

[0026] The third technical solution provided by the present invention is the use of an inhibitor of BACH1 gene or protein in the preparation of a drug for alleviating or treating intrahepatic cholestasis of pregnancy.

[0027] In one embodiment, the inhibitor of BACH1 gene or protein alleviates intrahepatic cholestasis of pregnancy by improving placental function.

[0028] The fourth technical solution provided by the present invention is the use of an inhibitor of BACH1 gene or protein in the preparation of a drug for improving mitochondrial function in intrahepatic cholestasis of pregnancy.

[0029] In one embodiment, the drug is a vector for gene therapy, including vectors for gene editing, gene expression regulation or gene delivery; or, the drug is a vector for cell therapy, including stem cells, immune cells or repair cells.

[0030] In one embodiment, the drug is a siRNA that specifically knocks down the BACH1 gene, and the siRNA nucleotide sequence is as shown in any one of the groups (1) to (2):

[0031] (1) SEQ ID NO. 1-2;

[0032] (2) SEQ ID NO. 3-4;

[0033] (3) SEQ ID NO.5~6.

[0034] Optionally, the siRNA nucleotide sequence is shown in SEQ ID NO.1-2.

[0035] In one embodiment, the dosage form of the drug includes oral solution, injection, tablet, pill, dispersion, capsule, pellet, granule, suspension, emulsion.

[0036] The fifth technical solution provided by the present invention is the use of a reagent for detecting BACH1 gene and / or protein level in the preparation of a product for detecting or diagnosing intrahepatic cholestasis of pregnancy.

[0037] In one embodiment, the test sample of the product includes: one or more of blood, cells, and tissues.

[0038] Optionally, the tissue is placenta; and the cells are vascular endothelial cells.

[0039] In one embodiment, the reagents include: one or more of a reagent for detecting the expression level of BACH1 protein and a reagent for detecting the expression level of BACH1 mRNA.

[0040] In one embodiment, the reagents include: reagents for detecting BACH1 molecules include primers, probes, antibodies, enzyme substrates, gene chips or protein chips.

[0041] In one embodiment, the primers for detecting BACH1 molecules include a forward primer and a reverse primer. Further preferably, the primers include:

[0042] Forward primer 1: 5'-TCTGAGTGAGAACTCGGTTTTTG-3' (SEQ ID NO.7),

[0043] Reverse primer 1: 5'-CGCTGGTCATTAAGGCTGAGTAA-3' (SEQ ID NO. 8);

[0044] or,

[0045] Forward primer 2: 5'-CTCAGCCTTAATGACCAGCGG-3' (SEQ ID NO. 9),

[0046] Reverse primer 2: 5'-GCCTACGATTCTTGAGTGGAAG-3' (SEQ ID NO. 10);

[0047] or,

[0048] Forward primer 3: 5'-AGTGTAAACTCCGCAGGTATCA-3' (SEQ ID NO.11),

[0049] Reverse primer 3: 5'-TTTGGGGCATAAAGAAGGCAA-3' (SEQ ID NO. 12).

[0050] The present invention also provides a diagnostic product, wherein the diagnostic reagent comprises a detection reagent for BACH1 molecules.

[0051] In one embodiment, the BACH1 molecule includes one or more of BACH1 protein, gene, and mRNA.

[0052] In one embodiment, the detection reagent comprises:

[0053] One or more of a reagent for detecting the expression level of BACH1 protein, a reagent for detecting the expression level of BACH1 gene, and a reagent for detecting the expression level of BACH1 mRNA.

[0054] In one embodiment, the reagents for detecting BACH1 molecules include primers, probes, antibodies, enzyme substrates, gene chips or protein chips.

[0055] In one embodiment, the diagnostic product includes, but is not limited to, a diagnostic kit, a primer, a probe, an antibody, an enzyme substrate, a gene chip or a protein chip.

[0056] The sixth technical solution provided by the present invention is the use of a regulating reagent of a BACH1 molecule in the preparation of a malic acid product for regulating the BACH1 molecule and / or the mitochondrial electron transport chain and / or the tricarboxylic acid cycle, wherein the regulating reagent of the BACH1 molecule comprises an enhancer of the BACH1 molecule or an inhibitor of the BACH1 molecule, wherein the BACH1 enhancer enhances the activity and / or expression of the BACH1 molecule, and the inhibitor of the BACH1 molecule inhibits the activity and / or expression of the BACH1 molecule.

[0057] In one embodiment, the BACH1 molecule includes a BACH1 protein, gene and / or mRNA.

[0058] In one embodiment, the regulating agent of the BACH1 molecule inhibits or enhances the activity and / or expression of the BACH1 molecule, thereby inhibiting or enhancing the BACH1 molecule and / or increasing the expression of mitochondrial electron transport chain-related genes and / or increasing the malate content in the tricarboxylic acid cycle.

[0059] In one embodiment, the signaling pathway includes NAD + In the mitochondrial content, the expression of mitochondrial electron transport chain related genes and the content of malic acid in the tricarboxylic acid cycle; further preferably, the mitochondrial electron transport chain related genes and the tricarboxylic acid cycle metabolites include cytochrome C oxidase subunit I (COXⅠ), cytochrome C oxidase subunit II (COXⅡ), cytochrome C oxidase subunit IV (COXⅣ) and malic acid.

[0060] In one embodiment, the modulating agent comprises:

[0061] (1) A vector containing the BACH1 gene, or an overexpression or knockout reagent;

[0062] (2) regulatory factors that enhance or inhibit BACH1 gene or mRNA expression;

[0063] (3) Agents that enhance or inhibit the activity of BACH1 protein.

[0064] In one embodiment, the regulating agent includes, according to the needs of the specific embodiment, the regulating agent can be any agent in the prior art, as long as it can enhance or inhibit the expression level of BACH1 molecules.

[0065] In one embodiment, the knockout described herein is a systemic knockout.

[0066] In one embodiment, the knockout reagent for the BACH1 gene comprises knocking out the 1st exon, the 2nd exon, the 3rd exon, the 4th exon and / or the 5th exon of the BACH1 gene.

[0067] In one embodiment, the regulatory reagent includes an antibody using BACH1 protein or an agent used using point mutation, deletion, insertion, antisense polynucleotides, siRNA, shRNA, microRNA or gene editing technology; further preferably, the gene editing technology includes DNA homologous recombination technology based on embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease and other gene editing technologies.

[0068] In one embodiment, the regulatory agent includes an inhibitor of a BACH1 molecule, which inhibits the activity and / or expression of the BACH1 molecule.

[0069] In one embodiment, the inhibitor comprises:

[0070] (1) A vector containing the BACH1 gene, or an overexpression or knockout reagent;

[0071] (2) regulatory factors that enhance or inhibit BACH1 gene or mRNA expression;

[0072] (3) Agents that enhance or inhibit the activity of BACH1 protein.

[0073] In one embodiment, the knockout reagent for the BACH1 gene includes siRNA of the BACH1 molecule.

[0074] In one embodiment, the siRNA comprises:

[0075] The upstream sequence is GCAAUGGAACCUGAAGAAATT (SEQ ID NO. 1) and the downstream sequence is UUUCUUCAGGUUCCAUUGCTA (SEQ ID NO. 2);

[0076] Alternatively, the upstream sequence is GGAGACAGUGAAUCCUGUUTT (SEQ ID NO. 3) and the downstream sequence is AACAGGAUUCACUGUCUCCTT (SEQ ID NO. 4);

[0077] Alternatively, the upstream sequence is GUAGAGCUGCAUUGUGAAATT (SEQ ID NO. 5) and the downstream sequence is UUUCACAAUGCAGCUCUACAA (SEQ ID NO. 6).

[0078] In one embodiment, the inhibitor of the BACH1 molecule inhibits the BACH1 molecule and / or increases the expression of genes related to the mitochondrial electron transport chain and / or increases the content of malate in the tricarboxylic acid cycle.

[0079] In one embodiment, the inhibitor of the BACH1 molecule alters NAD + Content in mitochondria.

[0080] In one embodiment, the inhibitor of the BACH1 molecule promotes the expression of genes related to the mitochondrial electron transport chain.

[0081] In one embodiment, the inhibitor of the BACH1 molecule increases the amount of malate in the Krebs cycle.

[0082] In one embodiment, the regulatory agent of the BACH1 molecule is an enhancer of the BACH1 molecule, which enhances the activity and / or expression of the BACH1 molecule, thereby enhancing the BACH1 molecule and / or promoting mitochondrial respiration and / or tricarboxylic acid cycle operation.

[0083] In one embodiment, the enhancer of the BACH1 molecule reduces NAD + In the content.

[0084] In one embodiment, the enhancement of the BACH1 molecule reduces the expression of genes related to the mitochondrial electron transport chain.

[0085] In one embodiment, the enhancer of the BACH1 molecule reduces the level of malate in the tricarboxylic acid cycle.

[0086] The seventh technical solution provided by the present invention is the use of a regulating agent of a BACH1 molecule in the preparation of a pharmaceutical composition for treating placental pathological angiogenesis-related diseases, wherein the regulating agent of the BACH1 molecule includes an enhancer of a BACH1 molecule or an inhibitor of a BACH1 molecule, wherein the enhancer of the BACH1 molecule enhances the activity and / or expression of the BACH1 molecule, and the inhibitor of the BACH1 molecule inhibits the activity and / or expression of the BACH1 molecule.

[0087] In one embodiment, the BACH1 molecule includes BACH1 protein, gene and / or mRNA.

[0088] In one embodiment, the regulating agent is an inhibitor of BACH1 molecule, which inhibits the expression of BACH1 molecule, or inhibits the expression of BACH1 molecule and / or promotes the expression of mitochondrial electron transport chain related genes and / or increases the content of malic acid in the tricarboxylic acid cycle.

[0089] In one embodiment, diseases associated with placental pathological angiogenesis include fetal growth restriction, preeclampsia, premature birth, and neonatal brain damage, among others.

[0090] The technical effects of the present invention are as follows:

[0091] The present invention first discovered that the expression of BACH1 gene and protein increased in patients with intrahepatic cholestasis of pregnancy and mouse placenta; inhibiting the expression of BACH1 can increase NAD in cell mitochondria. + The results showed that BACH1 can improve intrahepatic cholestasis of pregnancy by decreasing the expression of genes related to mitochondrial electron transport chain and increasing the content of malic acid in the tricarboxylic acid cycle, which confirmed the key role of BACH1 in intrahepatic cholestasis of pregnancy and provided a new target for the treatment of intrahepatic cholestasis of pregnancy, which has great application and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 is the expression level of BACH1 in human placental tissue; A is the volcano plot of RNA transcriptomics (GSE46157) sequencing of human placental tissue (n=2); B is the volcano plot of proteomics of human placental tissue (n=5).

[0093] Figure 2 A is the expression level of BACH1 in placental tissue of ICP patients, the left figure of A is the immunohistochemical staining of BACH1 in placental tissue of patients with intrahepatic cholestasis of pregnancy, the scale bar is 50 μm, and the quantitative and statistical analysis are shown in the right figure (n=30, data are mean ± SD); B is the total bile acid content in pregnant women's serum is positively correlated with the BACH1 content in placental tissue (n=30, data are mean ± SD); C is the aspartate aminotransferase content in pregnant women's serum is positively correlated with the BACH1 content in placental tissue (n=30, data are mean ± SD); D is the alanine aminotransferase content in pregnant women's serum is positively correlated with the BACH1 content in placental tissue (n=30, data are mean ± SD).

[0094] Figure 3 To construct an ICP mouse model using 0.5% bile acid, A is the mouse model construction process; B is the content of total bile acid in serum (n=6, data are mean ± SD); C is the activity of serum aspartate aminotransferase (n=6, data are mean ± SD); D is the activity of serum alanine aminotransferase (n=6, data are mean ± SD); E is the content of total bile acid in liver (n=6, data are mean ± SD); F is the activity of aspartate aminotransferase in liver (n=6, data are mean ± SD); G is the activity of alanine aminotransferase in liver (n=6, data are mean ± SD); H is H&E staining of liver, scale bar is 50 μm (n=6, data are mean ± SD).

[0095] Figure 4 The expression of BAHC1 mRNA level and protein content in placental tissue in the 0.5% bile acid-induced ICP mouse model, A is the expression of BACH1 mRNA (n=6, data are mean ± SD); B is the BACH1 protein content (n=6, data are mean ± SD); C left figure is immunofluorescence staining of BACH1 protein (red), DAPI stained cell nuclei, scale bar is 20μm, right figure is fluorescence quantitative analysis (n=6, data are mean ± SD); D left figure is immunohistochemical analysis of BACH1 protein, scale bar is 50μm, right figure is fluorescence quantitative analysis (n=6, data are mean ± SD).

[0096] Figure 5The ICP mouse model was established by intraperitoneal injection of 17α-ethinyl estradiol. A is the mouse model construction process; B is the content of serum total bile acid (n=6, data are mean ± SD); C is the activity of serum aspartate aminotransferase (n=6, data are mean ± SD); D is the activity of serum alanine aminotransferase (n=6, data are mean ± SD); E is the content of total bile acid in the liver (n=6, data are mean ± SD); F is the activity of liver aspartate aminotransferase (n=6, data are mean ± SD); G is the activity of liver alanine aminotransferase (n=6, data are mean ± SD); H is liver H&E staining, scale bar = 50 μm (n=6, data are mean ± SD).

[0097] Figure 6 The expression of BACH1 levels and contents in placental tissue in the 0.5% bile acid-induced ICP mouse model, A is the expression analysis of BACH1 mRNA (n=6, data are mean ± SD); B is the BACH1 protein content (n=6, data are mean ± SD); C, the left figure is immunofluorescence staining of BACH1 protein (red), DAPI staining of cell nuclei, the scale bar is 20 μm, and the right figure is fluorescence quantitative analysis (n=6, data are mean ± SD); D, the left figure is immunohistochemical analysis of BACH1 protein, the scale bar is 50 μm, and the right figure is fluorescence quantitative analysis (n=6, data are mean ± SD).

[0098] Figure 7 : BACH1 deficiency improved the total bile acid, aspartate aminotransferase and alanine aminotransferase indicators in the 0.5% bile acid-induced ICP mouse model. A is the serum total bile acid content (n=6, data are mean±SD); B is the serum aspartate aminotransferase activity (n=6, data are mean±SD); C is the serum alanine aminotransferase activity (n=6, data are mean±SD); D is the liver total bile acid content (n=6, data are mean±SD); E is the liver aspartate aminotransferase activity (n=6, data are mean±SD); F is the liver alanine aminotransferase activity (n=6, data are mean±SD).

[0099] Figure 8BACH1 deficiency improves placental function in the ICP mouse model induced by 0.5% bile acid feeding. A is the content of total bile acid in the placenta (n=6, data are mean±SD); B is the expression analysis of placental IGF1 mRNA (n=6, data are mean±SD); C is the expression analysis of placental GLUT1 mRNA (n=6, data are mean±SD); D is the expression analysis of placental PGF mRNA (n=6, data are mean±SD); E is the analysis of fetal weight (n=6, data are mean±SD); F is the analysis of placental weight (n=6, data are mean±SD); G is the analysis of the ratio of placenta to fetal weight (n=6, data are mean±SD).

[0100] Fig. 9 BAHC1 deficiency improves mitochondrial function in the 0.5% bile acid-induced ICP mouse model. A is proteomic pathway enrichment analysis; B is NAD in placental mitochondria + A is the content of ROS in placental mitochondria (n=6, data are mean ± SD); C is the content of ROS in placental mitochondria (n=6, data are mean ± SD); D is the content of ATP in placental mitochondria (n=6, data are mean ± SD); E is the content of SOD in placental mitochondria (n=6, data are mean ± SD).

[0101] Fig.10 Figure 2 BACH1 deficiency promotes the expression of mitochondrial electron transport chain-related genes in the 0.5% bile acid-induced ICP mouse model. A is the expression analysis of placental COXⅠ mRNA (n=6, data are mean±SD); B is the expression analysis of placental COXⅡ mRNA (n=6, data are mean±SD); C is the expression analysis of placental COXⅣ mRNA (n=6, data are mean±SD); D is the placental COXⅠ, COXⅡ, and COXⅣ protein content. The figure below is the quantification results of COXⅠ, COXⅡ, and COXⅣ proteins (n=6, data are mean±SD).

[0102] Fig.11 BACH1 deficiency increases the content of malate in the mitochondrial tricarboxylic acid cycle of mice (n=6, data are mean±SD).

[0103] Fig.12 Figure 3 Effects of BACH1-siRNA on BACH1 expression in HUVECs. Figure 4A shows the addition of BACH1-siRNA-1, BACH1-siRNA-2 and BACH1-siRNA-3 to HUVEC culture medium, and the mRNA level and protein content of BACH1 were detected 48 h later. Figure 4B shows the mRNA level of BACH1, and B, D and F are representative images of BACH1 protein detection (n=3, data are mean±SD).

[0104] Fig.13 BACH1 deficiency increases the expression of genes related to mitochondrial electron transport chain and the content of malate in the tricarboxylic acid cycle in HUVECs. A is the content of COXⅠ, COXⅡ and COXⅣ proteins in HUVECs (n=3, data are mean±SD); B is the content of malate in mitochondria of HUVECs (n=3, data are mean±SD); C is the content of total bile acid in HUVECs (n=3, data are mean±SD). DETAILED DESCRIPTION

[0105] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0106] Test method:

[0107] 1. Clinical sample collection

[0108] This invention has been approved by the Ethics Committee of Jiaxing Maternal and Child Health Hospital (Ethics Review Approval No.: Jiaxing Maternal and Child Health Hospital 2023 Research No. 036-Fast). The authors confirm that the human research participants provided written informed consent for the publication of potentially identifiable medical data contained in this article and that the participants received no cash compensation.

[0109] ICP was diagnosed according to the Chinese Guidelines for the Diagnosis and Treatment of Intrahepatic Cholestasis of Pregnancy, with the following criteria: unexplained pruritus; elevated serum bile acid (≥10 μmol / L); liver dysfunction without identifiable cause; postpartum resolution of symptoms and laboratory values. Exclusion criteria were as follows: Chinese primiparous twin pregnant women and multiparous women; patients with other medical problems known to be associated with placental histopathology (such as hypertension, preeclampsia, renal insufficiency, autoimmune diseases, thrombosis, diabetes); and inability to sign informed consent. All pregnant women with ICP were first-time patients and had not received any treatment. In this study, 10 pregnant women (5 healthy pregnant women and 5 ICP patients) from Jiaxing Maternal and Child Health Hospital were recruited and placental tissues were obtained for proteomic analysis.

[0110] Reverse phase chromatography and mass spectrometry analysis were performed by Shanghai Luming Biotechnology Co., Ltd. All raw data in the Uniprot Mus Musculus database were searched comprehensively using ProteomeDiscoverer2.4.1.15 (Thermo Fisher Scientific). Database searches were performed with trypsin restriction specificity. Alkylation on cysteine ​​was considered a fixed modification in the database search. For protein quantification methods, TMT was selected. The global false discovery rate (FDR) was set to 0.01, and it was considered that at least one peptide was required for the quantitative proteome. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were used to classify significantly differentially expressed proteins.

[0111] 2. Use 0.5% bile acid to establish an ICP mouse model

[0112] The ICP mouse model was established by Figure 3 As shown in A, 6- to 8-week-old C57BL / 6 mice were used, and the adult mice were caged at a male-to-female ratio of 2:1. The vaginal plugs of female mice were checked the next morning as a criterion for successful conception.

[0113] Starting from gestational day 12.5 (GD12.5), female mice were divided into two groups according to diet:

[0114] CRM group: standard maintenance or breeding diet (CRM);

[0115] CA group: CRM+0.5% bile acid (0.5% bile acid added to daily diet feed) induced ICP model in mice;

[0116] At 18.5 days of gestation, mice were weighed;

[0117] The placenta was removed and weighed, and the liver and placenta were fixed with 10% paraformaldehyde and embedded in paraffin. The remaining liver and placenta were quickly frozen in liquid nitrogen for subsequent mRNA and protein expression analysis and stored at -80°C until further analysis;

[0118] Statistics of placental sinusoid area: Based on H&E staining, Image J software was used to calculate the area of ​​the placental sinusoids.

[0119] 3. Establishment of mouse ICP model by intraperitoneal injection of 17α-ethinyl estradiol into pregnant mice

[0120] The ICP mouse model was established by Figure 5As shown in A, 6- to 8-week-old C57BL / 6 mice were used. The adult mice were caged at a male-to-female ratio of 2:1, and the vaginal plugs of female mice were checked the next morning as a criterion for successful conception.

[0121] Starting from gestational day 12.5 (GD12.5), female mice were divided into two groups according to diet:

[0122] Corn oil group: intraperitoneal injection of corn oil;

[0123] EE2 group: ICP mouse model was induced by intraperitoneal injection of 17α-ethinyl estradiol (5 mg / kg / day).

[0124] At 18.5 days of gestation, mice were weighed;

[0125] The placenta was removed and weighed, and the liver and placenta were fixed with 10% paraformaldehyde and embedded in paraffin. The remaining liver and placenta were quickly frozen in liquid nitrogen for subsequent mRNA and protein expression analysis and stored at -80°C until further analysis;

[0126] Statistics of placental sinusoid area: Based on H&E staining, Image J software was used to calculate the placental sinusoid area.

[0127] 4. Hematoxylin-Eosin staining

[0128] Dewaxing and rehydration: Dewaxing tissue sections in xylene and ethanol in turn, then washing with tap water to restore moisture to the sections. Hematoxylin staining: Immerse the sections in hematoxylin staining solution to dye the chromatin in the cell nucleus blue. After staining, wash away excess dye with tap water, then treat with differentiation solution to remove the parts that should not be colored, so that the cell nucleus is clearly colored. Eosin staining: Dehydrate the sections in gradient alcohol in turn, then immerse in eosin staining solution to dye the cytoplasm and extracellular matrix red. Dehydration and sealing: Dehydrate the sections again in anhydrous ethanol and xylene, then seal with neutral gum to keep the sections transparent and fixed.

[0129] 5. Real-time fluorescence quantitative PCR

[0130] Placental tissue or HUVEC cells were ultrasonically disrupted in Trizol reagent (R411-01, Vazyme, Nanjing, China) and then homogenized according to the manufacturer's protocol. Reverse transcription was performed using Prime Script RT kit (R101-02, Vazyme, Nanjing, China). RT-qPCR was performed using Light Cycler 480Ⅱ Real-Time System and SYBR mix (11201ES03; Yisheng Biotechnology Co., Ltd., Shanghai, China). The comparative cycle threshold (Ct) method was used to calculate the expression level of mRNA, and the Ct value of GAPDH was subtracted from the Ct value of the target gene to determine the relative quantification of the target transcript level.

[0131] 6. Protein detection

[0132] Placental tissue was collected, and RIPA lysis buffer was added to lyse the cells, total cell protein was extracted, and protein concentration was measured by BCA method. Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then electrotransferred to 0.22μmol / L polyvinylidene fluoride membrane, and the PVDF membrane was blocked with TBST buffer containing 0.5% skim milk powder at room temperature for 1h. Primary antibody was added and incubated overnight at 4℃. The primary antibody incubation solution was discarded, and TBST buffer containing secondary antibody was added and incubated at room temperature for 2h. Detection was performed using ImageLab chemiluminescence system. The experiment was repeated 3 times independently.

[0133] The raw materials used in the examples are:

[0134] 1. Source of C57BL / 6 mice: purchased from Nanjing Model Animal Center for Model Animal Research. The animal experiments were approved by the Ethics Committee of Jiangnan University (project number FW-20181225-01TY).

[0135] 2. Source of HUVEC cells: purchased from Shanghai Tongwei Industrial Co., Ltd.

[0136] 3. Source of bile acid (CA): purchased from Wuxi Fanbo Bioengineering Co., Ltd.

[0137] 4. 17α-ethinyl estradiol: Sigma-Aldrich (Shanghai) Trading Co., Ltd., (Cat#E4876).

[0138] 5. Alanine aminotransferase (ALT / GPT) detection kit (C009-2-1), aspartate aminotransferase (AST / GOT) detection kit (C010-2-1), and total bile acid (TBA) detection kit (E003-2-1) were all purchased from Nanjing Jiancheng Bioengineering Research Institute.

[0139] Example 1: Detection of BACH1 expression in ICP

[0140] 1. BACH1 expression is elevated in placental tissue of pregnant women with ICP

[0141] By analyzing the RNA-seq dataset (GSE46157), which contains placental tissue samples from healthy donors and patients with intrahepatic cholestasis of pregnancy, the primer sequences for human and mouse are listed as follows:

[0142] Human-BACH1:

[0143] F-5'-TCTGAGTGAGAACTCGGTTTTTG-3',

[0144] R-5'-CGCTGGTCATTAAGGCTGAGTAA-3';

[0145] Mouse-Bach1:

[0146] F-5'-AGAGTGCGGTATTTGCCTACG-3',

[0147] R-5'-TCAGTCTGGCCTACGATTCTC-3'.

[0148] The results are as follows Figure 1 As shown in A. The results showed that BACH1 mRNA was significantly overexpressed in the placenta tissue of patients with intrahepatic cholestasis of pregnancy.

[0149] Proteomic sequencing analysis of placental tissue samples from 5 healthy donors and 5 patients with intrahepatic cholestasis of pregnancy showed that Figure 1 As shown in B. The results showed that BACH1 protein was significantly overexpressed in the placenta tissue of patients with intrahepatic cholestasis of pregnancy.

[0150] Paraffin sections of placental tissues from patients with intrahepatic cholestasis of pregnancy (n=32) and normal controls (n=30) were collected, and the expression level of BACH1 in the placenta was detected by immunohistochemical staining. Figure 2 As shown in A. The results showed that compared with the healthy control group, BACH1 expression in placental vascular endothelial cells of patients with intrahepatic cholestasis of pregnancy was 51.86% higher than that of normal pregnant women.

[0151] By analyzing the blood routine test data of patients, the relationship between the levels of alanine aminotransferase, aspartate aminotransferase and total bile acid in the blood and the expression of BACH1 in placental tissue was detected. The results are as follows Figure 2 As shown in B, C, and D in Figure 1, the results showed that the expression of BACH1 in placental tissue was positively correlated with the total bile acid content in the blood; positively correlated with the activity of aspartate aminotransferase in the blood; and positively correlated with the activity of alanine aminotransferase in the blood.

[0152] 2. BACH1 expression is elevated in the placental tissue of the 0.5% bile acid-induced ICP mouse model

[0153] The serum total bile acid content and the activities of alanine aminotransferase and aspartate aminotransferase in the ICP mouse model induced by 0.5% bile acid were detected. Figure 3 The results are shown in B, C, and D in the figure; the content of total bile acid in the liver and the activities of alanine aminotransferase and aspartate aminotransferase. Figure 3 As shown in E, F, and G; H&E staining of the liver, the results are as follows Figure 3 As shown in H.

[0154] The results showed that the total bile acid, alanine aminotransferase and aspartate aminotransferase in the serum of mice in the CA group (0.5% bile acid-induced ICP mouse model) were 76.35%, 54.06% and 46.7% higher than those in the normal group, and the total bile acid, alanine aminotransferase and aspartate aminotransferase in the liver were 69.62%, 37.86% and 36.58% higher than those in the normal group. H&E staining of mouse liver showed liver damage, mainly including uneven arrangement of liver cords, nuclear condensation and cell vacuolation.

[0155] The expression of BACH1 in the placenta tissue of the ICP mouse model induced by 0.5% bile acid was detected. Figure 4 As shown in A, B, C, and D. The results showed that the protein content of BACH1 was significantly increased in the placental tissue of the ICP mouse model induced by 0.5% bile acid.

[0156] 3. BACH1 expression is increased in the placenta tissue of the ICP mouse model induced by intraperitoneal injection of 17α-ethinyl estradiol

[0157] The serum total bile acid content and the activities of alanine aminotransferase and aspartate aminotransferase in the ICP mouse model established by intraperitoneal injection of 17α-ethinyl estradiol were detected. Figure 5 The results are shown in B, C, and D in the figure; the content of total bile acid in the liver and the activities of alanine aminotransferase and aspartate aminotransferase. Figure 5 As shown in E, F, and G; H&E staining of the liver, the results are as follows Figure 5 As shown in H.

[0158] The results showed that the total bile acid, alanine aminotransferase and aspartate aminotransferase in the serum of mice with ICP mouse model constructed by intraperitoneal injection of 17α-ethinyl estradiol were 59.75%, 37.98% and 45.48% higher than those in the normal group, and the total bile acid, alanine aminotransferase and aspartate aminotransferase in the liver were 50.37%, 40.64% and 37.15% higher than those in the normal group. H&E staining of mouse liver showed liver damage, mainly including uneven arrangement of liver cords, nuclear condensation and cell vacuolation.

[0159] The expression of BACH1 in the placenta tissue of the ICP mouse model was detected by intraperitoneal injection of 17α-ethinyl estradiol. Figure 6 As shown in A, B, C, and D. The results showed that the protein content of BACH1 was significantly increased in the placental tissue of the ICP mouse model induced by intraperitoneal injection of 17α-ethinyl estradiol.

[0160] Example 2: Construction of a systemic BACH1 gene knockout model and its application in intrahepatic cholestasis of pregnancy

[0161] 1. Construction of a model of intrahepatic cholestasis of pregnancy using systemic BACH1 knockout mice

[0162] 6- to 8-week-old systemic BACH1 knockout C57BL / 6 mice (BACH1 - / - ) and wild-type C57BL / 6 mice (WT) aged 6 to 8 weeks were used. The adult mice were caged at a female-to-male ratio of 2:1, and the vaginal plugs of female mice were checked the next morning as the criterion for successful conception.

[0163] Starting from day 12.5 of pregnancy (gestational day 12.5), the female mice were mainly divided into four groups for 7 days, namely:

[0164] CRM WT group: wild-type C57BL / 6 mice (WT) fed with a standard maintenance or breeding diet (CRM);

[0165] CRM BACH1 - / - Group: Systemic BACH1 knockout C57BL / 6 mice (BACH1 - / - ) fed a standard maintenance or reproduction diet (CRM);

[0166] CAWT group: Wild-type C57BL / 6 mice (WT) were fed a diet containing 0.5% bile acid.

[0167] CABACH1 - / - Group: Systemic BACH1 knockout C57BL / 6 mice (BACH1 - / - ) were fed a diet containing 0.5% bile acid.

[0168] At 18.5 days of gestation, the body weight of each group of animals and the weight of liver, placenta, and fetus were measured, and the liver and placenta tissues were subjected to H&E staining, immunohistochemical staining, or immunofluorescence staining. The remaining serum, liver, placenta, and fetuses were stored at -80°C for further use.

[0169] 2. Effect detection

[0170] (1) Systemic BACH1 gene knockout reduces serum and liver total bile acid levels in intrahepatic cholestasis of pregnancy

[0171] The results showed that systemic BACH1 gene knockout could significantly reduce the levels of total bile acid, aspartate aminotransferase, and alanine aminotransferase in the serum and liver of mice induced by 0.5% bile acid, among which the serum total bile acid content decreased by 24.23%, the serum aspartate aminotransferase content decreased by 21.65%, the serum alanine aminotransferase content decreased by 26.48%, the liver total bile acid content decreased by 25.69%, the liver aspartate aminotransferase content decreased by 27.88%, and the liver alanine aminotransferase content decreased by 26.58%. In other words, inhibition of BACH1 has a significant therapeutic effect on the ICP mouse model induced by 0.5% bile acid feeding. Figure 7 As shown in AF in .

[0172] (2) Systemic BACH1 gene knockout improves placental function in intrahepatic cholestasis of pregnancy

[0173] Insulin-like growth factor-1 (IGF1) is a member of the insulin-like growth factor family. IGFs are widely present in placental tissue and are mainly synthesized and secreted by trophoblasts and smooth villous cells of the fetal membrane. IGF1 synthesized and secreted by placental trophoblasts, IGF1R widely expressed in the placenta, and IGFBP3 specifically expressed in the placenta are all extremely important for placental development and fetal growth and development.

[0174] Glucose transporter-1 (GLUT1) is a carrier that transports glucose across the cell membrane into cells in the mammalian placenta. A decrease in the level of placental GLUT1 leads to a decrease in glucose transport between pregnant mice, placenta and fetus, thereby affecting the growth and development of the placenta and fetus.

[0175] Placental growth factor (PGF) is a member of the vascular endothelial growth factor (VEGF) family, and its molecular structure is a glycoprotein homodimer molecule. PGF is a highly specific marker, and the level of PGF is significantly reduced when the placental syncytiotrophoblast cells are under oxygen pressure. The use of Quidel Triage PGF can be used to assess placental insufficiency.

[0176] result( Figure 8) showed that systemic BACH1 gene knockout could significantly reduce the total bile acid content in the placenta of mice induced by 0.5% bile acid, and the content of total bile acid in the placental tissue decreased by 33.48%; systemic BACH1 gene knockout could significantly increase the expression of Igf1, Glut1 and Pgf in the placenta of mice induced by 0.5% bile acid, and the expression of Igf1, Glut1 and Pgf in the placental tissue increased by 78.77%, 69.78% and 67.48%, respectively; systemic BACH1 gene knockout could significantly increase the weight of the fetus and placenta of mice induced by 0.5% bile acid, and the weight of the fetus and placenta increased by 48.78% and 21.44%, respectively; systemic BACH1 gene knockout could significantly reduce the weight ratio of the fetus and placenta of mice induced by 0.5% bile acid, and the weight ratio of the fetus and placenta decreased by 15.36%.

[0177] (3) Systemic BACH1 gene knockout improves mitochondrial function in placental tissue of intrahepatic cholestasis of pregnancy

[0178] Extract mitochondria from the placenta and detect NAD in mitochondria + The results of SOD, ATP and ROS contents are as follows Fig. 9 As shown in B, C, D, and E in Figure 1. The mRNA and protein of the placental tissue were extracted and tested. The test results are shown in Fig.10 As shown in A, B, C and D.

[0179] The results showed that systemic BACH1 gene knockout could significantly increase the NAD in mitochondria of mouse placental tissue induced by 0.5% bile acid. + , SOD and ATP contents increased by 16.99%, 48.78% and 34.55%, respectively; systemic BACH1 gene knockout could significantly reduce the ROS content in mitochondria of mouse placental tissue induced by 0.5% bile acid by 63.01%; systemic BACH1 gene knockout could significantly increase the mRNA expression and protein content of cytochrome C oxidase subunit Ⅰ (COXⅠ), cytochrome C oxidase subunit Ⅱ (COXⅡ) and cytochrome C oxidase subunit Ⅳ (COXⅣ) in mouse placental tissue induced by 0.5% bile acid, the mRNA expression increased by 64.69%, 66.62% and 57.48%, and the protein content increased by 73.43%, 46.08% and 51.64%, respectively.

[0180] The mitochondria in the placenta were extracted and the content of malic acid in the mitochondria was tested. The results were as follows: Fig.11 shown.

[0181] The results showed that systemic BACH1 gene knockout could significantly increase the content of malate in mitochondria of mouse placental tissue induced by 0.5% bile acid, by 18.36%.

[0182] Example 3: Application of knocking down BACH1 in taurocholic acid-induced HUVEC

[0183] 1. Design of BACH1-siRNA

[0184] According to the BACH1 gene, three BACH1-siRNAs were designed, and the sequences are shown in Table 1.

[0185] Table 1 BACH1-siRNA

[0186]

[0187] 2. Knockdown effect of BACH1-siRNA on BACH1 gene

[0188] The knockdown effects of three groups of BACH1-siRNA on the BACH1 gene were detected, and the specific groups were as follows:

[0189] (1) HUVEC + PBS + negative siRNA (100 pmol);

[0190] (2)HUVEC+PBS+BACH1-siRNA-1 (100pmol);

[0191] (3)HUVEC+PBS+BACH1-siRNA-2 (100pmol);

[0192] (4)HUVEC+PBS+BACH1-siRNA-3 (100pmol);

[0193] After 48 h of transfection and incubation, HUVEC cells were broken, mRNA and total protein were extracted, and the expression and content of BACH1 were detected. The results are shown in Fig.12 As shown in Figure AF. The results showed that BACH1-siRNA-1 had the best knockdown effect, reducing the level by 82.45%, which was significantly better than BACH1-siRNA-2 and BACH1-siRNA-3.

[0194] 3. BACH1-siRNA-1 improves bile acid-stimulated HUVEC mitochondrial function

[0195] (1) HUVEC + PBS + negative siRNA (100 pmol);

[0196] (2)HUVEC+PBS+BACH1-siRNA-1 (100pmol);

[0197] (3) HUVEC + taurocholic acid (100 μM) treatment for 24 h + negative siRNA (100 pmol);

[0198] (4) HUVEC + taurocholic acid (100 μM) treatment for 24 hours + BACH1-siRNA-1 (100 pmol).

[0199] After transfection, HUVEC cells were broken, total protein was extracted and the protein content of COXⅠ, COXⅡ and COXⅣ in HUVEC was detected. The results are as follows Fig.13 As shown in A; extract mitochondria from HUVEC and detect the malic acid content in mitochondria. The results are as follows Fig.13 As shown in B; the content of total bile acid in the cells was detected, and the results were as follows Fig.13 As shown in C.

[0200] The results showed that BACH1 gene knockdown could significantly increase the protein content of cytochrome C oxidase subunit I (COXⅠ), cytochrome C oxidase subunit II (COXⅡ) and cytochrome C oxidase subunit IV (COXⅣ) in HUVECs stimulated by taurocholic acid; BACH1 gene knockdown could significantly increase the content of malate in HUVEC mitochondria stimulated by taurocholic acid, and the increase was 21.11%; BACH1 gene knockdown could significantly reduce the content of malate in HUVEC mitochondria stimulated by taurocholic acid, and the decrease was 68.47%.

[0201] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Use of BACH1 gene or protein as a target in the preparation of drugs for alleviating and / or treating intrahepatic cholestasis of pregnancy.

2. The use according to claim 1, characterized in that: The drug can inhibit the expression of BACH1 gene or protein.

3. The use according to claim 1 or 2, characterized in that: The drug is a siRNA that specifically knocks down the BACH1 gene, and the siRNA nucleotide sequence is as shown in any one of the groups (1) to (2): (1) SEQ ID NO. 1-2; (2) SEQ ID NO. 3-4; (3) SEQ ID NO.5~6.

4. Use of an inhibitor of BACH1 gene or protein in the preparation of a drug, characterized in that: The drug is any of the following: (1) Drugs for relieving or treating intrahepatic cholestasis of pregnancy; (2) Drugs that improve mitochondrial function in intrahepatic cholestasis of pregnancy.

5. The use according to claim 4, characterized in that: The inhibitor of BACH1 gene or protein relieves intrahepatic cholestasis of pregnancy by improving placental function.

6. Use of a reagent for detecting BACH1 gene and / or protein levels in the preparation of a product for detecting or diagnosing intrahepatic cholestasis of pregnancy, characterized in that: The reagents include: one or more of a reagent for detecting the expression level of BACH1 protein and a reagent for detecting the expression level of BACH1 mRNA.

7. The use according to claim 6, characterized in that: Reagents for detecting BACH1 molecules include primers, probes, antibodies, enzyme substrates, gene chips or protein chips.

8. Use of a regulatory agent for BACH1 molecules, characterized in that The application includes any of the following: (1) Application in the preparation of a pharmaceutical composition for treating placental pathological angiogenesis-related diseases; (2) Application in the preparation of malic acid products for regulating BACH1 molecules and / or mitochondrial electron transport chain and / or tricarboxylic acid cycle.

9. The use according to claim 8, characterized in that: The regulating agent of the BACH1 molecule includes an enhancer of the BACH1 molecule or an inhibitor of the BACH1 molecule. The enhancer of the BACH1 molecule enhances the activity and / or expression of the BACH1 molecule, and the inhibitor of the BACH1 molecule inhibits the activity and / or expression of the BACH1 molecule.

10. A method for studying the function of genes related to intrahepatic cholestasis of pregnancy, screening drugs for treating intrahepatic cholestasis of pregnancy, constructing a disease model for intrahepatic cholestasis of pregnancy, or analyzing gene therapy drugs for intrahepatic cholestasis of pregnancy, characterized in that: The method is to reduce the expression of BACH1 by using siRNA that specifically knocks down the BACH1 gene; the siRNA nucleotide sequence is shown in any one of the groups (1) to (2): (1) SEQ ID NO.1~2; (2) SEQ ID NO.3~4; (3) SEQ ID NO.5~6.

Images