Application of SIRT5 inhibitor in preparation of medicine for treating non-alcoholic fatty liver disease

Abstract

The invention discloses application of an SIRT5 inhibitor in preparation of a medicine for treating a non-alcoholic fatty liver disease, and belongs to the technical field of biological medicines. Pharmacological experiment results prove that the SIRT5 inhibitor (NRD167) has a good treatment effect on a high-fat-induced liver and L02 intracellular lipid deposition model for the first time. Overexpression of SIRT5 can aggravate liver mitochondrial damage caused by high fat diet, and inhibition of the expression of SIRT5 can significantly improve the liver lipid deposition phenomenon. The SIRT5 inhibitor can effectively inhibit SIRT5 expression, reduce intracellular ROS content increase caused by high fat, reduce liver cell mitochondrial oxidative stress damage and improve ATP synthesis and SDH activity, and SIRT5 aggravates liver fat deposition caused by high fat by inhibiting SDH expression. The SIRT5 inhibitor has no obvious influence on metabolism under normal diet conditions. The SIRT5 inhibitor is used for preparing the medicine for treating the non-alcoholic fatty liver disease, the curative effect is exact, the effect is remarkable, and the good medical application prospect is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of SIRT5 inhibitors in the preparation of drugs for the treatment of non-alcoholic fatty liver disease. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) is a common metabolic liver disease, and its onset is closely related to multiple factors. The main causes include obesity, diabetes, hypercholesterolemia, etc. These factors lead to excessive fat deposition in the liver and gradually develop into NAFLD. NAFLD has a serious impact on human health and may cause complications such as abnormal liver function, hepatitis, and cirrhosis, increase the risk of cardiovascular disease, and even develop into liver cancer. For the treatment of NAFLD, drug therapy plays an auxiliary role to a certain extent. Commonly used drugs include antioxidants, insulin sensitizers, anti-inflammatory drugs, pioglitazone, etc. Because NAFLD is a multi-system disease, the current understanding of its pathogenic mechanism is very limited, and the side effects of therapeutic drugs are large. Therefore, finding new therapeutic targets and treatment strategies for NAFLD is a scientific problem that needs to be solved urgently.

[0003] One of the pathogenic mechanisms of NAFLD is that excessive intake of fatty acids (FAs) leads to excessive reactive oxygen species (ROS) in mitochondria, which in turn leads to impaired mitochondrial function and blocked FAsβ-oxidation, causing liver cell damage. Currently, there are no drugs that can reduce mitochondrial oxidative stress damage in the clinic for the treatment of NAFLD. Therefore, finding key molecules that regulate liver cell oxidative stress damage in the process of NAFLD will provide a new theoretical basis for clarifying the molecular mechanism of the occurrence and development of NAFLD, and provide new targets for the development of clinical drugs.

[0004] NAD + Nicotinamide riboside, a precursor of NAD, can improve the oxidative stress damage to liver mitochondria caused by NAFLD and is considered a potential target for preventing and reversing NAFLD. SIRTs are NAD + SIRT5 is a member of the third family of histone deacetylases that is dependent on succinyltransferases. It plays an important role in inflammation, metabolism, oxidative stress and apoptosis, and is a candidate target for the treatment of metabolic diseases. SIRT5 is located in the cytoplasm and mitochondria, and has a specific lysine desuccinylation function that is different from other members of the SIRTs family, and is involved in intracellular redox homeostasis and fat metabolism.

[0005] Lipid accumulation in the liver leads to mitochondrial damage, increases the risk of changes in mitochondrial structure and function, and produces a large amount of ROS, resulting in reduced β-oxidation and ATP depletion in mitochondria, aggravating oxidative stress, leading to cell death, further inducing NAFLD, and aggravating liver fibrosis. Mitochondria provide ATP for life activities, and their biological activity determines whether important metabolic pathways such as the TCA cycle and the electron transport chain (ETC) can proceed normally. SDH is the hub of the TCA cycle and ETC, catalyzing the oxidation of succinate to fumarate and using the electrons generated by oxidation to catalyze the reduction of ubiquinone to ubiquinol. SDH is the main component of respiratory chain complex II. Its structure is a highly conserved heterotetrameric protein. It belongs to cytochrome oxidase and is composed of four subunits of SDHA-D. It can be regulated by succinylation.

[0006] SIRT5 activity has a protective role in neuronal and cardiac physiology. In addition, SIRT5 exhibits a dichotomous role in cancer, acting as a context-dependent tumor promoter or suppressor. Studies have also shown that K. slooffiae promotes intestinal epithelial cell glycolysis by activating SIRT5-mediated lysine desuccinylation. At present, there are no reports on the role of SIRT5 inhibitors in alleviating abnormal liver fat metabolism, alleviating liver oxidative stress damage, and treating NAFLD. Summary of the invention

[0007] Purpose of the Invention

[0008] The present invention provides a new use of a SIRT5 inhibitor in preparing a drug for treating non-alcoholic fatty liver disease.

[0009] Technical Solution

[0010] SIRT5 is used as a target in the development, screening or preparation of therapeutic drugs for non-alcoholic fatty liver disease.

[0011] Application of SIRT5 inhibitors in the preparation of drugs for the treatment of non-alcoholic fatty liver disease.

[0012] The application is characterized in that: the SIRT5 inhibitor is NRD167, shSirt5, sgSirt5;

[0013] shSirt5:GCACATAGCCATCATCTCG;

[0014] The sequence of sgSirt5 is:

[0015] Fwd:caccgcgccatagccgagtgtgaga

[0016] Rev:aaactctcacactcggctatggcgc.

[0017]

[0018] NRD167, CAS No.: 2166487-23-4

[0019] The application is characterized in that: the SIRT5 inhibitor NRD167 can reduce the lipid level in the liver; the SIRT5 inhibitor NRD167 can reduce the lipid deposition in the liver cells caused by high fat in L02 cells. The SIRT5 inhibitor NRD167 can upregulate the ATP content in L02 cells; the SIRT5 inhibitor NRD167 can reduce the increase in ROS content in L02 cells caused by high fat; the SIRT5 inhibitor NRD167 can increase the SDH activity of L02 cells.

[0020] Beneficial Effects

[0021] The present invention first discovered that SIRT5 can be used as a drug target to screen drugs against non-alcoholic fatty liver disease. It was further found that the results of pharmacological experiments proved that the SIRT5 inhibitor (NRD167) has a good therapeutic effect on the high-fat-induced liver and L02 cell lipid deposition model. The present invention has proved through animal experiments that interfering with Sirt5 expression can significantly improve the liver lipid deposition phenomenon induced by a high-fat diet in mice, and inhibiting SIRT5 expression can reduce the TC content in the liver, which helps to reduce and improve the lipid deposition in the liver of mice. The present invention has proved through cell experiments that the SIRT5 inhibitor NRD167 can reduce the high lipid level and high ROS level in L02 cells caused by high fat, and significantly increase the ATP content and SDH activity. At the same time, the present invention has proved through cell experiments that Sirt5 overexpression leads to a decrease in the mitochondrial membrane potential of hepatocytes, aggravates the liver mitochondrial damage caused by a high-fat diet, and SIRT5 aggravates the liver fat deposition caused by high fat by inhibiting SDH expression. In the animal model, SIRT5 inhibitors have no obvious effect on metabolism under normal dietary conditions. Therefore, SIRT5 inhibitors (NRD167) are used to prepare drugs for the treatment of non-alcoholic fatty liver disease, which have definite and significant effects and have good prospects for medical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of Oil Red O staining of mouse liver tissue sections after treatment in Example 1;

[0023] Figure 2 is the weight measurement result of mice after treatment in Example 1;

[0024] Figure 3 is the measurement result of the food intake of mice after treatment in Example 1;

[0025] Figure 4The glucose tolerance test results of mice after treatment in Example 1, including the glucose tolerance line graph (A) and the area under the curve (B);

[0026] Figure 5 is the measurement result of TC in mouse liver after treatment in Example 1;

[0027] Figure 6 The results of Oil Red O staining of lipid droplets in L02 cells after treatment in Example 2, A is a photo, and B is a statistical result;

[0028] Figure 7 is the ATP detection result of L02 cells after treatment in Example 2;

[0029] Figure 8 This is the result of MitoSOX staining flow cytometry of L02 cells after treatment in Example 2;

[0030] Fig. 9 It is the detection of SDH activity in L02 cells after treatment in Example 2;

[0031] Fig.10 The JC-1 staining results of L02 cells after treatment in Example 2, A is a photo, and B is the statistical result;

[0032] Fig.11 This is the Western blot test result of L02 cells after treatment in Example 2;

[0033] Fig.12 The results of Oil Red O staining of lipid droplets in L02 cells after treatment in Example 2, A is a photo, and B is a statistical result;

[0034] Among them: *, p<0.05; **, p<0.01; ***, p<0.001; ns, no significant difference DETAILED DESCRIPTION

[0035] The present invention is further described by way of the following examples, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or change made to the present invention that is easily implemented by a person of ordinary skill in the art will fall within the scope of the claims of the present invention.

[0036] The materials used in the following examples are as follows:

[0037] 6-8 week old C57BL / 6J wild-type mice were purchased from Yangzhou University and kept in the Animal Experiment Center of China Pharmaceutical University. The blank control group (Vehicle) was given ordinary feed purchased from Nanjing Qinglongshan Animal Breeding Farm. The high-fat group (HFD) was fed a high-fat feed containing 45% fat purchased from Research DIETS, USA. Isopropanol was purchased from Nanjing Chemical Reagent Co., Ltd.; BCA protein quantification kit was purchased from Nanjing Novezan Biotechnology Co., Ltd.; BSA was purchased from Biofroxx; environmentally friendly tissue fixative was purchased from Nanjing Chemical Reagent Co., Ltd.; PBS buffer was purchased from Nanjing Chemical Reagent Co., Ltd.; sodium oleate was purchased from Industrial Biotechnology (Shanghai) Co., Ltd.; BSA (fatty free) was purchased from Shanghai Biotechnology Co., Ltd.; sodium palmitate was purchased from Sigma; glucose powder was purchased from Xilong Science; normal saline was purchased from Shanghai Biotechnology Co., Ltd.; penicillin-streptomycin solution was purchased from Shanghai Biotechnology Co., Ltd.; Sirt5 overexpression plasmid was purchased from Wuhan Miaoling Biotechnology Co., Ltd.; Oil Red O was purchased from Shanghai Biotechnology Co., Ltd.; DMEM was purchased from Gibco; trypsin was purchased from Gibco; PEI was purchased from Shanghai Qifa Experimental Reagent Co., Ltd.; fetal bovine serum was purchased from Biological Industries; enhanced ATP detection kit was purchased from Shanghai Biotechnology Co., Ltd.; MitoSOX was purchased from Thermo; JC-1 mitochondrial membrane potential detection kit was purchased from Shanghai Biotechnology Co., Ltd.; anti-SIRT5 antibody was purchased from SANTACRUZ, catalog number sc-271635; anti-GAPDH antibody was purchased from Proteintech, catalog number 60004-1-Ig; malonic acid was purchased from Aladdin; NRD167 was purchased from Selleck.

[0038] In the following embodiments:

[0039] Vehicle represents the blank control group; HFD represents the high-fat diet group; shSIRT5 represents the shSIRT5 lentivirus injection group; sgSirt5 represents the SIRT5 sgRNA transfection group; SIRT5in represents the SIRT5 inhibitor group (NRD167); Sirt5ov represents the Sirt5 overexpression group.

[0040] Example 1

[0041] 1. Construction of animal model

[0042] The mice were housed in a ventilated environment with a temperature of 24-25°C and a humidity of 50%-60%. They were allowed to eat and drink freely. Feed was added and drinking water was replaced in time. The bedding was changed and disinfected every week.

[0043] 1. Construction of shSirt5 lentiviral model (knockdown of Sirt5)

[0044] (1) Interference sequence shSirt5: GCACATAGCCATCATCTCG. Primer annealing, restriction digestion and plasmid purification, ligation, transformation, PCR verification of positive colonies, sequencing and plasmid extraction, and lentiviral packaging.

[0045] On the first day, 0.2% gelatin was added to 100 mm cell culture dishes. After covering for 20 min, the gelatin was removed and the cell culture dishes were placed in a cell clean bench for 15 min. 3.5 × 10 6 293T cells. On the second day, the 293T cell culture medium was replaced with serum-free medium, and the corresponding plasmids were transfected according to the ratio of 13μg Packagingsystem (psPAX2), 7μg Envelop plasmid (pM2G) and 20μg target gene in each 100mm cell culture dish. Prepare 2.5M NaCl, filter with a 0.22μm filter membrane, and dilute 2.5M NaCl with pure water to 150mM NaCl working solution. Each 100mm cell culture dish requires 800μL NaCl working solution. Add the corresponding volume of PEI and 150mM NaCl to a 15mL centrifuge tube at a ratio of 2:8 and vortex to mix. Each 100mm cell culture dish requires 950μL of the mixture. Take a 10mL centrifuge tube, add 950μL 150mM NaCl, psPAX2, pM2G and target gene plasmid in order, and finally add PEI and 150mM NaCl mixture, vortex mix evenly for 1min, let it stand in the cell clean bench for 10min, add all the mixture in the tube to 293T cells, and replace it with culture medium containing serum and penicillin-streptomycin solution after 3h. On the 4th day, 3×10 4 293T cells were added to the 24-well plate at a ratio of 100 cells / mL. On the 5th day, the supernatant in the 100 mm cell culture dish was collected and centrifuged at 50,000 g for 3 h. The centrifuge tube was taken out and placed on ice. The supernatant was discarded in the clean bench and 1% BSA was added to dissolve the precipitate. 1 μL and 0.1 μL of lentivirus were added to the 24-well plate and cultured for 3 more days. The green fluorescent protein GFP was observed under a fluorescence microscope.

[0046] (2) C57 male mice of similar body weight at 6-8 weeks old from the same batch were randomly divided into 3 groups: blank control group (Vehicle), high-fat group (scr+HFD) and tail vein injection of shSirt5 lentivirus group (HFD+shSirt5), with no less than 7 mice in each group. The ingredients of ordinary feed were carbohydrates (70 kcal%), protein (20 kcal%) and fat (10 kcal%); the ingredients of high-fat feed were fat (45 kcal%), carbohydrates (35 kcal%) and protein (20 kcal%). All mice were acclimated to the environment for 1 week before modeling. The Vehicle group was continuously fed with ordinary feed 1 week after tail vein injection of empty vector; the scr+HFD group was fed with high-fat feed for 20 weeks after tail vein injection of empty vector 1 week; the HFD+shSirt5 group was fed with high-fat feed for 20 weeks after tail vein injection of shSirt5 lentivirus 1 week.

[0047] After the modeling, the mice were killed, and the liver was cut from the same position and fixed in tissue fixative for 24 hours. Frozen sections were cut and stained with Oil Red O in the company. The results of Oil Red O staining are shown in Figure 1 As shown, compared with the scr+HFD group, the number of lipid droplet vacuoles and lipid droplets in the liver of mice in the HFD+shSirt5 group was significantly reduced, indicating that interfering with Sirt5 expression can significantly improve the phenomenon of hepatic lipid deposition.

[0048] 2. C57 male mice of similar weight at 6-8 weeks of age from the same batch were randomly divided into a blank control group (Vehicle) and an intraperitoneal injection group (SIRT5 inhibitor), with 8 mice in each group. All mice began modeling after 1 week of adaptation to the environment. The Vehicle group continued to be fed with ordinary feed for 4 weeks, and the SIRT5 inhibitor group was given ordinary feed for 4 weeks and intraperitoneally injected with SIRT5 inhibitor at a dose of 1 mg / kg / day. During the modeling period, the drug was administered once every 2 days at the same time, and the weight and food intake of the mice were recorded every 2 days. After the modeling was completed, liver tissue was taken for subsequent testing.

[0049] Mouse weight Figure 2 As shown, food intake Figure 3 As shown, there was no significant difference between the Vehicle group and the SIRT5 inhibitor group, indicating that SIRT5 inhibitors had no significant effect on metabolism under normal dietary conditions.

[0050] 2. Mouse intraperitoneal injection of glucose (IP-GTT) test

[0051] Prepare 20% glucose injection: 1g of glucose powder is dissolved in 5mL of normal saline. Before the experiment, the mice in the Vehicle group and SIRT5 inhibitor group constructed in Example 1 were fasted but not watered for 12h. Weigh and record the weight of the mice, use scissors to cut off about 1mm from the end of the mouse's tail, collect blood and record the blood sugar value at 0min. The mice were intraperitoneally injected with 20% glucose solution at a standard of 0.2mL / 20g and the timing was immediately performed. Subsequently, a Roche blood glucose meter was used to accurately record the blood sugar values ​​at 15, 30, 60, and 120min. After the experiment, the data was recorded and graphed.

[0052] The glucose tolerance line graph and area under the curve are shown in Figure 4 As shown, there was no significant difference between the Vehicle group and the SIRT5inhibitor group, indicating that under normal dietary conditions, SIRT5 inhibitors had no significant effect on blood sugar metabolism.

[0053] 3. Detection of total cholesterol (TC) content in mice

[0054] Take 20 mg of the liver tissue of the mice in the Vehicle group and SIRT5 inhibitor group constructed in Example 1, add 400 μL of anhydrous ethanol, homogenize with a homogenizer on ice, and load the sample after determining the protein concentration of the sample by the BCA method. Use the TC detection kit to perform the experiment, and add each group of samples to a 96-well plate according to the instructions. After mixing, incubate the well plate in a 37°C incubator for 10 minutes. Use an ELISA reader to measure the absorbance value of each well at a wavelength of 510 nm and calculate the TC content.

[0055] The results of the TC content determination are as follows Figure 5 As shown, SIRT5 inhibitor significantly decreased the TG content in the liver, indicating that SIRT5 inhibitor helps to improve lipid deposition in the liver of mice.

[0056] Example 2

[0057] 1. Construction of L02 cell model

[0058] 1. Reagent preparation

[0059] (1) Normal culture medium: add 10 mL of fetal bovine serum and 1 mL of penicillin-streptomycin solution to 89 mL of high-glucose DMEM medium; serum-free culture medium: add 1 mL of penicillin-streptomycin solution to 99 mL of high-glucose DMEM medium; double serum culture medium: add 20 mL of fetal bovine serum and 1 mL of penicillin-streptomycin solution to 79 mL of high-glucose DMEM medium.

[0060] (2) High-fat culture medium

[0061] 1% BSA culture medium: Add 1 g BSA to 99 mL high-glucose DMEM culture medium, mix evenly on a shaker at room temperature, filter and sterilize using a 0.22 μm filter membrane, add 1 mL of double antibody, and store at 4°C.

[0062] Free fatty acid culture medium: Add 0.0408 g sodium oleate and 0.0184 g sodium palmitate to 3 mL PBS to make the concentration of the mother solution 200 mmol / L, adjust the pH to 7.2, add high-glucose DMEM culture medium to 100 mL, filter and sterilize using a 0.22 μm filter membrane, and dilute to 1 mmol / L before use in the experiment.

[0063] (3) PEI transfection reagent

[0064] Weigh 0.1 g PEI MAX powder and dissolve it in 90 mL pure water. Adjust the pH to 7.0. Add pure water to the scale in a 100 mL volumetric flask. Filter with a 0.22 μm filter membrane and store at 4 °C away from light. Before the experiment, place the PEI transfection reagent at room temperature for 1 hour before use for transfection.

[0065] (4) Construction of sgSirt5 (knockdown of Sirt5) using CRISPR-Cas9 technology

[0066] Design CRISPR-sgRNA primer sequences

[0067] Fwd:caccgcgccatagccgagtgtgaga

[0068] Rev:aaactctcacactcggctatggcgc

[0069] Primer annealing, restriction enzyme digestion and plasmid purification, ligation, transformation, PCR verification of positive colonies, sequencing and extraction of sgSirt5 plasmid.

[0070] (5) Preparation of cell Oil Red O mother solution: Add 0.25 g of Oil Red O powder to 50 mL of isopropanol and fully dissolve it to make the mother solution concentration 5 g / L. Store it at 4°C away from light. Before the experiment, dilute the Oil Red O mother solution with pure water in a ratio of 3:2 and filter it with a 0.22 μm filter membrane to obtain the Oil Red O working solution.

[0071] 2. L02 cell SIRT5 inhibitor modeling and detection

[0072] (1) L02 cells were divided into ctrl, OA, and OA+SIRT5 inhibitor groups. After serum-free culture, the control group was cultured in serum-free medium for 12 h and in 1% BSA medium for 24 h. In the OA+SIRT5 inhibitor group, 5 μM SIRT5 inhibitor was added to serum-free medium for 12 h, and a high-fat model was established for 24 h. The culture medium of the high-fat group was a mixture of equal volumes of free fatty acid medium and 1% BSA medium.

[0073] (2) L02 cells were divided into ctrl and SIRT5 inhibitor groups. The ctrl group was cultured with normal culture medium for 24 h, and the SIRT5 inhibitor group was cultured with normal culture medium supplemented with 5 μM SIRT5 inhibitor for 24 h.

[0074] (3) Oil Red O staining

[0075] Remove the culture medium from the plate, wash twice with PBS, add appropriate amount of polymethanol and fix the cells on a shaker for about 30 minutes, remove the fixative, wash twice with PBS, add appropriate amount of Oil Red O working solution, stain at room temperature for 10 minutes, prepare 60% isopropanol for decolorization, and then wash twice with pure water. After the plate is naturally dried, add 10% glycerol to the wells, observe the cells under an inverted microscope and take pictures. Figure 6 As shown, compared with the ctrl group, OA could cause L02 cells to produce a large number of lipid droplets. Compared with the OA group, the number of lipid droplets in the OA+SIRT5 inhibitor group was significantly reduced, indicating that inhibiting SIRT5 expression can alleviate lipid deposition in hepatocytes caused by high fat.

[0076] (4) ATP content detection

[0077] The Beyotime Enhanced ATP Detection Kit was used for detection, and the standards and ATP detection solutions of various concentrations were prepared according to the instructions. The original culture medium of L02 cells was aspirated, washed twice with PBS, ATP lysis solution was added to the cells, and the cells were collected into EP tubes using a cell scraper. Centrifuged at 4°C, 12000rpm for 5min, and the supernatant was collected. The ATP detection solution was dropped into the well plate, allowed to stand at room temperature for 3min, and then the standards and samples were added, and the chemiluminescence value was immediately determined using an enzyme marker. The protein concentration of the samples was detected by the BCA quantitative method, and the ATP content of each sample after excluding the interference of protein concentration was calculated according to the standard curve.

[0078] ATP content test results are as follows Figure 7 As shown, compared with the ctrl group, the cellular ATP content in the SIRT5 inhibitor group was significantly increased, indicating that SIRT5 inhibitors promoted mitochondrial biogenesis in the liver and its biological functions, leading to increased ATP synthesis.

[0079] (5) Flow cytometry detection of mitochondrial reactive oxygen species (MitoROS), the main source of intracellular ROS

[0080] According to the instructions, dilute the MitoSOX dye solution to an appropriate concentration of working solution, remove the original culture medium, wash twice with PBS, add an appropriate amount of EDTA-free trypsin, let stand at room temperature for about 1 minute, add an equal volume of culture medium for neutralization after the cell morphology changes, gently blow the cells off, centrifuge at 2000rpm for 5 minutes, remove the supernatant, use MitoSOX working solution to gently blow the cell pellet, incubate at 37℃ for 20 minutes, centrifuge at 2000rpm for 5 minutes, discard the supernatant, resuspend the cell pellet with PBS, centrifuge at 2000rpm for 5 minutes, remove the supernatant, and resuspend the cells with PBS again for subsequent detection. Use a 300-mesh screen to filter the cells to be analyzed into the flow tube, select the appropriate fluorescence channel and the number of collected cells according to the experimental requirements, and load each group of cells in turn after setting the parameters. Save the data after the experiment, and use FlowJo_V10 software for data analysis.

[0081] The streaming results are as follows Figure 8 The results showed that compared with the OA group, the red fluorescence produced by MitoSOX was significantly weakened after the addition of SIRT5 inhibitor to L02 cells, indicating that SIRT5 inhibitor can reduce the increase in intracellular ROS content caused by high fat and attenuate the mitochondrial oxidative stress damage of L02 cells.

[0082] (6) SDH activity detection

[0083] Succinate dehydrogenase (SDH) is one of the hubs connecting oxidative phosphorylation and electron transfer. It can provide electrons for the aerobic and energy-producing respiratory chains of eukaryotic cell mitochondria and a variety of prokaryotic cells. Its activity can generally be used as an indicator to evaluate the degree of operation of the tricarboxylic acid cycle.

[0084] The SDH kit was used for detection, and each 1×10 6Add 200μL of reagent 1 and 2μL of reagent 3 to each cell, place the sample on ice for ultrasonication, and ultrasonicate for 5s and stop for 5s at 20% power, for a total of 20s. Centrifuge at 4℃, 600g for 5min, discard the precipitate, centrifuge the supernatant again at 4℃, 11000g for 10min, and discard the supernatant. Add 200μL of reagent 2 and 2μL of reagent 3 to the precipitate, place the sample on ice for ultrasonication, with a power of 20%, ultrasonicate for 3s and stop for 10s, for a total of 90s. Add 10μL of sample, 10μL of reagent 5 and 180μL of reagent 4 to the 96-well plate, mix and immediately record the absorbance A1 at 600nm at 20s, and measure the absorbance A2 at 600nm again at 1min 20s, and calculate ΔA=A1-A2. Quantify the sample protein concentration at 562nm, SDH activity=1904×ΔA÷sample protein concentration.

[0085] The results of SDH activity were as follows Fig. 9 As shown, SIRT5 inhibitors significantly increased SDH activity.

[0086] 3. Modeling and detection of Sirt5 overexpression (Sirt5 ov) in L02 cells

[0087] (1) Cell PEI transfection

[0088] Use the prepared PEI and Sirt5ov plasmid for transfection. 5 According to the ratio of 1.5 μg plasmid to 4.5 μL PEI per cell, the plasmid was first accurately added to the bottom of the EP tube, and then PEI that had been placed at room temperature for 1 hour was slowly added. After standing for 20 minutes, serum-free culture medium was added to the complex and cultured in a 37°C cell culture incubator.

[0089] (2) L02 cells were divided into ctrl, OA, and OA+Sirt5ov groups. After serum-free culture, the Ctrl group was transfected with pcDNA3.1 for 12 hours and cultured in 1% BSA medium for 24 hours; the OA group was transfected with pcDNA3.1 for 12 hours, and free fatty acid medium and 1% BSA medium were mixed in equal volumes and cultured for 24 hours; the OA+Sirt5ov group was transfected with Sirt5ov for 12 hours, and free fatty acid medium and 1% BSA medium were mixed in equal volumes and cultured for 24 hours.

[0090] (3) JC-1 staining

[0091] Dilute JC-1 staining solution to an appropriate concentration of working solution and prepare staining buffer according to the instructions. Aspirate the original culture medium, wash with PBS three times, add JC-1 staining working solution, incubate in a 37°C incubator for 20 minutes, wash with staining buffer twice, add appropriate amount of culture medium, observe the cells under an inverted microscope and take pictures.

[0092] JC-1 results are as follows Fig.10 As shown, compared with the OA group, the red fluorescence stimulated by Sirt5ov transfection in L02 cells was significantly weakened, indicating that Sirt5 overexpression led to a decrease in mitochondrial membrane potential of hepatocytes and aggravated the liver mitochondrial damage caused by a high-fat diet.

[0093] 4. L02 cell sgSirt5 modeling and detection

[0094] (1) L02 cells were divided into negative control (NC) and sgSirt5 groups. The NC group was transfected with LentiCRISPR V2 plasmid, and the sgSirt5 group was transfected with sgSirt5 plasmid. The prepared PEI and plasmid were used for transfection. Each 5×10 5 The plasmid was accurately added to the bottom of the EP tube according to the ratio of 1.5 μg plasmid to 4.5 μL PEI per cell. Then PEI that had been placed at room temperature for 1 hour was slowly added. The mixture was allowed to stand for 20 minutes. Serum-free culture medium was added to the complex. After 3-6 hours, an equal volume of double serum was added and the mixture was cultured in a 37°C cell culture incubator for 24 hours.

[0095] Western blot was used to detect the expression of SIRT5 protein. The results of Western blot detection are as follows Fig.11 As shown, it showed that the sgSirt5 group successfully inhibited Sirt5 expression.

[0096] (2) L02 cells were divided into NC, OA, OA+sgSirt5, and OA+sgSirt5+Malonate (malonic acid, a competitive inhibitor of SDH) groups. After serum-free culture, the NC and OA groups were transfected with LentiCRISPR V2 plasmids, and the OA+sgSirt5 and OA+sgSirt5+Malonate were transfected with sgSirt5 plasmids. Malonate was added 12 hours after transfection, and the NC group was cultured with 1% BSA medium for 24 hours; the OA groups were cultured with equal volumes of free fatty acid medium and 1% BSA medium mixed for 24 hours.

[0097] Oil red O staining results Fig.12 As shown, compared with the OA group, the number of lipid droplets in the OA+sgSirt5 group was significantly reduced, and the lipid droplets in the OA+sgSirt5+Malonate group increased again, indicating that inhibiting Sirt5 expression is beneficial to reducing liver lipid deposition, and on this basis, inhibiting SDH activity weakened the therapeutic effect brought by inhibiting Sirt5, proving that SIRT5 aggravates high-fat-induced liver fat deposition by inhibiting SDH expression.

Claims

1. SIRT5 is used as a target in the development, screening or preparation of therapeutic drugs for non-alcoholic fatty liver disease.

2. Use of a SIRT5 inhibitor in the preparation of a drug for the treatment of non-alcoholic fatty liver disease, characterized in that: The SIRT5 inhibitor is NRD167, shSirt5 or sgSirt5; Wherein: The structural formula of NRD167 is as follows: Nucleotide sequence of shSirt5: gcacatagccatcatctcg; The nucleotide sequence of sgSirt5 is: Fwd:caccgcgccatagccgagtgtgaga Rev:aaactctcacactcggctatggcgc.

Images