A kind of Liumei Morchella Guizhou DL02 and its application

Abstract

The present invention relates to the field of edible fungi and specifically discloses a Morchella sextelata strain, Qian DL02, which has been deposited with the China Center for Type Culture Collection and is designated CCTCC NO: M2022899. The present invention also discloses uses of Qian DL02 in the fields of food and beverages. The strain Qian DL02 has light brown ascocarps, a well-shaped mushroom, and high commercial value. Furthermore, the strain has the advantages of a short cultivation cycle, high yield, and strong resistance to heavy metal chromium stress.

Description

Technical Field

[0001] The invention belongs to the field of edible fungi, and in particular relates to a Morchella liumei strain and also relates to uses of the strain. Background Art

[0002] The Morchella mushroom, a member of the Morchaceae family, gets its name from its cap, which resembles a sheep's stomach. It is a prized edible and medicinal mushroom. Grown in the humus of broadleaf or mixed coniferous and broadleaf forests, it is found worldwide and is found in 28 provinces, municipalities, and autonomous regions in my country. Morels are not only delicious and unique in flavor, but also rich in nutritional value, boasting high protein content, essential amino acids and vitamins, trace elements, carbohydrates, and a diverse range of fatty acids. The fruiting bodies of morels can also be used as medicine. According to the "Compendium of Materia Medica," morels are neutral in nature, sweet and cold in flavor, and non-toxic. They offer benefits such as gastrointestinal health, aiding digestion, reducing phlegm and regulating qi, tonifying the kidneys, and nourishing the brain and mind. They contain polysaccharides that inhibit tumors, as well as antibacterial and antiviral active ingredients. They have been used as a premium nutritional supplement in Europe and the United States.

[0003] Six-sister Morchella (Morchella sextelata) belongs to a species of the genus Morchella and is one of the main cultivated morels in my country. At present, the main problems in the cultivation of six-sister morels are: (1) the cultivation cycle is long, which is generally about 120 days. Morels are seasonally cultivated edible fungi. Fresh mushrooms are often put on the market in large quantities from February to March each year. The price of fresh mushrooms put on the market before the Spring Festival is generally higher than that after the Spring Festival, which can bring higher commercial value. Mushrooms produced before the Spring Festival often require a shorter cultivation cycle. (2) In some areas of southwest my country, the content of heavy metal chromium in the soil exceeds the standard, which has an adverse effect on the growth of morels and directly affects the yield of morels. Therefore, cultivating morel strains that are resistant to heavy metal chromium stress, have a short cultivation cycle and high yield is crucial to the stable development of the morel industry in southwest my country.

[0004] my country's vast primeval forests, stretching from south to north, are rich in wild edible mushrooms, including wild morels. Domesticating wild morels not only enriches people's dining tables and meets their needs for a higher standard of living, but also leverages their medicinal and edible properties to develop higher-value-added foods, beverages, and health products, improving people's well-being while increasing farmers' incomes and export earnings. Summary of the Invention

[0005] The present invention aims to provide a Morchella liumei strain with a short fruiting period, strong resistance to heavy metal chromium stress and high yield.

[0006] Another object of the present invention is to provide uses of the above-mentioned Morchella liumei strain.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The present invention provides a Morchella sextelata strain Guizhou DL02, which is preserved in the China Center for Type Culture Collection, with a preservation number of CCTCC NO: M2022899 and a preservation date of June 15, 2022.

[0009] The present invention also provides the use of the strain Qian DL02 in food or health products.

[0010] The present invention also provides a food or health product, which contains the strain Qian DL02 or an extract of Qian DL02.

[0011] The present invention also provides the use of the strain Qian DL02 in beverages.

[0012] The present invention also provides a beverage containing the above-mentioned strain Qian DL02 or an extract of Qian DL02.

[0013] The present invention also provides the use of the strain Qian DL02 in preparing medicines for improving human immunity.

[0014] The present invention also provides a genetically engineered Morchella esculenta, wherein the starting strain of the genetically engineered Morchella esculenta is the above-mentioned strain Qian DL02.

[0015] The present invention has the following advantages and beneficial technical effects:

[0016] (1) The ascocarps of the strain Qian DL02 of the present invention are light brown, have a good mushroom shape, and have high commercial value. (2) The strain Qian DL02 of the present invention has a short cultivation cycle. Under traditional field cultivation, the cycle from sowing to mushroom harvesting of Qian DL02 is 80 to 85 days. The cultivation cycle of other existing six-sister morel strains is generally around 100 to 130 days. A short cultivation cycle means less labor cost, and is also conducive to mushroom production before the Spring Festival. The price of fresh morel mushrooms before the Spring Festival is higher than that after the Spring Festival, and the corresponding economic benefits are higher. (3) The strain Qian DL02 of the present invention has a high yield. The average yield of Qian DL02 agricultural cultivation is 529.08 kg / 667 m 2 , while the yield of other existing six-sister morel strains is only 350-450kg / 667m 2About, that is, the yield of the strain Qian DL02 of the present invention is significantly higher than that of other existing cultivated Morchella esculenta strains. (4) The strain Qian DL02 of the present invention has a strong resistance to heavy metal chromium stress. Under different chromium concentration stresses, the solid seed mycelium growth rate or liquid seed mycelium biomass of Qian DL02 is significantly higher than that of other Morchella esculenta strains, and its resistance to heavy metal chromium stress is higher than that of other main cultivated strains. (5) The breeding process of the strain Qian DL02 of the present invention is multi-spore self-pollination. After mating type detection, the strain has a double mating type. Compared with the strain separated by traditional tissues, its genetic material is more complete and its traits are more stable.

[0017] Biodeposit: The present invention's Morchella sextelata strain, Qian DL02, was cultivated by the inventors from wild Morchella collected in Bijie City, Guizhou Province, and then screened and cultured through multi-spore selfing. This strain is deposited with the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with the deposit number CCTCC NO: M2022899 and the deposit date June 15, 2022. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 .Photo of the fruiting body of the strain Guizhou DL02 of the present invention.

[0019] Figure 2 . Phylogenetic tree diagram of the strain Guizhou DL02 of the present invention.

[0020] Figure 3 Comparative ISSR fingerprints of the present strain Guizhou DL02 and other Morchella liliumei strains; M is the molecular weight standard; 1 is "Guizhou DL02"; 2 is "Guizhou Morchella No. 1"; 3 is "Lefeng No. 2"; 4 is "Faxing No. 1". DETAILED DESCRIPTION

[0021] The present invention is further described below by way of examples, which do not constitute any limitation to the present invention. Unless otherwise specified, the biochemical reagents used in the following examples are all conventional commercial biochemical reagents.

[0022] Example 1 Breeding process of the strain Guizhou DL02 of the present invention

[0023] (1) Collection and isolation of wild Morchella strains

[0024] In April 2017, the inventors discovered a wild Morchella fruiting body in the Qixingguan area of ​​Bijie City, Guizhou Province. Mycelium (strain) was obtained by isolating the fruiting body tissue. Then, through morphological characteristics, ITS-PCR detection, phylogenetic tree construction and ISSR fingerprint map comparison, as well as gene fragment size and sequence, it was identified as belonging to Morchella sextelata. The strain after tissue separation was cultivated and fruited. Then, the strain was isolated from the fruiting body with good flower shape and inoculated on PDA medium for cultivation. The fruiting test was carried out at the experimental base of Guizhou Academy of Agricultural Sciences. After fruiting, the ascospores were collected and the subsequent strain selection was carried out through multispore self-pollination.

[0025] (2) Strain selection

[0026] Genomic DNA was extracted according to the DNA extraction kit instructions (Beijing Kangwei Century Co., Ltd.). PCR amplification was performed using two known primer combinations, P8-FF / P8-5R and P10-2F / P10-2R, to detect the mating type genes MAT1-1 and MAT1-2 of the monosporic strain. The primer sequences are as follows:

[0027] P8-5F: 5'-TTACCTTACTGGACTGGTTCGTGAG-3';

[0028] P8-5R: 5'-TGGAATGTCTGTGATTGAGGCTGTG-3'.

[0029] P10-2F: 5'-GGCCAGAACAGATGCTCGAAGAAGC-3';

[0030] P10-2R: 5'-GTGGCAACTCCCAAAGCATGATCAA-3'.

[0031] The PCR reaction system was as follows: 20 μL total volume: 1 μL DNA template (20-50 ng / μL), 2 μL 10× Buffer (with Mg2+), 0.5 μL 2.5 mM dNTPs, 0.2 μL 5 U / μL DNA polymerase, 0.5 μL each of 0.2 μM primers, and double-distilled water to 20 μL. Amplification reaction conditions: initial denaturation at 94°C for 5 min; 30 cycles of 94°C for 30 s, 63°C for 30 s, and 72°C for 3 min; and extension at 72°C for 10 min.

[0032] Electrophoresis of the PCR amplification products revealed that single-spore strains with MAT1-1 but no MAT1-2 gene bands were classified as MAT1-1. Conversely, single-spore strains with MAT1-2 but no MAT1-1 gene bands were classified as MAT1-2. Double-mating-type strains were selected and cultured for several generations. Comparative tests were conducted on strains with stable genetic traits, including rapid mycelial growth, high yield, and resistance to heavy metal chromium stress. This strain was identified as Qian DL02, demonstrating stable genetic traits, rapid mycelial growth, high yield, and the ability to maintain a high growth rate even under heavy metal chromium stress.

[0033] Example 2 Classification and Identification of Morchella Strain Guizhou DL02 of the Present Invention

[0034] (1) Morphological identification of Guizhou DL02:

[0035] The ascocarps of the Morchella guineensis (Qian DL02) are light brown, 6–13 cm tall. The ascocarps are 4–9 cm long and 2–4 cm thick, conical in shape, with a blunt apex and a lower margin connected to the stipe. The ascocarps have well-developed longitudinal ridges and shallow transverse ridges, covered with short hairs. The ridges intersect to form pits, which are flat when young and sharpen with maturity. The stipe is 2–6 cm long and 2.5–4 cm thick, white or milky white, cylindrical or swollen at the base, with white hairs at the base. The asci are columnar, each containing eight spores arranged in a single longitudinal arrangement. According to the description and photos of the morphological characteristics of the Morchella sextelata (Liu Wei, Zhang Ya, et al., Jilin Science and Technology Press, 2017) on page 64, Qian DL02 shares the same morphological characteristics as the Morchella sextelata. Therefore, Qian DL02 belongs to the Morchella sextelata species.

[0036] (2) Molecular biological classification and identification of Guizhou DL02

[0037] The genomic DNA of Qian DL02 was extracted using the Plant Genomic DNA Extraction Kit CW0531 (Beijing Kangwei Century Company), and PCR amplification was performed using universal primers ITS1 and ITS4. The universal primer sequences are as follows:

[0038] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0039] ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0040] The ITS-PCR amplification reaction system is as follows: total volume 20 μL: 1 μL of 20-50 ng / μL DNA template, 10× Buffer (with Mg 2+)2μL, 2.5mM dNTP 0.5μL, 5U / μl DNA polymerase 0.2μL, 0.2μM primers 0.5μL each, add double distilled water to 20μL. The ITS-PCR reaction conditions are: pre-denaturation 94℃5min; 94℃1min, 60℃1min, 72℃75s, 30 cycles; 72℃ extension 10min. As a result, a DNA molecule fragment with a fragment length of 730bp was amplified. It was sent to Sangon Biotech Co., Ltd. for sequencing, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 1. After BLAST comparison, the ITS sequence of the strain Guizhou DL02 of the present invention has the highest similarity with the ITS sequence of Morchella liumei, and the similarity can reach up to 99.73%, and a phylogenetic tree was constructed. Results (see Figure 2 ) The strain Guizhou DL02 of the present invention belongs to the species Morchella sextelata of the genus Morchella in classification; and is different from other Morchella sextelata strains and is a new Morchella sextelata strain.

[0041] Example 3 ISSR identification comparison test of the present invention's strain Qian DL02 and other Morchella spp.

[0042] (1) Test materials: (1) the strain “Qian DL02” of the present invention; (2) “Qian Morchella No. 1” (the six-sister Morchella strain approved by Guizhou Province in 2022); (3) “Lefeng No. 2” (the six-sister Morchella strain approved by Guizhou Province in 2023); (4) “Faxing No. 1” (the six-sister Morchella strain promoted for cultivation in Qiandongnan, Guizhou).

[0043] (2) Test methods

[0044] The genomic DNA of “Qian DL02”, “Qian Morchella No. 1”, “Lefeng No. 2” and “Faxing No. 1” were extracted using the new plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company). According to the agricultural industry standard of the People's Republic of China NY / T 1730-2009 “ISSR method for authenticity identification of edible fungi”, 20 ISSR primers (see Table 1) were selected for PCR amplification. The primer sequences are as follows:

[0045] Table 1 ISSR random primer sequences

[0046] Primer name Primer sequence 5'-3' Primer name Primer sequence 5'-3' P1 TGCACACACACACAC P11 GAGAGAGAGAGAGAGAAC P2 GTGACACACACACAC P12 AGAGAGAGAGAGAGAGGC P3 GTGACGACTCTCTCTCTCT P13 TCTCTCTCTCTCTCTCCG P4 GGATGCAACACACACACAC P14 ACACACACACACACACACCG P5 CGTGTGTGTGTGTGT P15 GTGTGTGTGTGTGTGTTA P6 AGTGTGTGTGTGTGT P16 TGTGTGTGTGTGTGTGGA P7 CCAGTGGTGGTGGTG P17 ACACACACACACACAC P8 GGAGTGGTGGTGGTG P18 ACACACACACACACACACC P9 AGAGAGAGAGAGAGAGG P19 ACACACACACACACACACCT P10 GAGAGAGAGAG AGAGAC P20 ACACACACACACACACACCTG

[0047] The ISSR-PCR amplification reaction system is as follows: a total PCR reaction volume of 20 μL containing 1× PCR reaction buffer, 0.2 mmol / L dNTPs, 1 U Taq DNA polymerase, 0.4 pmol / L primers, 20 ng-50 ng template DNA, and sterile double-distilled water to 20 μL. The ISSR-PCR amplification reaction conditions are: 94°C pre-denaturation for 4 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 5°C below the primer Tm for 45 seconds, extension at 72°C for 2 minutes, for a total of 35 cycles, and extension at 72°C for 7 minutes, followed by storage at 4°C.

[0048] Results (see Figure 3 ) From the ISSR pattern amplified with P9 as primer, it can be seen that the specific bands of the strain Qian DL02 of the present invention and the other three strains are significantly different, indicating that the strain Qian DL02 of the present invention is a new strain of Morchella sextelata.

[0049] Example 4 Cultivation test of strain Guizhou DL02 of the present invention

[0050] Follow these steps:

[0051] (1) Stock culture: Use a sterilized and cooled inoculating hook to inoculate the 5 mm diameter Guizhou DL02 strain (this strain has been deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with the deposit number CCTCC NO: M2022899) in the center of the stock culture medium plate, and culture at 20°C and a relative humidity of 60-75%. After about 3 days, the mycelium will cover the plate. Continue to culture under dark conditions for 7 days, at which time a large number of sclerotia will form on the plate, and the Guizhou DL02 stock culture is obtained; Preparation method of stock culture medium: Peel 200 g of potatoes and cut them into 1.5 cm cubes, put them into 800 mL of pure water and boil for 20 min, filter through 3 layers of gauze to obtain the extract, then add 20 g of glucose, 18 g of agar, 1 g of potassium dihydrogen phosphate, and 0.5 g of magnesium sulfate, mix well, and then dilute to 1000 mL with pure water, sterilize at 121°C for 20 min; pour into a 9 cm diameter plate and set aside.

[0052] (2) Stock culture: 5 pieces of the Qian DL02 mother culture obtained in step (1) with a diameter of 5 mm were scooped from the sterilized and cooled spawn, and inoculated onto the stock culture medium for culture. The culture was carried out at 18° C., a relative humidity of 60-75%, and in the dark. The bag was filled in about 7 days. The culture was continued for about 14 days until the mycelium was ripe and the mycelium filled the flask. At this time, a large number of sclerotia were formed in the flask, and the Qian DL02 stock culture was obtained. The components and their weight percentages of the stock culture medium were as follows: 80% wheat, 13% humus, 5% rice husk, 1% gypsum, and 1% calcium carbonate. The water content of the culture medium was 60-65%. The components were mixed and stirred evenly. The bags were placed in a polypropylene plastic bag (16 cm×35 cm×0.005 cm), tied, and sterilized at 121° C. for 2 hours for use.

[0053] (3) Cultivation of cultivars: Use a sterilized and cooled spawn shovel to dig out the original seed of Guizhou DL02 obtained in step (2) at a mass ratio of 1:30 and inoculate it on the original seed culture medium for cultivation. Cultivate at 18°C, relative humidity of 60-75%, and in the dark for 20 days until the mycelium fills the flask and a large number of sclerotia are formed in the flask, thereby obtaining the Guizhou DL02 cultivar.

[0054] (4) Opening furrows for sowing and covering with film: Select arable land in a greenhouse with a pH of 6-6.5 and fine soil. After clearing weeds, plow the soil. Open furrows before sowing. The furrow width is 80-100 cm, and a 50 cm walkway is left between furrows. The soil moisture content is 40-45%. Break the cultivated seeds obtained in step (3) into small particles and evenly spread them on the furrow surface. Sow 400 bags of cultivated seeds per mu. Immediately after sowing, evenly cover with a layer of soil about 2-3 cm thick.

[0055] (5) Mycelium cultivation and placement of nutrient bags: After sowing, the maximum temperature in the greenhouse is controlled at 15-20°C, the relative humidity is 60-70%, the soil moisture content is 45%, and the light intensity is 50-100 lux. After 5 days, the mycelium will cover the entire bed and form a white "fungus frost". Then, the nutrient bags are placed. Each bag is cut with two slits parallel to the long side of the bag using a clean knife. The cut surfaces are placed close to the soil on the bed. 2,000 nutrient bags are evenly placed per mu of land. After the nutrient bags are placed, they are covered with black polypropylene film with air holes. The film should be placed in the field for about 45-50 days, and the black polypropylene film is removed. The preparation method of the nutrient bags is as follows: 90% wheat, 9% rice husks, and 1% quicklime are mixed uniformly according to the weight percentage ratio, and the water content is 60-65%. The mixture is stirred evenly. The cultivation bag uses a polypropylene plastic bag (12cm×24cm×0.005cm) specification. Put the mixed nutrients into the bag, tie the bag with a polypropylene rope, sterilize it at 121℃ for 1 hour, and then cool it to room temperature.

[0056] (6) Primordial differentiation: After removing the ground film in step (5), water is sprayed to make the soil moisture content reach 50-55%. During the fruiting body growth stage, the maximum temperature in the greenhouse is controlled between 10-20°C and the minimum temperature is not lower than 3°C. The relative humidity of the air is 75-85%, and the light intensity is 200-300 lux. Natural ventilation is carried out in the greenhouse to induce the formation of primordia. A large number of primordia will be formed about 5 days after spraying water. After the primordia are formed, continued cultivation will form about 1-2 cm young mushrooms.

[0057] (7) Management and harvesting of mushrooms: The maximum temperature in the greenhouse should be controlled at 10-20°C, the relative humidity at 70-80%, the soil moisture at 40-45%, and the light intensity at 500-1000 lux. The greenhouse should be naturally ventilated. When the temperature is high, measures such as spraying, ventilation through the greenhouse side windows, and covering the roof with reflective film should be used to reduce the temperature. It takes about 20-25 days from the formation of the primordium to the maturity of the fruiting body. When the fruiting body grows to 5-8 cm in height, the ridges and pits of the cap are clearly defined, and the ascocarp has basically expanded, it is mature and should be harvested in time.

[0058] Results (see Figure 1 ) The ascocarps of the six-sister morel strain Guizhou DL02 of the present invention are light brown, with a good mushroom shape, a compact fruiting body texture, and a delicate taste. The commodity value is high. Secondly, it can be seen from Table 2 that the cultivation cycle of the morel strain Guizhou DL02 of the present invention is short (see Table 2), and the cycle from sowing to mushroom harvesting is 80 to 85 days, while the cultivation cycle of "Guizhou Morel No. 1", "Lefeng No. 2" and "Faxing No. 1" is 100 to 130 days, that is, the cultivation cycle of the strain Guizhou DL02 of the present invention is 20 to 50 days shorter than that of other six-sister morels; the average yield of Guizhou DL02 agricultural cultivation is 529.08 kg / 667 m 2 The above test results show that the strain Guizhou DL02 of the present invention has a shorter cultivation period and higher yield than other existing main cultivated six-sister morel varieties.

[0059] Table 2 Comparative test results of the cultivation cycle and yield of the strain Guizhou DL02 of the present invention and other Morchella spp.

[0060] Guizhou DL02 Guizhou Morel No. 1 Lefeng No. 2 Faxing No. 1 Cultivation period (d) 80～85 100～110 110～130 100～110 <![CDATA[Yield (kg / 667m 2 )]]> 529.08 330.46 346.2 357.6

[0061] Example 5 Comparative test on the heavy metal chromium stress resistance of the solid strain of the present invention Guizhou DL02

[0062] (1) Test strains: (1) the strain of the present invention "Qian DL02"; (2) "Qian Morchella No. 1" (the six-sister Morchella strain approved by Guizhou Province in 2022); (3) "Lefeng No. 2" (the six-sister Morchella strain approved by Guizhou Province in 2023); (4) "Faxing No. 1" (the six-sister Morchella strain promoted for cultivation in Qiandongnan, Guizhou).

[0063] (2) Test methods:

[0064] (1) Different concentrations of chromium standard solution were added to PDA culture medium. The final chromium concentrations of the culture medium were 2, 4, 6, 8, and 10 mg / L, respectively. PDA culture medium without chromium standard solution was used as blank control (CK). A total of 26 treatments were performed. The pH value of all culture media was adjusted to 7. Three replicates were set at different concentrations. The test Morchella liumei fungus blocks were inoculated and cultured in an incubator at 23°C. The mycelial growth in culture medium with different concentrations of heavy metal chromium was recorded.

[0065] (2) Determination of hyphae growth rate: After the six-sister morels were inoculated on the solid culture medium, the culture was stopped when any treatment filled the plate. The growth time was recorded, the plate was photographed, and the colony diameter of each treatment was measured by the cross-hatch method. The average daily growth rate of the hyphae was calculated by measuring the hyphae length on the plate.

[0066] The results (see Table 3) showed that the mycelial growth rate of the strain Qian DL02 under different concentrations of heavy metal chromium stress was significantly higher than that of other strains, indicating that the tolerance of Qian DL02 to heavy metal chromium stress was higher than that of other main cultivated strains.

[0067] Table 3 Comparative test results of mycelial growth rate of the solid strain Guizhou DL02 of the present invention at different chromium concentrations

[0068]

[0069] Example 6 Heavy metal chromium stress resistance test of the liquid strain of the present invention Qian DL02

[0070] (1) Test strains: (1) the strain of the present invention "Qian DL02"; (2) "Qian Morchella No. 1" (the six-sister Morchella strain approved by Guizhou Province in 2022); (3) "Lefeng No. 2" (the six-sister Morchella strain approved by Guizhou Province in 2023); (4) "Faxing No. 1" (the six-sister Morchella strain promoted for cultivation in Qiandongnan, Guizhou).

[0071] (2) Test methods:

[0072] (1) Different concentrations of chromium standard solution were added to PDB liquid culture medium. The final chromium concentrations in the culture medium were 2, 4, 6, 8, and 10 mg / L, respectively. PDB liquid culture medium without chromium standard solution was used as the blank control (CK). The pH value of all culture media was adjusted to 7. Each bottle of culture medium was inoculated with different Morchella serrata strains for cultivation. Six Morchella serrata blocks with a diameter of 5 mm were inoculated and cultured in a shaking incubator at 23°C and 150 rpm in the dark for 5 days. Three replicates were set for each treatment. The mycelial growth in the culture medium with different concentrations of heavy metal chromium was recorded.

[0073] (2) Determination of mycelial biomass: Filter the mycelial pellets from the liquid culture medium using a 100-mesh filter and rinse them repeatedly with purified water. Dry the mycelial pellets in an oven at 45°C until constant weight is reached, and weigh the mass of the dry mycelium.

[0074] The results (see Table 4) showed that under different chromium concentration stresses, the liquid culture mycelial biomass of the strain Qian DL02 of the present invention was significantly higher than that of other Morchella esculenta strains, indicating that the strain Qian DL02 of the present invention has a significantly higher resistance to heavy metal chromium stress than other main cultivated Morchella esculenta strains.

[0075] Table 4 Comparative test results of mycelial biomass of the present invention's strain Qian DL02 liquid inoculation at different chromium concentrations

[0076]

Claims

1. A kind of six-sister morel ( Morchella sextelata ) strain Qian DL02, deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M2022899.

2. Use of the strain Guizhou DL02 according to claim 1 in food or health products.

3. A food or health product, characterized in that: The food or health product contains the strain Qian DL02 according to claim 1.

4. Use of the strain Guizhou DL02 according to claim 1 in beverages.

5. A beverage, characterized in that The beverage contains the strain Qian DL02 according to claim 1.

6. Use of the strain Guizhou DL02 according to claim 1 in preparing drugs for improving human immunity.

Images