T7 RNA polymerase mutant and application thereof

Abstract

The invention discloses a T7 RNA (Ribonucleic Acid) polymerase mutant, and the T7 RNA polymerase mutant comprises any one or more of the following amino acid mutation sites: W797L, P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, Q786L, S430P, L446F or T375K, and the T7 RNA polymerase mutant has RNA polymerase activity. The invention also discloses an application of the T7 RNA polymerase mutant in in-vitro transcription, non-coding RNA synthesis, RNA drug synthesis, in-vivo protein expression or cell-free protein expression.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a T7 RNA polymerase mutant and its application. Background Art

[0002] T7 RNA polymerase is a monomeric enzyme from the double-stranded DNA virus T7 bacteriophage. It has a total of 883 amino acids. Its main function is to use DNA as a template to polymerize RNA by catalyzing the formation of phosphodiester bonds between nucleoside triphosphate substrates. It plays an important role in the process of transferring genetic information from DNA to RNA. Since it was first used for RNA synthesis in the 1980s, T7 RNA polymerase has become an important tool in the fields of molecular biology and genetic engineering.

[0003] RNA polymerases exist in almost all organisms. According to the type of organism, they can be roughly divided into bacterial, archaeal, eukaryotic and viral RNA polymerases. Among them, the RNA polymerases of bacteria, archaea and eukaryotes usually have complex subunit structures and require the participation of multiple auxiliary factors in the transcription process, which poses great challenges to the study of the transcription mechanism of the enzyme itself. The RNA polymerases in viruses usually have only a single subunit and a relatively simple structure. Common ones include T7 RNA polymerase, T3 RNA polymerase and SP6 RNA polymerase. The structure and function of this type of enzyme have been studied more. Although there are many types of RNA polymerases, the application market of T7 RNA polymerase is the largest. Compared with non-viral polymerases, T7 polymerase has a simple structure and extremely high promoter specificity. It only transcribes DNA downstream of the T7 promoter, has a very low error rate, does not require auxiliary factors, and has a transcription rate that is 5 times the transcription rate of Escherichia coli RNAP. Compared with other viral polymerases, the polymerization rate and transcribed length of T7 RNA polymerase are higher than those of SP6 RNA polymerase and T3 RNA polymerase, and T7 has the highest expression level in the Escherichia coli expression system and the lowest production cost. Due to its promoter specificity and high RNA polymerase activity, T7 RNA polymerase is widely used in many fields of molecular biology. In the field of recombinant protein expression, T7 RNA polymerase can be used to express recombinant genes at high levels in Escherichia coli, and can also be used for protein production in cell-free expression systems. Cell-free expression systems usually require a long incubation time, which requires T7 RNA polymerase to have good stability.

[0004] In the field of mRNA vaccines and drugs, T7 RNA polymerase is often used to produce mRNA. However, some unnecessary byproducts, such as double-stranded RNA, are produced during the transcription process. If an mRNA vaccine containing double-stranded RNA is injected into the human body, it will trigger an unnecessary immunogenic response, so it is very important to remove double-stranded RNA during the production of mRNA vaccines. The NewEngland Biolabs team found that the byproducts produced in in vitro transcription can be reduced by increasing the temperature of the reaction, which places higher requirements on the thermal stability of T7 RNA polymerase and its activity at high temperatures. Summary of the invention

[0005] In order to solve the above technical problems, the present application provides a T7 RNA polymerase with high thermal stability and high temperature catalytic activity, which expands the application scope of T7 RNA polymerase in the fields of molecular biology and genetic engineering, especially when high temperature conditions are required for the reaction.

[0006] The present application provides a T7 RNA polymerase mutant. Relative to the wild-type T7 RNA polymerase, the T7 RNA polymerase mutant comprises any one or more of the following amino acid mutation sites: W797L, P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, Q786L, S430P, L446F or T375K, and has RNA polymerase activity.

[0007] The present application also provides an isolated polynucleotide, which encodes the above-mentioned T7 RNA polymerase mutant.

[0008] The present application also provides a construct, wherein the construct contains the isolated polynucleotide described above.

[0009] The present application also provides a cell, which comprises the above-mentioned construct.

[0010] The present application also provides a method for preparing T7 RNA polymerase, which comprises culturing the above-mentioned cells to express T7 RNA polymerase.

[0011] The present application also provides the use of the above-mentioned T7 RNA polymerase mutant in in vitro transcription;

[0012] and / or, use of the T7 RNA polymerase mutant in the synthesis of non-coding RNA, wherein the non-coding RNA comprises at least one of sgRNA, tRNA, siRNA, snoRNA or oligonucleotide;

[0013] and / or, use of the T7 RNA polymerase mutant in RNA drug synthesis;

[0014] And / or, use of the T7 RNA polymerase mutant in in vivo protein expression or cell-free protein expression.

[0015] The T7 RNA polymerase mutant proposed in this specification may bring beneficial effects including but not limited to: (1) The mutant screened in this application has significantly improved thermal stability compared with the wild type, with a maximum Tm difference of 9°C; (2) The mutant screened in this application has significantly improved high temperature activity compared with the wild type, with the 52°C activity increased by more than 30 times; (3) The activity of the mutant of this application is not adversely affected by the mutation and maintains more than 50% of the catalytic activity; (4) The mutant of this application has application potential in room temperature and high temperature in vitro transcription technology, cell-free protein expression technology and the development of gene therapy tool technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present application will be further described in the form of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not restrictive, and include:

[0017] Figure 1 is a histogram of the unfolding temperatures of the wild-type T7 RNA polymerase and multiple mutants according to some embodiments of the present application;

[0018] Figure 2 A diagram showing the effect of a single amino acid on the activity of T7 RNA polymerase according to some embodiments of the present application;

[0019] Figure 3 This is a graph showing the effect of a single amino acid substitution on the activity of T7 RNA polymerase after heat treatment at 48° C. for 5 minutes according to some embodiments of the present application;

[0020] Figure 4 This is a graph showing the relative activity results of wild-type T7 RNA polymerase and mutant T7 RNA polymerase transcribed at 50° C. for one hour according to some embodiments of the present application;

[0021] Figure 5 This is a graph showing the relative activity results of wild-type T7 RNA polymerase and mutant T7 RNA polymerase transcribed at 52° C. for one hour according to some embodiments of the present application. DETAILED DESCRIPTION

[0022] In order to more clearly illustrate the technical solutions of the embodiments of this specification, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some examples or embodiments of this specification. For ordinary technicians in this field, this specification can also be applied to other similar scenarios based on these drawings without creative work. Unless it is obvious from the language environment or otherwise explained, the same reference numerals in the figures represent the same structure or operation.

[0023] As shown in this specification and claims, unless the context clearly indicates an exception, the words "a", "an", "an" and / or "the" do not refer to the singular and may also include the plural. Generally speaking, the terms "comprise" and "include" only indicate the inclusion of the steps and elements that have been clearly identified, and these steps and elements do not constitute an exclusive list. The method or device may also include other steps or elements.

[0024] Flowcharts are used in this specification to illustrate the operations performed by the system according to the embodiments of this specification. It should be understood that the preceding or following operations are not necessarily performed precisely in order. Instead, the steps may be processed in reverse order or simultaneously. At the same time, other operations may also be added to these processes, or one or more operations may be removed from these processes.

[0025] T7 RNA polymerase is also widely used in the field of nucleic acid amplification technology, including nucleic acid sequence-based amplification (NASBA) technology and transcription-mediated amplification (TMA) technology. NASBA technology has been successfully used to rapidly diagnose a variety of pathogenic viruses, especially those with single-stranded RNA genomes. TMA technology has been shown to be one of the most sensitive tests for detecting hepatitis B virus RNA in patient serum. For NASBA, TMA and related methods, increasing the reaction temperature can improve the reaction kinetics. For example, increasing the reaction temperature of isothermal amplification can achieve amplification of RNA with secondary structure. In addition, polymerase chain reaction (PCR) technology has shown that high annealing temperature can promote specific hybridization between primers and targets, thereby achieving highly specific amplification. Therefore, it is of great significance to engineer T7 RNA polymerase with high thermal stability and high temperature catalytic activity. Using deep learning to predict amino acid mutation sites and thus improve the thermal stability of proteins has become a fast and efficient option. In this way, variants with high thermal activity and stability can be quickly screened.

[0026] The present application provides a T7 RNA polymerase mutant. Relative to the wild-type T7 RNA polymerase, the T7 RNA polymerase mutant includes any one or more of the following amino acid mutation sites: W797L, P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, Q786L, S430P, L446F or T375K, and has RNA polymerase activity.

[0027] In some embodiments, the T7 RNA polymerase mutant may include an amino acid mutation site Q786L; in some embodiments, it may further include any one or more of the following mutation sites: W797L, P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, S430P, L446F or T375K.

[0028] In some embodiments, the polymerase mutant may include amino acid mutation sites Q786L, S430P and W797L; in some embodiments, further preferably, the polymerase mutant may also include any one or more of the following amino acid mutation sites: P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, L446F, P657K or T375K.

[0029] In some embodiments, relative to wild-type T7 RNA polymerase, the T7 RNA polymerase mutant may include any of the following groups of amino acid mutation sites: Q786L, S430P and W797L; Q786L, W797L and L446F; Q786L, S430P, W797L and L446F; Q786L, S430P, N601E and L446F; Q786L, S430P, W797L, P657K, N601E, L446F, P476E and T375K; Q786L, S430P, W797L, P657K, Y846R, L446F, P476E and T375K; Q786L, S430P , W797L, P657K, L446F, P476E, S606V and T375K; Q786L, S430P, W797L, P657K, Y846R, L446F, P476E and S606V; Q786L, S430P, Y846R, M306K and S606V; Q786L, S430P, Y846R, L446F and P476E; Q786L, S430P, Y846R, N601E, L446F and S606V; Q786L, S430P, Y846R, M306K, N601E and L446F.

[0030] In some embodiments, the amino acid sequence of the wild-type T7 RNA polymerase may be as shown in SEQ ID NO.1.

[0031] The "sequence" herein should generally be understood to include both the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless a more limited explanation is required herein.

[0032] The present application also provides an isolated polynucleotide, which encodes the above-mentioned T7 RNA polymerase mutant.

[0033] As used herein, the terms "polynucleotide," "nucleotide," "oligonucleotide," and "nucleic acid" may be used interchangeably to refer to nucleic acids including DNA, RNA, derivatives thereof, or combinations thereof.

[0034] The present application also provides a construct, wherein the construct contains the isolated polynucleotide described above.

[0035] "Construct" herein refers to a polynucleotide that can carry at least one polynucleotide fragment. The construct can deliver a fragment of nucleic acid, each polynucleotide, to a host cell. It can include at least one expression cassette comprising a regulatory sequence for correctly expressing the polynucleotide incorporated therein. The polynucleotide to be introduced into the cell (e.g., a polynucleotide encoding a target product or a selective marker) can be inserted into an expression cassette of a vector to express it therefrom. The construct according to the present application can exist in a circular or linear (linearized) form, and also includes expression construct fragments. The term "construct" also includes artificial chromosomes or similar individual polynucleotides that allow the transfer of exogenous nucleic acid fragments.

[0036] The present application also provides a cell, which comprises the above-mentioned construct.

[0037] The present application also provides a method for preparing T7 RNA polymerase, which comprises culturing the above-mentioned cells to express T7 RNA polymerase.

[0038] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.

[0039] The present application also provides the use of the above-mentioned T7 RNA polymerase mutant in in vitro transcription;

[0040] and / or, use of the T7 RNA polymerase mutant in the synthesis of non-coding RNA, wherein the non-coding RNA comprises at least one of sgRNA, tRNA, siRNA, snoRNA or oligonucleotide;

[0041] and / or, use of the T7 RNA polymerase mutant in RNA drug synthesis;

[0042] And / or, use of the T7 RNA polymerase mutant in in vivo protein expression or cell-free protein expression.

[0043] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0044] Example 1 - Construction and synthesis of wild-type T7 RNA polymerase plasmid vector and selection of mutation sites

[0045] The amino acid sequence of the wild-type T7 RNA polymerase was searched in the NCBI database and sent to Qingke Biotechnology Co., Ltd. to synthesize its coding gene. After codon optimization, the pQE-80L vector was selected, and the SacI and HindⅢ double restriction sites were selected. The synthesized plasmid product was transformed into the competent Escherichia coli Ecoli-BL21 (DE3).

[0046] The wild-type (WT) amino acid sequence of the T7 RNA polymerase involved in the present application is shown in SEQ ID NO.1.

[0047] SEQ ID NO.1:

[0048] MNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA

[0049] Score the modification targets of T7 RNA polymerase based on deep learning, and select the top 50 as target sites to be synthesized by Tsingke Biological Company.

[0050] The mutant T7 RNA polymerase involved in the present application has a mutation site and an amino acid sequence relative to the wild type as shown in Table 1. The mutant T7 RNA polymerase of the present application can be produced and verified to be correct by introducing a mutation into the wild type T7 RNA polymerase gene. The method of introducing a desired mutation into a specified nucleic acid sequence is well known to those skilled in the art.

[0051] Table 1

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] Example 2—Expression and melting temperature measurement of single-site and combination mutant proteins

[0069] Escherichia coli Ecoli-BL21 (DE3) containing T7 RNA polymerase was inoculated into LB liquid medium containing 50μg / mL ampicillin, and cultured on a shaker at 37°C and 220rpm. When the bacterial OD600 reached 0.6-0.8, IPTG was added at a final concentration of 1mM and induced at 37°C for 6h. The bacterial cells were collected by centrifugation at 4000rpm for 25min, washed with Buffer A (50mM Tris-HCl pH8.0, 300mM NaCl, 3mM imidazole, 0.1mM EDTA), resuspended in Buffer A, and ultrasonically disrupted. Centrifuged at 12,000rpm for 60min, and the supernatant was collected. After the supernatant was filtered, Ni-NTA purification was performed. Use 3mM, 10mM and 200mM imidazole to wash for 1 column volume each, collect the eluted fractions containing high-purity target protein, change the solution to Buffer B (50mM Tris-HCl pH 8.0, 100mM NaCl, 0.1mM EDTA) by ultrafiltration, add 75% glycerol and store at -20°C.

[0070] To measure the melting temperature of mutants (e.g. Figure 1 0.2 mg / ml T7 RNA polymerase variant was prepared in buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 0.1 mM EDTA), 5× exogenous fluorescent SYPROOrange was added, and the melting temperature was measured using Analytik Jena qTower3.

[0071] Example 3 - Real-time transcription activity detection and end-point polymerization activity determination

[0072] Design a 99bp template DNA sequence and send it to the company to synthesize the template DNA sequence. The sequence name is iSpinach-template, and the base sequence (5'-3') is as follows:

[0073] GTCAGATCCATAATACGACTCACTATAGGGGCGACTACGGTGAGGGTCGGGTCCAGTAGCTTCGGCTACTGTTGAGTAGAGTGTGGGCTCCGTAGTCGC (SEQ ID NO. 2).

[0074] Prepare real-time in vitro transcription fluorescence detection reaction buffer (200mM HEPES, pH 7.5, 30mM MgCl2, 20mM DTT, 0.4U / μL RNase inhibitor, 5mM NTPs mixture, 100nM DNA template, 0.04mg / ml T7 RNA polymerase, 100μM DFHBI), place the system at 37℃, and measure the RNA polymerization rate of T7 RNA polymerase by detecting the change of real-time fluorescence signal within 30min (excitation wavelength: 470nm, emission wavelength: 512nm). Each experiment was repeated in three groups. 37℃ transcription activity comparison Figure 2 shown.

[0075] Wild-type T7 RNA polymerase (WT) and mutants were heat treated at 48°C for 5 min and placed on ice for later use. A real-time in vitro transcription fluorescence detection reaction buffer (200 mM HEPES, pH 7.5, 30 mM MgCl2, 20 mM DTT, 0.4 U / μL RNase inhibitor, 5 mM NTPs mixture, 100 nM DNA template, 0.04 mg / ml T7 RNA polymerase, 100 μM DFHBI) was prepared and the system was placed at 37°C. The RNA polymerization rate of T7 RNA polymerase was determined by detecting the changes in the real-time fluorescence signal within 30 min (excitation wavelength: 470 nm, emission wavelength: 512 nm). Each experiment was repeated in triplicate. Residual activity comparison Figure 3 As shown, the effects of single amino acid substitutions on the activity of T7 RNA polymerase (WT, SEQ ID NO. 1) are shown, indicating the results of mutants Y846R, S606V, N601E, P657K, M306K, P476E, K642G and W797L being transcribed at 37°C for 30 minutes after incubation at 48°C for 5 minutes.

[0076] Prepare endpoint reaction buffer (200mM HEPES, pH 7.5, 30mM MgCl2, 20mM DTT, 0.4U / μLRNase inhibitor, 5mM NTPs mixture, 0.04mg / ml T7 RNA polymerase, 100nM DNA template), react at 50℃ and 52℃ for 1 hour each, add 100mM EDTA to terminate the reaction, add 100μMDFHBI after 10min of reaction, and detect the terminated fluorescence signal at an excitation wavelength of 470nm and an emission wavelength of 512nm. The relative activity results of wild-type T7 RNA polymerase and mutant type transcribed at 50℃ for one hour are shown in the figure below. Figure 4 As shown; the relative activity results of wild-type T7 RNA polymerase and mutant transcription at 52°C for one hour are shown in Figure 5 shown.

[0077] The basic concepts have been described above. Obviously, for those skilled in the art, the above detailed disclosure is only for example and does not constitute a limitation of this specification. Although not explicitly stated here, those skilled in the art may make various modifications, improvements and corrections to this specification. Such modifications, improvements and corrections are suggested in this specification, so such modifications, improvements and corrections still belong to the spirit and scope of the exemplary embodiments of this specification.

[0078] At the same time, this specification uses specific words to describe the embodiments of this specification. For example, "one embodiment", "an embodiment", and / or "some embodiments" refer to a certain feature, structure or characteristic related to at least one embodiment of this specification. Therefore, it should be emphasized and noted that "one embodiment" or "an embodiment" or "an alternative embodiment" mentioned twice or more in different positions in this specification does not necessarily refer to the same embodiment. In addition, certain features, structures or characteristics in one or more embodiments of this specification can be appropriately combined.

[0079] In some embodiments, numbers describing the number of components and attributes are used. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise specified, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may change according to the required features of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining digits. Although the numerical domains and parameters used to confirm the breadth of their range in some embodiments of this specification are approximate values, in specific embodiments, the setting of such numerical values ​​is as accurate as possible within the feasible range.

[0080] Finally, it should be understood that the embodiments described in this specification are only used to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, as an example and not a limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly introduced and described in this specification.

Claims

1. A T7 RNA polymerase mutant, characterized in that: Relative to wild-type T7 RNA polymerase, the T7 RNA polymerase mutant includes any one or more of the following amino acid mutation sites: W797L, P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, Q786L, S430P, L446F or T375K, and has RNA polymerase activity.

2. The T7 RNA polymerase mutant according to claim 1, characterized in that The T7 RNA polymerase mutant includes the amino acid mutation site Q786L, and further includes any one or more of the following mutation sites: W797L, P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, S430P, L446F or T375K.

3. The T7 RNA polymerase mutant according to claim 1, characterized in that The polymerase mutant includes amino acid mutation sites Q786L, S430P and W797L; further preferably, the polymerase mutant also includes any one or more of the following amino acid mutation sites: P657K, Y846R, M306K, N601E, P476E, S606V, K642G, P742G, I117L, L446F, P657K or T375K.

4. The T7 RNA polymerase mutant according to claim 1, characterized in that Relative to wild-type T7 RNA polymerase, the T7 RNA polymerase mutant comprises any of the following groups of amino acid mutation sites: Q786L, S430P and W797L; Q786L, W797L and L446F; Q786L, S430P, W797L and L446F; Q786L, S430P, N601E and L446F; Q786L, S430P, W797L, P657K, N601E, L446F, P476E and T375K; Q786L, S430P, W797L, P657K, N601E, L446F, P476E and T375K; 0P, W797L, P657K, Y846R, L446F, P476E and T375K; Q786L, S430P, W797L, P657K, L446F, P476E, S606V and T375K; Q786L, S430P, W797L, P657K, Y846R, L446F, P476E and S606V; ; Q786L, S430P, Y846R, M306K and S606V; Q786L, S430P, Y846R, L446F and P476E; Q786L, S430P, Y846R, N601E, L446F and S606V; Q786L, S430P, Y846R, M306K, N601E and L446F.

5. The T7 RNA polymerase mutant according to claim 1, characterized in that The amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO.

1.

6. An isolated polynucleotide, characterized in that The isolated polynucleotide encodes the T7 RNA polymerase mutant according to any one of claims 1 to 5.

7. A construct, characterized in that The construct contains the isolated polynucleotide of claim 6.

8. A cell comprising the construct of claim 7.

9. A method for preparing T7 RNA polymerase, the method comprising culturing the cell according to claim 8 to express T7 RNA polymerase.

10. Use of the T7 RNA polymerase mutant according to any one of claims 1 to 5 in in vitro transcription; and / or, use of the T7 RNA polymerase mutant in the synthesis of non-coding RNA, wherein the non-coding RNA comprises at least one of sgRNA, tRNA, siRNA, snoRNA or oligonucleotide; and / or, use of the T7 RNA polymerase mutant in RNA drug synthesis; And / or, use of the T7 RNA polymerase mutant in in vivo protein expression or cell-free protein expression.

Images