Recombinant Bst DNA polymerase with high DNA polymerase activity and reverse transcriptase activity as well as preparation and application of recombinant Bst DNA polymerase

Abstract

The invention discloses a recombinant Bst DNA polymerase with high DNA polymerase activity and reverse transcriptase activity as well as preparation and application of the recombinant Bst DNA polymerase. According to the present invention, a Headpiece structural domain truncated body Hp47 derived from chicken villus protein and a Sto7d structural domain derived from thermophilic archaea Sulfolobus tokidaii are subjected to sequence rearrangement, and are fused to the amino terminal of a Bst DNA polymerase large fragment so as to construct the novel Bst DNA polymerase rearrangement mutant HpSt-G23; the recombinant polymerase HpSt-G23 obtained by the invention has both high polymerase activity and reverse transcriptase activity, and can tolerate inhibitors such as urea, sodium chloride and the like. HpSt-G23 and TthRecA can construct a detection system, DNA or RNA amplification can be completed in the same system only by using two primers, the detection sensitivity of an RNA template is greatly improved, and the HpSt-G23 has a good development prospect in the field of nucleic acid detection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant Bst DNA polymerase having both high DNA polymerase activity and reverse transcriptase activity, and a preparation and application thereof. Background Art

[0002] Loop-mediated isothermal amplification (LAMP) is a method for nucleic acid amplification detection under isothermal conditions (60-65°C). Compared with conventional PCR and qPCR, it does not require processes such as thermal denaturation and temperature cycling of the template, is less dependent on instruments, and has the characteristics of simplicity, rapidity, and strong specificity. LAMP technology designs 4-6 primers for 6-8 regions on the target gene sequence of the template, and relies on the polymerase activity and strand displacement activity of Bst DNA polymerase (derived from Geobacillus stearothermophilus) to amplify DNA under isothermal conditions. Although Bst DNA polymerase itself has been confirmed to have reverse transcriptase activity, when amplifying RNA templates, it is still necessary to add additional reverse transcriptase to the RT-LAMP reaction system due to its low reverse transcriptase activity. However, when reverse transcriptase and DNA polymerase are used simultaneously in a system, due to their differences in processivity, stability, and active temperature range, the detection process becomes more complicated, and may even inhibit each other, reducing the sensitivity and accuracy of the detection. If a single enzyme preparation can amplify both DNA and RNA templates, RNA reverse transcription can be performed without the addition of reverse transcriptase. Therefore, improving the reverse transcriptase activity of Bst DNA polymerase is expected to simplify the detection of RNA templates by RT-LAMP. At the same time, Bst DNA polymerase can maintain a good ability to amplify nucleic acid templates in the presence of various inhibitors, which will have good application prospects in rapid diagnosis or on-site diagnosis.

[0003] Due to the particularity of LAMP technology, the use of 4-6 primers and a polymerase without proofreading activity will inevitably form primer dimers and cause nonspecific amplification. Thermus thermophilus ( T ) The heat-resistant TthRecA protein derived from HB8 can effectively reduce the mismatch between primers, improve the specificity of the amplification reaction, and reduce primer dimerization by reducing the number of primers in LAMP.

[0004] In order to simplify the system composition of LAMP and RT-LAMP and reduce non-specific amplification caused by primer dimerization, it is urgent to research and develop a new Bst DNA polymerase that not only has high polymerase activity and reverse transcriptase activity and strong inhibitor tolerance, but also can match RecA to construct a simple RecA-LAMP system for detecting DNA and RNA. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a recombinant Bst DNA polymerase having both high DNA polymerase activity and reverse transcriptase activity.

[0006] Another object of the present invention is to provide a method for preparing the above-mentioned recombinant Bst DNA polymerase having both high DNA polymerase activity and reverse transcriptase activity.

[0007] Another object of the present invention is to provide an application of the above-mentioned recombinant Bst DNA polymerase having both high DNA polymerase activity and reverse transcriptase activity.

[0008] The purpose of the present invention is achieved through the following technical solutions: A recombinant Bst DNA polymerase with high DNA polymerase activity and reverse transcriptase activity, named HpSt-G23, whose amino acid sequence is shown in SEQ ID NO.1. The recombinant Bst DNA polymerase is based on the Headpiece domain truncated form of chicken chorion protein Hp47 and thermophilic archaea Sulfolobus tokodaii The secondary structure sequence of the double domain of Sto7d protein is obtained by rearranging the amino acid sequence of the domain and connecting it to the amino terminus of the large fragment of wild-type Bst DNA polymerase.

[0009] The biological material related to the above-mentioned recombinant Bst DNA polymerase is any one or more of the following biological materials: I. Nucleic acid molecule; the nucleic acid molecule comprises a DNA fragment encoding the HpSt-G23.

[0010] II. Expression vector; the expression vector comprises the nucleic acid molecule described in I; III. Host cell; the host cell comprises the expression vector described in II.

[0011] Furthermore, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 2. It can be heterologously expressed in an E. coli expression system.

[0012] The method for preparing the recombinant Bst DNA polymerase having both high DNA polymerase activity and reverse transcriptase activity comprises the following steps: S1. Transform the expression vector into competent cells, heat shock them after ice bath, cool them on ice for recovery, add LB liquid culture medium for constant temperature shaking culture, and pick monoclonal cells for screening; S2. Extract the expression vector of the screened positive clone, transform it into host cells, and inoculate the host cells into LB liquid culture medium for constant temperature shaking culture to obtain a seed culture solution containing HpSt-G23; S3, taking the seed culture solution and inoculating it into LB liquid culture medium, and performing amplification culture to obtain a bacterial solution containing HpSt-G23; S4, adding isopropyl β-D-Thiogalactoside (IPTG) to the bacterial solution to induce host cells to express HpSt-G23, and centrifuging to obtain bacterial precipitates containing HpSt-G23; S5, adding lysis buffer to the bacterial precipitate, resuspending the bacterial cells containing HpSt-G23, disrupting the bacterial cells by ultrasonication, centrifuging, and obtaining a supernatant containing HpSt-G23; S6, removing impurity proteins from the supernatant of the broken cells by constant temperature incubation and centrifugation to obtain a protein supernatant containing HpSt-G23; S7. Subject the protein supernatant to nickel ion affinity chromatography, perform gradient elution using elution buffer to form a chromatography eluate, take the chromatography eluate for protein denaturation, detect the chromatography eluate using SDS-PAGE electrophoresis, and collect the chromatography eluate containing HpSt-G23 to obtain the HpSt-G23.

[0013] A LAMP / RT-LAMP reaction kit comprises nuclease-free water, a LAMP reaction buffer, a LAMP primer, dNTPs, at least one of a fluorescent dye, and the HpSt-G23.

[0014] Preferably, the composition of the LAMP reaction buffer is as follows: 20±10 mmol / L Tris-HCl, 90±20 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 6±2 mmol / L MgSO4, pH 9.0±0.6.

[0015] Preferably, the LAMP primer composition is as follows: 0.8-1.6 μmol / L FIP / BIP, 0.2-0.4 μmol / L FF / LB, 0.2-0.4 μmol / L F3 / B3.

[0016] Preferably, the concentration of the dNTPs in the system is 0.8-1.4 mmol / L.

[0017] Preferably, the enzyme activity unit of HpSt-G23 in the system is 0.05-0.12 U / μL, and the optimal addition amount is 0.06 U / μL.

[0018] Preferably, the fluorescent dye is SYBR Green Ⅰ, EvaGreen, SYTO-9 or SYTO-82, and more preferably SYTO-9.

[0019] Application of the above LAMP / RT-LAMP reaction kit in nucleic acid detection.

[0020] Preferably, the nucleic acid detection conditions are 60-65°C and 60 min.

[0021] Preferably, the sample for nucleic acid detection includes an RNA virus sample or a plasmid sample containing viral DNA.

[0022] Preferably, the sample source for nucleic acid detection is not limited, and may contain at least one of inhibitors such as urea, NaCl, SYBR, and whole blood. Among them, the concentration of urea is within 1.5 mol / L, the concentration of NaCl is within 85mmol / L, the concentration of SYBR Green I is within 2×, and the concentration of whole blood is within 6% (v / v).

[0023] A RecA-HpSt-G23 reaction kit, comprising nuclease-free water, reaction buffer, primers, dNTPs, ATP, betaine, at least one of spermidine, and the HpSt-G23 and T RecA.

[0024] Preferably, the reaction buffer has the following composition: 20±10 mmol / L Tris-HCl, 70±15 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 5±2 mmol / L MgSO4, pH 8.8±0.4.

[0025] Preferably, the primer composition is as follows: 1.2-1.6 μmol / L FIP / BIP.

[0026] Preferably, the enzyme activity unit of HpSt-G23 in the system is 0.05-0.12 U / μL, more preferably 0.06 U / μL.

[0027] Preferably, the concentration of TthRecA in the system is 2-8 ng / μL.

[0028] Preferably, the concentration of the dNTPs in the system is 0.6-1.2 mmol / L.

[0029] Preferably, the concentration of ATP in the system is 0.1-1.2 mmol / L.

[0030] Preferably, the concentration of Betaine in the system is 0.6-1.0 mol / L.

[0031] Preferably, the concentration of spermidine in the system is 0.4-0.8 mmol / L.

[0032] Application of the above-mentioned RecA-HpSt-G23 reaction kit in nucleic acid detection.

[0033] Preferably, the nucleic acid detection conditions are 60-65°C and 60 min.

[0034] Preferably, the sample for nucleic acid detection includes an RNA virus sample or a plasmid sample containing viral DNA.

[0035] Compared with the prior art, the present invention has the following advantages and effects: The present invention fuses the amino terminus of the Bst DNA polymerase large fragment with a protein polypeptide rearranged based on the amino acid sequence of the Hp47-Sto7d domain to obtain HpSt-G23, which has high stability, can maintain more than 70% of the enzyme activity between pH 5-9, and still has more than 90% of the enzyme activity after being treated at 60°C for 2 hours; the modified HpSt-G23 has high tolerance to common inhibitors, and can at least tolerate 85 mM NaCl and 1.5 M urea; at the same time, HpSt-G23 also has high polymerase activity and reverse transcriptase activity, and the minimum detection limit of its composition in LAMP and RT-LAMP methods is significantly lower than that of the wild-type Bst DNA polymerase large fragment.

[0036] The HpSt-G23 described in the present invention is easy to use. The RecA-HpSt-G23 reaction system constructed in conjunction with Tth RecA can be used for DNA and RNA template detection in the same system. The number of primers is reduced to 2, and no additional reverse transcriptase is required when detecting RNA, which saves experimental and time costs and greatly improves the detection sensitivity of RNA templates. It has good application prospects in the field of rapid nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Schematic diagram of the Bst DNA polymerase mutant of the present invention.

[0038] Figure 2The figure is the SDS-PAGE electrophoresis analysis diagram of the Bst DNA polymerase mutant in the present invention.

[0039] Figure 3 This is a graph comparing the amplification capabilities of the Bst DNA polymerase mutants of the present invention on DNA templates.

[0040] Figure 4 This is a diagram showing the reverse transcriptase activity test results of the Bst DNA polymerase mutant of the present invention.

[0041] Figure 5 This is a comparison result of the salt tolerance of the Bst DNA polymerase mutants in the present invention.

[0042] Figure 6 This is a comparison diagram of the thermal stability of the large fragments of HpSt-G23 and Bst DNA polymerase in the present invention.

[0043] Figure 7 This is a graph showing the pH stability comparison of the large fragments of HpSt-G23 and Bst DNA polymerases in the present invention.

[0044] Figure 8 This is a graph showing the tolerance test results of HpSt-G23 and Bst DNA polymerase large fragments to different inhibitor concentrations in the present invention.

[0045] Fig. 9 The Bst DNA polymerase mutant HpSt-G23 of the present invention and T Comparison of the amplification capabilities of the RecA-HpSt-G23 system constructed by RecA and the LAMP system.

[0046] Fig.10 The Bst DNA polymerase mutant HpSt-G23 of the present invention and T Comparison of the amplification capabilities of the RecA-HpSt-G23 system constructed by RecA and the RT-LAMP system. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0048] Example 1: Preparation of amino acid sequence rearranged domain mutants based on the Hp47-Sto7d domain According to the Headpiece domain of chicken chorion protein (PDB:1YU5, NCBI ID: 396423) and the Sulfolobus tokodaii Based on the three-dimensional crystal structure of Hp47-Sto7d fused with the Sto7d domain of 1BF4 (PDB: 1BF4 NCBI ID: BA000023.2), the sequence was rearranged and the new domain was fused to the amino terminus of the large fragment of Bst DNA polymerase with a linker of "TCTGGCGGTGGTAGCGGTGGCGGCGGTTCTGGCGGTGGTGGCAGC" to obtain a Bst DNA polymerase mutant. Figure 1 . Figure 1 The amino acid sequences corresponding to the numbers in the sequence are as follows: H1: PRGVDPSRKENHLS; H2: DEDFKAVF; H3: GMTRSAFANL; H4: PLWKQQNLKKEKGLF; S1: VTVKFKYK; S2: GEEKEVDI; S3: SKIKKVWRV; S4: GKMISFTYDDNG; S5: KTGRGAVSEK; S6: DAPKELLQMLEKSGKK. Subsequently, the performance of the BstDNA polymerase mutants was tested.

[0049] The specific implementation is as follows: (1) Design a nucleotide sequence encoding the rearrangement domain, use overlap extension PCR and conventional PCR methods to artificially synthesize a DNA molecule encoding the relevant domain, and use a 2×Hipro DNA Assembly Mix (Guangzhou Yingzan Biotechnology Co., Ltd., K001A) kit to connect the DNA molecule of the relevant domain with the pET-28a plasmid of the linear Bst DNA polymerase large fragment (the plasmid has been disclosed in the document "Xiang, R., Liu, G., Hou, Y., Xie, L., Wang, Q., Hu, S., 2024. Double domain fusion improves the reverse transcriptase activity and inhibitor tolerance of Bst DNA polymerase. International Journal of Biological Macromolecules 274, 133243.") by homologous recombination, and the linker is "TCTGGCGGTGGTAGCGGTGGCGGCGGTTCTGGCGGTGGTGGCAGC". As another embodiment of the present invention, a biological company can be commissioned to directly synthesize a DNA molecule encoding a Bst DNA polymerase mutant. The ligation product or the synthesized sequence was then transformed into competent cells BL21 (DE3) to form recombinant engineered cells, and cultured in LB (Luria-Bertani) liquid medium with constant temperature shaking until OD 600 =0.6~0.8, add IPTG with a final concentration of 0.1 mmol / L, induce with shaking at 18℃ for 12h, collect and weigh the induced bacteria by centrifugation (4℃, 6,000×g, 30 min), record the wet weight of the bacteria, add lysis buffer (50mmol / L Tris-HCl, pH7.5) in proportion to resuspend the bacteria, break the bacteria by constant power ultrasound (4℃, 5.5 s ON, 5.5 s OFF, 165 W), centrifuge at low temperature (4℃, 36,000×g, 30 min), take the supernatant and incubate at 60℃ for 30 min to remove impurity proteins, centrifuge at low temperature (4℃, 36,000×g, 30 min), take the supernatant and filter it through a 0.22 μm microporous membrane, and then purify it through a nickel ion affinity column to obtain a high-purity BstDNA polymerase mutant, and use 12% SDS-PAGE protein electrophoresis to detect the protein purity, see Figure 2The nucleotide sequence encoding the Bst DNA polymerase mutant HpSt-G23 is shown in SEQ ID NO.1, wherein bases 1-354 are the nucleotide sequence encoding the rearrangement domain, bases 355-400 are the linker, and bases 401-2157 are the nucleotide sequence encoding the large fragment of Bst DNA polymerase. The nucleotide sequences of other Bst DNA polymerase mutants can be rearranged accordingly with reference to SEQ ID NO 1 for bases 1-354.

[0050] (2) Performance test of Bst DNA polymerase mutants.

[0051] The Bst DNA polymerase mutant was used as a template for LAMP and RT-LAMP reactions using astrovirus plasmid (the plasmid has been published in the literature "Xiang, R., Liu,G., Hou, Y., Xie, L., Wang, Q., Hu, S., 2024. Double domain fusion improves the reverse transcriptase activity and inhibitor tolerance of Bst DNA polymerase. International Journal of Biological Macromolecules 274, 133243.") DNA and SARS CoV-2 RNA, and its salt resistance was tested.

[0052] Bst DNA polymerase amplification ability test: LAMP / RT-LAMP reaction system is shown in Table 1: Table 1 Reaction system

[0053] 5× reaction buffer: 100 mmol / L Tris-HCl, 450 mmol / L KCl, 100 mmol / L (NH4)2SO4, 30 mmol / L MgSO4, pH 9.0; primer mix: 20 μmol / L FIP / BIP, 5 μmol / L LF / LB, 5 μmol / LF3 / B3.

[0054] Each reaction was repeated 3 times, and the prepared reaction system was placed in a real-time fluorescence quantitative PCR instrument, and the reaction program was set to 63°C for 60 min, and the "FAM" fluorescence signal was collected once every minute. The primer sequences used to detect astrovirus plasmid DNA are as follows: Ast-FIP: 5'-CTGCTCTGTCCCGCCCTCTAATGGCCGCAACAGGAGTA-3'; Ast-BIP: 5'-AGGACTAGAAGACAGCCCGGATGACAATGTTACGGACACGT-3'; Ast-LF: 5'-TTGTGAGCGGGCCTTG-3'; Ast-LB: 5'-CGCGGCAAACATCAATCTTCTCA-3'; Ast-F3: 5'-GCAGGTAACTGTTGAGGTCA-3'; Ast-B3: 5'-GGTTTTGGTCCTGTGACACC-3'.

[0055] The primer sequences used to detect SARS CoV-2 RNA are as follows: RN-FIP: 5'-TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC-3'; RN-BIP: 5'-CGCATTGGCATGGAAGTCAATTTGATGGCACCTGTGTAG-3'; RN-F3: 5'-AACACAAGCTTTCGGCAG-3'; RN-B3: 5'-GAAATTTGGATCTTTGTCATCC-3'; RN-LF: 5'-ACCTTCGGGAACGTGGTT-3'; RN-LB: 5'-TTCCTTGTCTGATTAGTTC-3'.

[0056] The amplification results are as follows Figure 3 and Figure 4 As shown, the fusion of exogenous domains can significantly improve the amplification efficiency of Bst DNA polymerase, among which the polymerase HpSt-G23 not only accelerated the amplification efficiency of plasmid DNA, but also significantly improved its reverse transcriptase activity.

[0057] Using the astrovirus plasmid as a template, the salt tolerance of Bst DNA polymerase was tested in the LAMP system. Figure 5 As shown, the rearrangement of the domain amino acid sequence has a significant effect on the salt tolerance of Bst DNA polymerase and can significantly improve the tolerance of Bst DNA polymerase to high salt.

[0058] Further, TthRecA with a final concentration of 5 ng / μL and 0.6 mM ATP were added to the system in Table 1, and the primer mix was replaced with 20 μmol / L FIP / BIP to prepare the RecA-LAMP system. After running at 63°C for 60 min in a real-time fluorescence quantitative PCR instrument, it was found that HpSt-G23 could rapidly amplify astrovirus DNA without non-specific amplification. According to previous studies, the enzyme preparation obtained by fusing the Hp47 and Sto7d double domains to the amino terminus of the large fragment of Bst polymerase, namely HpStBL, although it has improved the reverse transcriptase activity and inhibitor resistance of Bst DNA polymerase to a certain extent, has low amplification efficiency when amplifying nucleic acid samples when forming the RecA-LAMP system with TthRecA, and non-specific amplification occurs.

[0059] In summary, HpSt-G23 among the mutants constructed in this example not only improves the amplification efficiency of Bst DNA polymerase, but also improves salt tolerance, and has better performance in RecA-LAMP, and is a better mutant.

[0060] Example 2: HpSt-G23 expression and purification (1) The pET-28a-HpSt-G23 plasmid was transformed into expression competent BL21 (DE3) to form recombinant engineered cells, and cultured in LB liquid medium with constant temperature shaking until OD 600 =0.6~0.8, add IPTG with a final concentration of 0.1 mmo / L, induce with shaking at 18℃ for 12 h, collect the induced bacteria by low-temperature centrifugation and weigh, record the wet weight of the bacteria, add lysis buffer in proportion to resuspend the bacteria, centrifuge (4℃, 6,000 × g, 30 min), collect the induced bacteria and weigh, record the wet weight of the bacteria, add lysis buffer in proportion to resuspend the bacteria, constant power ultrasonic disruption of the bacteria (4℃, 5.5 s ON, 5.5 s OFF, 165 W), low-temperature centrifugation (4℃, 36000×g, 30 min), take the supernatant and incubate at 60℃ for 30 min to remove impurity proteins, low-temperature centrifugation (4℃, 36,000×g, 30 min), take the supernatant and filter it through a 0.22 μm microporous membrane and purify it through a nickel ion affinity column. The purification steps are as follows: (2) Using a peristaltic pump chromatography system, the supernatant was loaded onto the His Trap HPLC system pre-equilibrated with buffer at a flow rate of 1 mL / min. TM HP (purchased from GE Healthcare); (3) The column was flushed with binding buffer (50 mmol / L Tris-HCl, 50 mmol / L NaCl, 5% v / v glycerol, pH 8.0) at a flow rate of 1 mL / min, and then eluted with elution buffer (50 mmol / L Tris-HCl, 50 mmol / L NaCl, 500 mmol / L imidazole, 5% v / v glycerol, pH 8.0) and the eluted fractions were collected.

[0061] (4) The eluate containing the target protein was collected and dialyzed to obtain high-concentration and high-purity HpSt-G23, which was stored in storage buffer (50 mM Tris-HCl, 50 mmol / L KCl, 1 mmol / L EDTA, 50% glycerol, 1 mmol / L DTT, pH 8.0) and stored in a -20 °C refrigerator for a long term.

[0062] Example 3: Thermal stability analysis of HpSt-G23 HpSt-G23 and wild-type Bst DNA polymerase large fragments with the same enzyme activity concentration (0.05 U / μL) were incubated at different temperatures (20, 30, 40, 50, 60, 70, 80°C) for 2 h, and then the enzyme activities of the two enzymes after incubation at different temperatures for 2 h were determined according to the polymerase activity assay method. Three parallels were set for each condition, and the enzyme activity without incubation was defined as 100%, and the residual enzyme activity after hot incubation was calculated. The results are shown in Figure 6 As shown in the figure, after incubation at 60°C for 2 h, the enzyme activity of HpSt-G23 remained above 90%.

[0063] Example 4: pH stability analysis of HpSt-G23 HpSt-G23 and wild-type Bst DNA polymerase large fragments with the same enzyme activity concentration (0.1 U / μL) were mixed with equal volumes of buffer solutions of different pH values ​​(3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0) and incubated at 4 °C for 24 h. The enzyme activities of the two enzymes were then determined according to the polymerase activity assay method. Three parallels were set for each condition. The enzyme activity without incubation was defined as 100%, and the residual enzyme activities of the two enzymes were calculated. The results are shown in Figure 7 As shown, after incubation in pH 5-9 buffer for 24 h, the enzyme activity of HpSt-G23 remained above 70%.

[0064] Example 5: Analysis of the amplification ability of HpSt-G23 in LAMP reaction Different concentrations of astrovirus plasmid DNA were used as templates to test the amplification ability of HpSt-G23, HpStBL and wild-type BstDNA polymerase large fragment Bst LF in LAMP. The time required for the fluorescence value to reach the fluorescence threshold automatically determined by the software of the fluorescence quantitative PCR instrument (time threshold T t ) is the evaluation index. The shorter the time, the faster the amplification rate and the higher the efficiency.

[0065] Prepare 5×LAMP buffer: 100 mmol / L Tris-HCl, 375 mmol / L KCl, 100 mmol / L (NH4)2SO4, 25 mmol / L MgSO4, pH 9.0; the amplification system is prepared as shown in Table 1, and the reaction program is set as: 63 ℃ / 60s, a total of 60 cycles, and the "FAM" fluorescence signal is collected once every minute.

[0066] The results are shown in Table 2. HpSt-G23 has higher DNA amplification efficiency and amplification sensitivity than HpStBL and Bst LF, which means that HpSt-G23 is more suitable for DNA detection by LAMP method.

[0067] Table 2 T of HpSt-G23 in LAMP reaction t value

[0068] Example 6: Analysis of the amplification ability of HpSt-G23 in RT-LAMP reaction Using different concentrations of SARS CoV-2 RNA as template, the amplification performance of HpSt-G23, HpStBL, wild-type BstDNA polymerase large fragment BstLF, Bst 3.0 and Bst 4.0 in the RT-LAMP system was verified. See Example 5 for a specific implementation.

[0069] The results are shown in Table 3. When directly amplifying SARS CoV-2 RNA templates, HpSt-G23 has higher amplification efficiency and amplification sensitivity than BstLF, Bst 3.0 and Bst 4.0; HpSt-G23 and HpStBL have the same minimum detection limit of 0.50 pg / μL. At the lowest template concentration, although the amplification efficiency of HpSt-G23 for RNA is slightly lower than that of HpStBL, the amplification efficiency of HpSt-G23 for RNA is higher than that of HpStBL at other template concentrations. This shows that HpSt-G23 can detect RNA templates in RT-LAMP reactions and has higher reverse transcriptase activity.

[0070] Table 3 T of HpSt-G23 in RT-LAMP reactiont value

[0071] Example 7: Tolerance test of HpSt-G23 to different inhibitor concentrations Use 10 5 The astrovirus plasmid DNA with 20 copies / μL was used as a template, and different concentrations of NaCl, urea, SYBR Green I and whole blood were added to the LAMP reaction to investigate the tolerance of the Bst DNA polymerase mutant HpSt-G23 and the Bst DNA polymerase large fragment to common inhibitors.

[0072] The results are as follows Figure 8 As shown in the figure, HpSt-G23 showed better inhibitor tolerance in the system containing sodium chloride, urea, SYBR Green I and whole blood, and its amplification rate was the fastest in the system containing 1.5 M urea or 85 mM sodium chloride. However, the enzyme activity of the large fragment of wild-type Bst DNA polymerase was severely inhibited in the system containing inhibitors, and the amplification rate decreased significantly.

[0073] Example 8: Comparison of amplification capabilities between the RecA-HpSt-G23 system and the LAMP system Using different concentrations of astrovirus plasmid DNA as template, the amplification efficiency of the RecA-HpSt-G23 system and the conventional LAMP system were compared. The RecA-HpSt-G23 system is shown in Table 4: Prepare 5× reaction buffer: 100 mmol / L Tris-HCl, 350 mmol / L KCl, 100 mmol / L (NH4)2SO4, 25 mmol / L MgSO4, pH 8.8.

[0074] The RecA-HpSt-G23 system amplification primers only used the two inner primers in the LAMP primers, namely FIP and BIP. The amplification procedure was consistent with the LAMP amplification procedure, and the reaction was carried out at 63°C for 60 min. The results are shown in Fig. 9 As shown in the figure, the minimum detection limit of the RecA-HpSt-G23 system is the same as that of LAMP, and both can amplify 10 0 copies / μL target, indicating that the system has good prospects in DNA detection.

[0075] Table 4 Reaction system

[0076] Example 9: Comparison of amplification capabilities between the RecA-HpSt-G23 system and the RT-LAMP system Using SARS CoV-2 RNA as the sample and Bst DNA polymerase product enzyme as the control, the amplification sensitivity of the RecA-HpSt-G23 system and the conventional RT-LAMP system for RNA templates were compared. 10 pg, 5 pg, 1 pg, 0.5 pg, 0.1 pg, 0.05 pg, and 0.01 pg of RNA templates were amplified, respectively. The RecA-HpSt-G23 amplification procedure was consistent with the LAMP amplification procedure, and the reaction was carried out at 63°C for 60 min.

[0077] The results are as follows Fig.10 As shown in the figure, the RecA-HpSt-G23 system can amplify RNA template as low as 0.01 pg within 40 min, and the amplification sensitivity is significantly higher than that of the RT-LAMP reaction system, indicating that this system also has good prospects in RNA detection.

[0078] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A recombinant Bst DNA polymerase having both high DNA polymerase activity and reverse transcriptase activity, characterized in that: It was named HpSt-G23, and its amino acid sequence is shown in SEQ ID NO.

1.

2. The recombinant Bst DNA polymerase-related biomaterial according to claim 1, characterized in that: Any one or more of the following biological materials: I. A nucleic acid molecule; the nucleic acid molecule comprises a DNA fragment encoding the HpSt-G23; II. Expression vector; the expression vector comprises the nucleic acid molecule described in I; III. Host cell; the host cell comprises the expression vector described in II.

3. The recombinant Bst DNA polymerase-related biomaterial according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

4. A method for preparing a recombinant Bst DNA polymerase, characterized in that: The following steps are involved: S1. Transform the expression vector described in claim 2 or 3 into competent cells, heat shock them after ice bath, cool them on ice for recovery, add LB liquid culture medium for constant temperature shaking culture, and pick monoclonal cells for screening; S2. Extract the expression vector of the screened positive clone, transform it into host cells, and inoculate the host cells into LB liquid culture medium for constant temperature shaking culture to obtain a seed culture solution containing HpSt-G23; S3, taking the seed culture solution and inoculating it into LB liquid culture medium, and performing amplification culture to obtain a bacterial solution containing HpSt-G23; S4, adding isopropylthiogalactoside to the bacterial solution to induce host cells to express HpSt-G23, and centrifuging to obtain bacterial precipitates containing HpSt-G23; S5, adding lysis buffer to the bacterial precipitate, resuspending the bacterial cells containing HpSt-G23, disrupting the bacterial cells by ultrasonication, centrifuging, and obtaining a supernatant containing HpSt-G23; S6, removing impurity proteins from the supernatant of the broken cells by constant temperature incubation and centrifugation to obtain a protein supernatant containing HpSt-G23; S7. Subject the protein supernatant to nickel ion affinity chromatography, perform gradient elution using elution buffer to form a chromatography eluate, take the chromatography eluate for protein denaturation, detect the chromatography eluate using SDS-PAGE electrophoresis, and collect the chromatography eluate containing HpSt-G23 to obtain the HpSt-G23.

5. A LAMP / RT-LAMP reaction kit, characterized in that: The method comprises at least one of nuclease-free water, a LAMP reaction buffer, a LAMP primer, dNTPs, and a fluorescent dye, and the HpSt-G23 described in claim 1.

6. The LAMP / RT-LAMP reaction kit according to claim 5, characterized in that: The composition of the LAMP reaction buffer is as follows: 20±10 mmol / L Tris-HCl, 90±20 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 6±2 mmol / L MgSO4, pH 9.0±0.6; The LAMP primers are composed as follows: 0.8-1.6 μmol / L FIP / BIP, 0.2-0.4 μmol / L LF / LB, 0.2-0.4 μmol / L F3 / B3; The concentration of the dNTPs in the system is 0.8-1.4 mmol / L; The enzyme activity unit of HpSt-G23 in the system is 0.05-0.12 U / μL; The fluorescent dye is SYBR Green Ⅰ, EvaGreen, SYTO-9 or SYTO-82.

7. Use of the LAMP / RT-LAMP reaction kit according to claim 5 or 6 in nucleic acid detection, characterized in that: The conditions for nucleic acid detection are 60-65°C and 60 min; The samples for nucleic acid detection include RNA virus samples or plasmid samples containing viral DNA; The sample for nucleic acid detection contains at least one of inhibitors such as urea, NaCl, SYBR, and whole blood; wherein the concentration of urea is within 1.5 mol / L, the concentration of NaCl is within 85 mmol / L, the concentration of SYBR Green I is within 2×, and the concentration of whole blood is within 6% v / v.

8. A RecA-HpSt-G23 reaction kit, characterized in that: Contains at least one of nuclease-free water, reaction buffer, primers, dNTPs, ATP, betaine, and spermidine, T RecA and HpSt-G23 as claimed in claim 1.

9. The RecA-HpSt-G23 reaction kit according to claim 8, characterized in that: The composition of the reaction buffer is as follows: 20±10 mmol / L Tris-HCl, 70±15 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 5±2 mmol / L MgSO4, pH 8.8±0.4; The primer compositions are as follows: 1.2-1.6 μmol / L FIP / BIP; The enzyme activity unit of HpSt-G23 in the system is 0.05-0.12 U / μL; The concentration of TthRecA in the system is 2 to 8 ng / μL; The concentration of the dNTPs in the system is 0.6-1.2 mmol / L; The concentration of ATP in the system is 0.1-1.2 mmol / L; The concentration of Betaine in the system is 0.6-1.0 mol / L; The concentration of spermidine in the system is 0.4-0.8 mmol / L.

10. Use of the LAMP / RT-LAMP reaction kit or RecA-HpSt-G23 reaction kit described in claim 8 or 9 in nucleic acid detection, characterized in that: The conditions for nucleic acid detection are 60-65°C and 60 min; The sample for nucleic acid detection includes an RNA virus sample or a plasmid sample containing viral DNA.

Images