Application of plasmodiophora brassicae infected early chitin in prevention and control of cruciferae clubroot

Abstract

The invention provides application of plasmodiophora brassicae infected early-stage chitin in prevention and control of cruciferae clubroot, and relates to a technology and application for preventing and controlling the cruciferae clubroot based on blocking synthesis of zoosporangium chitin in plasmodiophora brassicae infected early-stage chitin. Experiments prove that chitin components exist in zoosporangia in the early stage of plasmodiophora brassicae infection and are synthesized by plasmodiophora brassicae chitin synthetase genes PbCHS3 and PbCHS7, and a new target is provided for prevention and control of clubroot of cruciferae crops. The clubroot can be efficiently prevented and controlled by expressing PbCHS3 and PbCHS7 silencing vectors in arabidopsis thaliana and oilseed rape and treating or applying pesticide polyoxin capable of blocking chitin synthesis through exogenous small RNA, and a key technology and a key method are provided for preventing and controlling the clubroot of cruciferae.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to application of gene PbCHS3 and gene PbCHS7 and homologous sequences thereof in preventing and controlling clubroot disease of cruciferous crops. Background Art

[0002] There are many types of cruciferous crops and they bring huge economic benefits to the global agricultural industry. Common cruciferous cash crops at present include rapeseed (Brassica napus), cabbage (B.rapa), cabbage (B.oleracea), mustard (B.juncea) and radish (Raphanus sativus), which are important sources of edible oil, vegetables, feed and industrial oil for humans, and are also one of the most important cash crops in the world.

[0003] Crucifer clubroot is a worldwide soil-borne disease caused by the obligate living parasitic protist Plasmodiophorabrassicae Woronin, which can harm almost all cruciferous crops. It is an important disease of crops such as rape, cabbage, Chinese cabbage and radish. At present, the annual affected area of ​​this disease in local areas of the world exceeds 3.2 million hectares, and the number of crops harmed accounts for more than one-third of the cruciferous crop planting area, with an average yield loss of 20% to 30%. What's more, the fields with serious diseases even have a complete crop failure, causing economic losses of tens of billions of yuan every year. At the same time, the clubroot survives in the soil with the diseased root residues in the form of dormant spores, and maintains infectivity for more than 10 years, making prevention and control extremely difficult.

[0004] The prior art has conducted a lot of research on the methods of preventing and treating clubroot, but an effective radical cure has not yet been found. Mining and utilizing clubroot resistance genes and cultivating disease-resistant varieties are considered to be the most economical and effective measures for preventing and controlling clubroot. There is differentiation of physiological subspecies in clubroot fungi. The existing clubroot resistance sites are mainly from turnip (B.rapa ssp.rapifera, feed cabbage). These resistances are dominant and subspecies specific. The disease-resistant varieties in production are promoted and applied for about three years before resistance loss occurs, making the disease-resistant breeding cycle long and far from meeting production needs. In addition, the host disease resistance genes with immune resistance cannot block the initial infection of clubroot fungi, resulting in the fact that the clubroot fungi can still produce a large number of secondary zoospores in the host epidermal cells of the disease-resistant plants, increasing the risk of host resistance loss and clubroot disease spread. Given that the clubroot fungi belong to protists, their species classification status is unique, and most of the existing fungicides for oomycetes, fungi and bacteria are ineffective against the clubroot fungi, and the fungicides that can be used for the prevention and control of rapeseed clubroot in production are extremely scarce. With the continuous expansion of the planting area of ​​cruciferous crops, there is an urgent need to seek new methods and technologies for efficient and lasting prevention and control of cruciferous vegetable clubroot. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide key targets of root-knot fungi for improving the root-knot resistance of cruciferous crops. Targeted inhibition of these targets can achieve the improvement of the root-knot resistance of cruciferous crops, providing new key targets and technical means for the improvement of the root-knot resistance of cruciferous crops and long-term and efficient prevention and control.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides an application of blocking the synthesis of zoosporangium chitin in the early infection stage of root-knot fungi in preventing and controlling the root-knot disease of cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, kale, mustard and radish.

[0008] The present invention also provides the use of gene PbCHS3 and gene PbCHS7 and homologous sequences thereof in preventing and controlling clubroot disease of cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, kale, mustard and radish.

[0009] The present invention also provides the use of silencing and / or reducing the expression of genes PbCHS3 and PbCHS7 and their homologous sequences in preventing and controlling clubroot disease in cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, kale, mustard and radish.

[0010] The present invention also provides the use of gene PbCHS3 and gene PbCHS7 and their homologous sequences in the chitin synthesis of zoosporangium of root knot fungi that prevent and control root knot disease in cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, cabbage, mustard and radish.

[0011] In the present invention, the nucleotide sequence of the gene PbCHS3 is shown in SEQ ID NO.1:

[0012]

[0013] The nucleotide sequence of the gene PbCHS7 is shown in SEQ ID NO.2:

[0014]

[0015] Based on this, the present invention also protects nucleotide sequences that have at least 50% homology with SEQ ID NO.1 and SEQ ID NO.2;

[0016] Preferably, it is a nucleotide sequence having at least 70% homology with SEQ ID NO.1 and SEQ ID NO.2;

[0017] More preferably, it is a nucleotide sequence having at least 80% homology with SEQ ID NO.1 and SEQ ID NO.2;

[0018] More preferably, it is a nucleotide sequence having at least 85% homology with SEQ ID NO.1 and SEQ ID NO.2;

[0019] More preferably, it is a nucleotide sequence having at least 90% homology with SEQ ID NO.1 and SEQ ID NO.2;

[0020] The most preferred nucleotide sequence is one having at least 95% homology with SEQ ID NO.1 and SEQ ID NO.2.

[0021] The present invention also provides a kit for preventing and controlling clubroot of cruciferous crops, the kit comprising primers for detecting genes PbCHS3 and PbCHS7, or interfering nucleotide fragments for targeting and silencing genes PbCHS3 and PbCHS7 of root-knot fungi:

[0022] The primer for detecting gene PbCHS3 is as shown in SEQ ID NO.3: CCAAGTACCCGAAGAAGCGT;

[0023] and as shown in SEQ ID NO.4: CGTAGTCAGGATCCGGGTTG;

[0024] The primer for detecting gene PbCHS7 is as shown in SEQ ID NO.5: AGCGGAACTCGGAGGACTAT;

[0025] and as shown in SEQ ID NO.6: CATGATCAGGTGCGTCAGGT;

[0026] The interfering nucleotide fragment targeting the silencing of PbCHS3 and PbCHS7 genes of Rhizoctonia solani is shown in SEQ ID NO.7:

[0027] CAGCGCACCTACAAGTCGATGCCGACGAAGCCATTGCTCCTGTTCATCGATTCCGACATTGAGCTGGACGAGACCGCCATGGCGCACTTCGTGTACGACATGAACAGGAACAAGGGCGTGACGCGCGAGGCGCTGACGGGCCTGATCACGTGCAAGACGGCCGGCACGTACAGCTTCTACAAGCTGATGCAGGACAGCGAGTATATCGAGTCGCA GATGTTGCAGAGGAACACGGAGGATTACCTCGGGGCGGTGTCCTGCCTGCCCGGTGCGCTGACATGGTGCGGTTCGAGGCGCTGGAGGCGGTCGCGCCGACCTACTTTGGGAAGATGACCGCCGAGGACAACTTCGACTTCAACAGGACGCACCTGGGCGAGGACCGGTACCTGACGCACCTGCTGATGGAATCACGCACCGTCAAGTACCGG.

[0028] In the present invention, the above-mentioned kit may also include a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium.

[0029] The present invention also provides a method for preventing and controlling clubroot of cruciferous crops, the method comprising: applying dsRNA of silencing gene PbCHS3 and gene PbCHS7 to reduce the expression of gene PbCHS3 and gene PbCHS7, so that the biomass of clubroot fungi decreases;

[0030] The dsRNA primer is as shown in SEQ ID NO.8:

[0031] TAATACGACTCACTATAGGGCAGCGCACCTACAAGTCGATGC;

[0032] and as shown in SEQ ID NO.9:

[0033] CCCTATAGTGAGTCGTATTACCGGTACTTGACGGTGCGTGAT.

[0034] The present invention also provides a biological control method for clubroot of cruciferous crops, the biological control method comprising: connecting a nucleotide fragment used for host-induced gene silencing into a silencing expression vector to obtain a host silencing vector, transforming the host silencing vector into Agrobacterium, transforming plants by an inflorescence dipping method and obtaining transgenic plants with reduced expression levels of genes PbCHS3 and PbCHS7;

[0035] The nucleotide fragment used for host-induced gene silencing is shown in SEQ ID NO.7.

[0036] The invention provides the use of polyoxin in interfering with the biosynthesis of chitin in the cell wall of clubroot pathogens of cruciferous crops.

[0037] The present invention also provides the use of polyoxin in preventing and controlling clubroot disease of cruciferous crops.

[0038] The present invention also provides a chemical prevention and control method for clubroot of cruciferous crops, the chemical prevention and control method comprising: applying polyoxin externally to destroy chitin synthesis, thereby reducing the disease index of clubroot.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The present invention identified that the key infection structure of the primary infection of the protist root-knot fungus - the zoosporangium contains chitin, and clarified that the chitin is synthesized by the PbCHS3 and PbCHS7 genes. This discovery not only enriched the theoretical understanding of the pathogenic biology of root-knot fungus, but also provided a theoretical basis for the research and development of precise prevention and control technology of root-knot disease.

[0041] The present invention provides a variety of technologies for improving the clubroot disease resistance of cruciferous crops, namely, targeted inhibition of chitin synthesis in zoosporangia of root-knot fungi through exogenous dsRNA, host-induced gene silencing, and exogenous application of polyoxin, thereby blocking the initial infection of root-knot fungi, thereby achieving long-lasting and efficient clubroot disease resistance of cruciferous crops, providing a new approach for improving the clubroot disease resistance of cruciferous crops, and having broad application prospects.

[0042] The present invention creates cruciferous crops with targeted silencing of PbCHS3 and PbCHS7, which have broad-spectrum resistance to different races of root-knot fungus, and the resistance is not easily lost, and can effectively and durably prevent and control root-knot disease. It provides key germplasm resources for improving root-knot disease resistance in cruciferous crops, and has huge application potential, economic benefits and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Confocal microscopy images of dormant spores in Arabidopsis cortical cells 25 days after inoculation and zoosporangium in Arabidopsis root hair cells 8 days after inoculation; white arrows are fluorescent signals of zoosporangium, and the scale bar is 10 μm;

[0044] Figure 2 Identification and characterization of chitin synthase from Rhizobium; A. Evolutionary analysis of chitin synthase from Rhizobium; B. Expression and functional domain analysis of chitin synthase from Rhizobium; C. Quantitative expression analysis of PbCHS3 and PbCHS7 genes; D. Tertiary structure analysis of PbCHS3 and PbCHS7 proteins; E. Multiple sequence expression analysis of PbCHS3 and PbCHS7 genes;

[0045] Figure 3 Disease survey of Arabidopsis plants treated with dsRNA targeting silencing PbCHS3 and PbCHS7; A. Analysis of the expression of PbCHS3 and PbCHS7; B. Investigation of root swelling of Arabidopsis; C. Investigation of disease index; D. Investigation of root knot fungus biomass; E. Analysis of the number of zoosporangia per centimeter in Arabidopsis root tissue;

[0046] Figure 4 Disease investigation of transgenic Arabidopsis thaliana with targeted silencing of PbCHS3 and PbCHS7 based on HIGS technology after inoculation with different physiological races; A. Silencing vector construction strategy; B. PbCHS3 and PbCHS7 expression analysis; C. Arabidopsis root swelling investigation; D. Disease index investigation; E. Root-knot fungus biomass investigation;

[0047] Root phenotypes of each strain of Arabidopsis thaliana inoculated with different physiological races of root-knot fungus 25 days later. The scale is 1 cm.

[0048] Figure 5 Investigation on the disease resistance of transgenic rapeseed with targeted silencing of PbCHS3 and PbCHS7 based on HIGS technology; A. Analysis of the expression levels of PbCHS3 and PbCHS7; B. Investigation on root swelling of rapeseed; C. Investigation on disease index; D. Investigation on biomass of root knot fungi. DETAILED DESCRIPTION

[0049] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0050] Example 1

[0051] The wall component of zoospore of root knot fungus is chitin

[0052] By using Nile Red (NR) to label lipid droplets in root-knot fungi, and Calcofluor white (CFW) and wheat germ agglutinin (WGA) to label chitin, we successfully observed the structures of dormant spores and zoosporangia of root-knot fungi in the cortical cells of Arabidopsis thaliana. Figure 1 ). Under a confocal microscope, dormant spores showed solid circular fluorescence in the NR channel, and strong annular fluorescence in the CFW and WGA channels, indicating that their walls contained chitin. For zoosporangium, secondary zoospores in the formation stage showed irregular solid fluorescence in the NR channel, and the fluorescence signal weakened after release in the mature stage. The fluorescence signals of CFW and WGA were highly overlapped in the merge image, confirming that chitin is a common component of the dormant spore wall and the zoosporangium wall. This discovery provides an important target for understanding the biological characteristics of root knot fungi and developing new prevention and control strategies.

[0053] Example 2

[0054] Identification of chitin synthesis genes in zoosporangium of Plasmodium rudimentum

[0055] In vivo, the most critical and final step of chitin synthesis is completed by chitin synthase (CHS). CHS has long been considered an ideal target for antifungal drugs, insecticides, and acaricides. Using homology alignment and hidden Markov models, 16 CHSs (PbCHS1-PbCHS16) were identified in the genome of P. sphaeroides. Using IQ-TREE to construct an evolutionary tree, it was found that there were species-specific evolutionary events in P. sphaeroides CHS, which did not belong to the reported classes I-VII in fungi ( Figure 2 A). Using Pfam and TMHMM for domain prediction, all 16 CHSs of Rhizoctonia solani contained typical CHS domains. Expression analysis revealed that except for PbCHS1, PbCHS3 and PbCHS7, most genes were lowly expressed in dormant spores and infection stages ( Figure 2 C), among which PbCHS3 and PbCHS7 were significantly upregulated during the zoosporangium development period ( Figure 2 D). Using AlphaFold to predict the tertiary structure of proteins, the structures of PbCHS3 and PbCHS7 are similar to the reported and clearly functional Candida albicans chitin synthase CaChs2, and the core regions contain the QXXEY, EDX, and QRXRW motifs necessary for enzyme activity ( Figure 2 D). Using Muscle for multiple sequence alignment, the sequence similarity between PbCHS3 and PbCHS7 is 68.72% ( Figure 2 E). These results indicate that PbCHS3 and PbCHS7 are key genes for chitin synthesis in zoosporangia of Plasmodium rudimentum.

[0056] The nucleotide sequences of PbCHS3 and PbCHS7 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0057] The primers for detecting PbCHS3 gene expression are as follows:

[0058] SEQ ID NO.3: CCAAGTACCCGAAGAAGCGT;

[0059] SEQ ID NO.4: CGTAGTCAGGATCCGGGTTG;

[0060] The primers for detecting PbCHS7 gene expression are as follows:

[0061] SEQ ID NO.5: AGCGGAACTCGGAGGACTAT;

[0062] SEQ ID NO. 6: CATGATCAGGTGCGTCAGGT.

[0063] Example 3

[0064] Evaluation of the efficacy of exogenous dsRNA silencing PbCHS3 and PbCHS7 in the prevention and control of plant clubroot disease

[0065] The dsRNA of nucleotide fragment SEQ ID NO.3 that silences PbCHS3 and PbCHS7 genes was synthesized in vitro using T7 RNAi Transcription Kit from Nanjing Novozyme Biotechnology Co., Ltd. A blank control group and three experimental groups with dsRNA solution concentrations of 10 nmol / L, 20 nmol / L, and 40 nmol / L were set up in the experiment. The root knot fungus strain used was physiological race 4 collected from Jishou City, Hunan Province. Plants at 2 weeks old were inoculated with root knot fungus, and the inoculation amount was 10 6 Spores / plant were inoculated with a suspension of dormant spores of Rhizoctonia solani. dsRNA solution was applied 2 days, 4 days, and 6 days after inoculation. 8 days after inoculation, the expression levels of PbCHS3 and PbCHS7 of Rhizoctonia solani in each treatment group decreased significantly compared with the control, with the highest decreases of 82.18% and 75.58%, respectively ( Figure 3 A). 25 days after inoculation, the root swelling of plants in each treatment group was compared with that of the control group ( Figure 3 B) Disease index ( Figure 3 C) and the biomass of root-knot bacteria decreased significantly ( Figure 3 D), of which the protection efficiency of the 10nmol / L treatment group was 9.67%, the 20nmol / L treatment group was 32.26%, and the 40nmol / L treatment group was 51.61%. Further research found that 8 days after inoculation, the number of zoosporangia in the 40nmol / L treatment group decreased by 60.49% compared with the control group ( Figure 3E). The above results show that PbCHS3 and PbCHS7 are key genes for the development of zoosporangium in root knot fungus, and exogenous application of dsRNA silencing PbCHS3 and PbCHS7 has a good effect on the prevention and treatment of root knot disease.

[0066] The primers for synthesizing dsRNA are as follows:

[0067] SEQ ID NO.8: TAATACGACTCACTATAGGGCAGCGCACCTACAAGTCGATGC;

[0068] SEQ ID NO.9: CCCTATAGTGAGTCGTATTACCGGTACTTGACGGTGCGTGAT.

[0069] Example 4

[0070] Evaluation of the control effect of transgenic plants with clubroot disease by targeting PbCHS3 and PbCHS7 based on host-induced gene silencing (HIGS) technology

[0071] The nucleotide fragment used for host-induced gene silencing was connected into the PBI121-RNAi-Bar silencing expression vector ( Figure 4 A), after sequencing, it was transformed into Agrobacterium GV3101, and the inflorescence dipping method was used to transform Columbia-0 Arabidopsis, and the herbicide resistance carried by the vector was used to screen transgenic plants. The positive plants obtained by screening were further identified by PCR amplification. Two homozygous transgenic Arabidopsis lines L1 and L2 were obtained. Five root knot fungi from different geographical origins were inoculated. Compared with the control, the expression levels of PbCHS3 and PbCHS7 of the root knot fungi inoculated with the two transgenic lines were significantly reduced ( Figure 4 B). Disease investigation was then conducted to investigate the root swelling of the two strains ( Figure 4 C), disease index ( Figure 4 D) and the relative biomass of root knot fungi decreased ( Figure 4 E), all showed a certain resistance to clubroot disease in 5 different regions. The above research results show that the HIGS technology based on targeted silencing of PbCHS3 and PbCHS7 gives plants a broad-spectrum resistance to clubroot disease.

[0072] The primers for identifying positive transgenic plants are as follows:

[0073] SEQ ID NO.10: CAGCGCACCTACAAGTCGATGC;

[0074] SEQ ID NO. 11: AACGACGGCCAGTGAATTCCC.

[0075] Example 5

[0076] Evaluation of the control effect of transgenic rapeseed clubroot by targeting PbCHS3 and PbCHS7 based on host-induced gene silencing (HIGS) technology

[0077] The constructed PBI121-RNAi-Bar silencing expression vector was transformed into the hypocotyls of Zhongshuang 11 (ZS11) rapeseed by Agrobacterium-mediated genetic transformation to obtain two homozygous transgenic rapeseed lines S1 and S2. The root-knot fungus strain used was the No. 4 physiological subspecies collected from Jishou City, Hunan Province. Eight days after inoculation with root-knot fungus, the expression levels of root-knot fungus PbCHS3 and PbCHS7 in the root tissues of the two transgenic lines were significantly decreased compared with the control ( Figure 5 A), among which the PbCHS3 of the S1 strain was reduced by 75.12%, and the PbCHS7 was reduced by 50.72%; the PbCHS3 of the S2 strain was reduced by 65.45%, and the PbCHS7 was reduced by 51.95%. Disease investigation was carried out 25 days after inoculation, and the root swelling of the two transgenic rapeseed lines ( Figure 5 B) Disease index ( Figure 5 C) and root knotweed bacteria biomass decreased significantly ( Figure 5 The above results show that the HIGS technology based on targeted silencing of PbCHS3 and PbCHS7 confers resistance to rapeseed with clubroot disease.

[0078] Example 6

[0079] Investigation on the resistance of rapeseed to clubroot disease after external application of polyoxin

[0080] Polyoxin is a broad-spectrum antibiotic fungicide produced by Streptomyces aureus. It has good systemic conduction and works mainly by interfering with the biosynthesis of chitin in the bacterial cell wall. Polyoxin is a safe pesticide with high efficiency, low toxicity and no environmental pollution. Therefore, it is widely used in the prevention and treatment of important diseases of grain crops, special crops, fruits and vegetables. There are no reports on its research on the prevention and treatment of clubroot. Order Polyoxin 10% wettable powder produced by Japan Science and Technology Pharmaceutical Co., Ltd., and prepare it into 500 times and 1000 times liquid respectively. Root irrigation treatment was carried out on the day of ZS11 rapeseed planting. 30 days after planting ZS11 rapeseed, it was inoculated with a spore suspension of root knot fungus of Hunan Jishou No. 4 physiological subspecies. The concentration of the spore suspension was 1×10 6 / mL, and the disease survey was conducted 30 days after inoculation. The results showed that compared with the control, the root swelling of rapeseed irrigated with 500 times the liquid was not obvious, and the disease index was significantly reduced. The above research results show that exogenous irrigation of pesticides that destroy chitin synthesis has a good effect on the prevention and control of clubroot.

[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of blocking the synthesis of zoosporangium chitin in the early infection stage of root-knot fungi in preventing and controlling the root-knot disease of cruciferous crops, wherein the cruciferous crops include rape, cabbage, kale, mustard and radish.

2. Application of genes PbCHS3 and PbCHS7 and their homologous sequences in preventing and controlling clubroot disease in cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, kale, mustard and radish.

3. Application of silencing and / or reducing the expression of genes PbCHS3 and PbCHS7 and their homologous sequences in preventing and controlling clubroot disease in cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, kale, mustard and radish.

4. Application of genes PbCHS3 and PbCHS7 and their homologous sequences in the synthesis of chitin in zoosporangium of root knot fungi that prevent and control clubroot disease in cruciferous crops, wherein the cruciferous crops include rapeseed, cabbage, kale, mustard and radish.

5. A kit for preventing and controlling clubroot of cruciferous crops, characterized in that: The kit includes primers for detecting genes PbCHS3 and PbCHS7, or interfering nucleotide fragments for targeting and silencing genes PbCHS3 and PbCHS7 of root-knot bacteria: The primers for detecting gene PbCHS3 are shown in SEQ ID NO.3 and SEQ ID NO.4; The primers for detecting gene PbCHS7 are shown in SEQ ID NO.5 and SEQ ID NO.6; The interfering nucleotide fragment targeting silencing the PbCHS3 and PbCHS7 genes of Rhizoctonia solani is shown in SEQ ID NO.

7.

6. A method for preventing and controlling clubroot of cruciferous crops, characterized in that: The control method comprises: applying dsRNA of silencing gene PbCHS3 and gene PbCHS7 to reduce the expression of gene PbCHS3 and gene PbCHS7, so that the biomass of root knot fungus decreases; The primers of the dsRNA are shown in SEQ ID NO.8 and SEQ ID NO.

9.

7. A biological control method for clubroot of cruciferous crops, characterized in that: The biological control method comprises: connecting a nucleotide fragment for host-induced gene silencing into a silencing expression vector to obtain a host silencing vector, transforming the host silencing vector into Agrobacterium, transforming plants by an inflorescence dipping method and obtaining transgenic plants with reduced expression levels of genes PbCHS3 and PbCHS7; The nucleotide fragment used for host-induced gene silencing is shown in SEQ ID NO.

7.

8. Application of polyoxin in interfering with the biosynthesis of chitin in the cell wall of clubroot pathogens in cruciferous crops.

9. Application of polyoxin in preventing and controlling clubroot disease in cruciferous crops.

10. A chemical control method for clubroot of cruciferous crops, characterized in that: The chemical prevention and control method comprises: applying polyoxin externally to destroy chitin synthesis, thereby reducing the disease index of clubroot disease.

Images