Application of drug-resistant gene CSP8 in regulation and control of resistance of diaphorina citri to neonicotinoid pesticides and detection method of drug-resistant gene CSP8

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a drug-resistant gene CSP8 in regulation and control of resistance of diaphorina citri to neonicotinoid pesticides and a detection method of the drug-resistant gene CSP8, and the nucleotide sequence of the drug-resistant gene CSP8 is shown as SEQ ID NO.1. By regulating and controlling the drug-resistant gene CSP8, the resistance of diaphorina citri to neonicotinoid pesticides can be effectively regulated. The drug-resistant gene CSP8 disclosed by the invention can be used as a molecular target for field monitoring of diaphorina citri. Aiming at the resistance of diaphorina citri to neonicotinoid pesticides, the drug-resistant gene CSP8 is analyzed and screened based on an expression mode.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of a drug-resistant gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides and a detection method thereof. Background Art

[0002] Citrus Huanglongbing (HLB) is one of the most devastating diseases of citrus, also known as the "cancer" of citrus. Asian citrus psyllid (Diaphorina citri Kuwayama), belonging to the Psyllidae family (Hemiptera), is the main insect vector of Huanglongbing. Effective control of citrus psyllid can prevent the occurrence and spread of Huanglongbing. At present, the most effective and convenient method for controlling citrus psyllid in the citrus industry is still to spray chemical agents, but the frequent and unreasonable use of chemical agents has caused problems such as pesticide resistance, pesticide residues and biodiversity destruction in citrus psyllids. Citrus psyllids have been found to have varying degrees of resistance to neonicotinoid insecticides all over the world.

[0003] Chemosensory proteins (CSPs) are a class of small soluble proteins that are widely present in various insect receptors. However, there are no reports on the response mechanism of DcCSPs in citrus psyllids induced by neonicotinoid insecticides and the key genes that interact with them, as well as whether CSPs can effectively improve the resistance of citrus psyllids to insecticides. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the drug-resistant gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides and a detection method thereof. By regulating the drug-resistant gene CSP8, the resistance of citrus psyllid to neonicotinoid pesticides can be effectively regulated.

[0005] The present invention provides application of a drug-resistant gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides. The nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.1.

[0006] As a preferred embodiment, the drug resistance includes: resistance to neonicotinoid pesticides.

[0007] As a preferred embodiment, the anti-neonicotinoid pesticide includes: thiamethoxam.

[0008] The present invention provides application of drug-resistant gene CSP8 in detecting drug resistance of citrus psyllid. The nucleotide sequence of drug-resistant gene CSP8 is shown as SEQ ID NO.1.

[0009] The invention provides a method for detecting the insecticide resistance of citrus psyllid, comprising the following steps: detecting the expression level of the insecticide resistance gene CSP8 in citrus psyllid tissues, wherein the nucleotide sequence of the insecticide resistance gene CSP8 is shown in SEQ ID NO.1.

[0010] As a preferred embodiment, the amplification primer pair for the drug-resistant gene CSP8 includes: CSP8-F as shown in SEQ ID NO.2 and CSP8-R as shown in SEQ ID NO.3.

[0011] As a preferred solution, during the detection, GAPDH is used as an internal reference gene, and the amplification primer pair of GAPDH includes: GAPDH-F as shown in SEQ ID NO.4 and GAPDH-R as shown in SEQ ID NO.5.

[0012] As a preferred solution, the detection includes: real-time fluorescence quantitative detection.

[0013] As a preferred solution, the reaction system for real-time fluorescence quantitative detection is calculated as 10 μL and includes: 5 μL of SYBR Green reagent, 0.5 μL of upstream primer and downstream primer, 0.5 μL of cDNA and the balance of ultrapure water.

[0014] As a preferred embodiment, the tissue includes: feet and / or wings.

[0015] Beneficial effects: The present invention provides an application of the drug-resistant gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides, and the nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.1. By regulating the drug-resistant gene CSP8, the resistance of citrus psyllid to neonicotinoid pesticides can be effectively regulated. The protein encoded by the drug-resistant gene CSP8 of the present invention is a small molecule soluble protein, which is easy to obtain; it can be used as a molecular target for field monitoring of citrus psyllid. The present invention targets the resistance of citrus psyllid to neonicotinoid pesticides and screens out the drug-resistant gene CSP8 based on expression pattern analysis. The results of the embodiment show that by treating citrus psyllid adults with different concentrations of neonicotinoid pesticides and conducting RT-qPCR detection, it was analyzed that when the concentration of neonicotinoid pesticides was 5 mg / L, the expression level of the drug-resistant gene CSP8 in citrus psyllid adults was the highest.

[0016] The present invention provides an application of the drug resistance gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides, and the nucleotide sequence of the drug resistance gene CSP8 is shown in SEQ ID NO. 1. The results of the embodiment show that after silencing the drug resistance gene CSP8 using RNAi interference technology, the resistance of citrus psyllid to neonicotinoid pesticides can be effectively reduced.

[0017] The present invention provides a method for detecting the pesticide resistance of citrus psyllid, comprising the following steps: detecting the expression level of the drug resistance gene CSP8 in citrus psyllid tissue, wherein the nucleotide sequence of the drug resistance gene CSP8 is shown in SEQ ID NO. 1. The results of the embodiment show that by detecting the expression level of the drug resistance gene CSP8 by RT-qPCR, the resistance of citrus psyllid to neonicotinoid pesticides can be analyzed. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a graph showing the expression level of CSP8 in different tissues of citrus psyllid adults;

[0019] Figure 2 This is a graph showing the effect of different concentrations of drugs on the transcription level of CSP8;

[0020] Figure 3 This is the expression level of CSP8 after the citrus psyllid adults were treated with pesticides;

[0021] Figure 4 The SDS-PAGE analysis result of prokaryotic expression of CSP8 protein is shown in FIG. 1 , wherein 1 is the supernatant before disruption, 2 is the supernatant after disruption, 3 is the bacteria, 4 is the supernatant after membrane, 5 is the flow-through, 6 is 10 mM imidazole, 7 is 10 mM imidazole, 8 is 100 mM imidazole, and 9 is 250 mM imidazole;

[0022] Figure 5 It is the binding curve diagram of protein CSP8 and 1-NPN;

[0023] Figure 6 It is the binding curve diagram of protein CSP8 and thiamethoxam;

[0024] Figure 7 This is a graph showing the detection results of CSP8 silencing efficiency;

[0025] Figure 8 This figure shows the effect of silencing CSP8 on the insecticide resistance of citrus psyllid. DETAILED DESCRIPTION

[0026] The present invention provides an application of a drug-resistant gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides. The nucleotide sequence of the drug-resistant gene CSP8 (GenBank: MN731492.1) is shown in SEQ ID NO.1:

[0027] 5'-ATGTTCAAGTTGTGTAGCGCCGCTGTTGGCCTGTTCCTGGCTGTGC AACTGGTTGCTGGAAAGCCAGCTGGAGAGAAGTACACCACCAAGTATGACAACGTGGATCTGGATCAGATCCTGAGGAACGACAGACTGATCAACAACTACTACAACTGTCTCCTGGACAAGGGCAAGTGCTCACCTGATGGACAGGAACTGAAAAACAAGCTTCCTGACGCCATCGCCACCGA GTGCAAGAGCTGCTCCGAGAAGCAGAAGGAAGGCTCTAAGAGGATCTTCAAGTACCTCATTGACAACAAGCCAGAACAATGGGCTGAGCTAGAGAAGAAGTTCGACCCCAACGGTACATATAAGGCCAAGTACCAGAAGGAGCTGTCAGACCTGAAGGCTGGAAAGCCCGTGAAGATCTAA-3'.

[0028] As a preferred embodiment, the drug resistance of the present invention includes: resistance to neonicotinoid pesticides. As a specific embodiment, the neonicotinoid pesticide of the present invention includes: thiamethoxam. The present invention uses neonicotinoid pesticides to treat citrus psyllid adults, and then performs RT-qPCR to detect the expression level of CSPs genes, and finally screens out the drug resistance gene CSP8.

[0029] The present invention provides the application of the drug-resistant gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides, and the nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.1. In the present invention, the constructed drug-resistant gene CSP8 expression vector can be transferred into Escherichia coli, and IPTG is used to induce expression. After the strain culture is completed, the bacteria are collected, the cells are ultrasonically broken, the target protein is released, and the target protein is purified by chromatography separation to obtain a high-purity target protein. Finally, the protein is concentrated by low-temperature high-speed centrifugation, and the target band is detected by SDS-PAGE gel electrophoresis. In one embodiment, RT-qPCR detection is performed after treating citrus psyllid adults with different concentrations of neonicotinoid pesticides. It is analyzed that when the concentration of neonicotinoid pesticides is 5 mg / L, the expression level of the drug-resistant gene CSP8 in the citrus psyllid adults is the highest, and at this concentration, the expression level of the treatment group in the citrus psyllid feet is significantly increased compared with the control group.

[0030] As a preferred embodiment, a primer pair of the drug resistance gene CSP8 with a T7 promoter is designed, PCR amplification is performed using the CSP8 plasmid as a template, and then agarose gel electrophoresis is performed and the template for synthesizing dsRNA is recovered using a kit gel; and the dsRNA is synthesized using the PromegaT7 RiboMAX Express RNAi System, and finally the purity of the dsRNA is detected by agarose gel electrophoresis before RNA interference experiments can be performed. The results of the embodiment show that after silencing the drug resistance gene CSP8 using interference technology, the resistance of citrus psyllid to neonicotinoid pesticides can be effectively reduced.

[0031] The present invention provides application of drug-resistant gene CSP8 in detecting drug resistance of citrus psyllid. The nucleotide sequence of drug-resistant gene CSP8 is shown as SEQ ID NO.1.

[0032] The present invention provides a method for detecting the insecticide resistance of citrus psyllid, comprising the following steps: detecting the expression level of the drug-resistant gene CSP8 in the tissue of citrus psyllid, wherein the nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.1. As a preferred embodiment, the tissue includes: legs and / or wings. In one embodiment, the expression level of the drug-resistant gene CSP8 in different tissues of citrus psyllid adults is detected by RT-qPCR, and the analysis shows that the drug-resistant gene CSP8 is highly expressed in the legs of citrus psyllid.

[0033] In the present invention, the expression level of the drug-resistant gene CSP8 in the adult tissues of citrus psyllid can be detected by RT-qPCR. As a preferred embodiment, the amplification primer pair of the drug-resistant gene CSP8 includes: CSP8-F as shown in SEQ ID NO.2 and CSP8-R as shown in SEQ ID NO.3; during the detection, GAPDH is used as the internal reference gene, and the amplification primer pair of GAPDH includes: GAPDH-F as shown in SEQ ID NO.4 and GAPDH-R as shown in SEQ ID NO.5.

[0034] As a preferred embodiment, the detection includes: real-time fluorescence quantitative detection, for example, RT-qPCR detection using SYBR Green (YEASEN) enzyme, and the reagent contains SYBR Green I fluorescent dye. The reaction system of the real-time fluorescence quantitative detection of the present invention can include: 5 μL of SYBR Green reagent, 0.5 μL of upstream primer and downstream primer, 0.5 μL of cDNA and the balance of ultrapure water in 10 μL.

[0035] To further illustrate the present invention, the application of the drug-resistant gene CSP8 provided by the present invention in regulating the resistance of citrus psyllid to neonicotinoid pesticides and its detection method are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0036] Example 1 Expression pattern analysis

[0037] (1) Two groups of experiments were set up, one for the control group treated with glycerol and the other for the experimental group treated with thiamethoxam. Murraya osmanthus with 3 to 5 leaves of moderate age were selected and soaked in glycerol and pesticide (5 mg / L) for 30 seconds respectively. After drying at room temperature for 1 hour, they were placed in a homemade plastic cup device and then released to feed on psyllids.

[0038] After treating the citrus psyllid adults in the above manner for 24 hours, 4 biological replicates were set up, and samples were collected respectively. The total RNA of the citrus psyllid was extracted using the Trizol kit. After the concentration was detected, the cDNA was synthesized using the cDNA first-strand synthesis kit (YEASEN / Yisheng, Yisheng Biotechnology (Shanghai) Co., Ltd.) (refer to the instructions for specific steps). Using cDNA as a template, CSP8 as the target gene, and GAPDH as an internal reference gene, SYBR Green (YEASEN / Yisheng, Yisheng Biotechnology (Shanghai) Co., Ltd.) enzyme was used to perform RT-qPCR detection to detect the expression level of the CSPs gene, and finally the CSP8 gene sequence (as shown in SEQ ID NO.1) was screened out.

[0039] Real-time fluorescence quantitative primers for CSP8: qPCR-F (as shown in SEQ ID NO.2): 5'-AAGCCAGCTGGAGAGAAGT-3'; qPCR-R (as shown in SEQ ID NO.3): 5'-GAAAGCCCG TGAAGATCTAA-3'.

[0040] The real-time fluorescence quantitative primers for GAPDH are qPCR-F (as shown in SEQ ID NO.4): 5'-CATGGCAAGTTCAACGGTGA-3'; qPCR-R (as shown in SEQ ID NO.5): 5'-CGATGCCTTCTCAATGGTGG-3'.

[0041] The RT-qPCR reaction system parameters are shown in Table 1 , and the RT-qPCR reaction program parameters are shown in Table 2 .

[0042] Table 1 RT-qPCR reaction system

[0043]

[0044] Table 2 RT-qPCR reaction conditions

[0045]

[0046] (2) The head, thorax, abdomen, legs, wings, salivary glands, and intestines of citrus psyllid were collected, with 3 biological replicates in each group. The total RNA of citrus psyllid was extracted using the Trizol kit. After the detection concentration was feasible (i.e., the system that could synthesize the cDNA chain contained 500 ng of sample), cDNA was synthesized using the same steps as (1). The SYBR Green (YEASEN / Yisheng, Yisheng Biotechnology (Shanghai) Co., Ltd.) reagent system was used for RT-qPCR to detect the expression level of CSP8 in different tissues of citrus psyllid. The results are shown in Figure 1 Among them, the P value was calculated using the independent sample t test, the standard error was represented by the error bar, and the different lowercase letters (a, b, c) above indicated significant differences when P < 0.05.

[0047] from Figure 1 It can be seen that CSP8 is mainly highly expressed in the legs and wings of citrus psyllid, and there are significant differences; and CSP8 is highly expressed in the legs of citrus psyllid.

[0048] (3) The experiment was set up as described above using different concentrations of thiamethoxam, i.e., concentrations of 0, 5 mg / L, 10 mg / L, and 15 mg / L. Psyllid feet were collected, with 3 biological replicates per group, and RT-qPCR detection was performed. The test results are shown in the table. Figure 2 Among them, the P value was calculated using the independent sample t test, the standard error was represented by the error bar, and the different * above indicated significant differences when P<0.05, among which * and ** indicated extremely significant differences.

[0049] from Figure 2 It can be seen that when the concentration of the agent is 5 mg / L, the expression level of CSP8 in citrus psyllid adults is the highest.

[0050] At the same time, the expression levels in the feet of citrus psyllids treated with 5 mg / L concentration and the control group were compared. Figure 3 Among them, the P value was calculated using the independent sample t test, the standard error was represented by the error bar, and the * above indicated a significant difference when P < 0.05.

[0051] from Figure 3 It can be seen that the expression level in the treated group was significantly increased compared with the control group in the citrus psyllid legs.

[0052] Example 2 Prokaryotic expression and in vitro purification

[0053] (1) Prokaryotic expression

[0054] CSP8 recombinant plasmid construction:

[0055] The sequence is the same as above, and the target fragment with SalⅠ and NotⅠ is selected for amplification, and then the pET-30a(+) prokaryotic expression vector is double-digested with SalⅠ and NotⅠ restriction endonucleases to linearize it. The Universal One Step Cloning Kit homologous recombination cloning kit (YEASEN / Yisheng, Yisheng Biotechnology (Shanghai) Co., Ltd.) was used to connect and recombinant the pET-30a(+) vector and the target fragment (refer to the instruction manual for specific steps).

[0056] The ligation product was transferred to DH5α competent cells for culture, the positive strains were identified by PCR, and the positive strains were sent for sequencing. The sequencing results were compared and analyzed using SnapGene software, and the recombinant plasmid was named pET-30a-CSP8.

[0057] Transform the recombinant plasmid into E. coli BL21 (DE3) competent cells (refer to the instruction manual for specific steps). Inoculate the positive strain into LB liquid medium (containing 50 μg / mL kanamycin) and culture at 200 r / min and 37°C until OD 600 =0.6, add 0.1mM IPTG to induce the expression strain for 12h. After the culture is completed, the bacteria are collected, washed with ddH2O, and finally resuspended with PBS to which PMSF (1:100) has been added. The cells are ultrasonically disrupted until the solution is almost clear to release the target protein. Centrifuge at 4°C, 12000rpm for 15min, collect the supernatant of the cell lysate and place it on ice, and filter the supernatant with a 0.45μm membrane. The filtered supernatant is purified by affinity chromatography column at low temperature. 10mM imidazole, 100mM imidazole, and 250mM imidazole are used to elute the protein, and the flow-through is collected separately. The purified protein has a His tag. The purified proteins are then concentrated using concentrators, and the target proteins are detected by SDS-PAGE gel electrophoresis. The results are shown in Figure 4 .

[0058] from Figure 4 It can be seen that the results of bands 1 to 9 all show that the positions of the prokaryotic expressed and purified proteins are consistent with those of the target protein bands, and the verification results are all correct.

[0059] (2) In vitro expression

[0060] The saturation binding curve of protein and fluorescent probe 1-NPN was determined by fluorescence spectrophotometer FL970. 1mM 1-NPN solution prepared with different volumes of chromatographic grade methanol was added to the protein solution (1μM) in the cuvette until the concentration of 1-NPN in the cuvette was 0-20μM. After each addition of 1-NPN, the mixture was allowed to stand for 30s to ensure that the substances in the solution were fully mixed. The maximum absorbance was scanned and recorded to draw the binding curve of protein with 1-NPN. Subsequently, a protein solution with a final concentration of 1μM and 1μM 1-NPN were configured as the basic reaction solution, and then 1mM ligand solution prepared with different volumes of methanol was added to the cuvette until the final concentration of the ligand reached 10μM in the cuvette. After each addition of ligand, the mixture was allowed to stand for 30s to ensure that the substances in the solution were fully mixed. The maximum absorbance was scanned and recorded. The above detection data were processed. First, the binding constant of the tested protein sample and 1-NPN was calculated according to the Scatchard equation. The binding constant of protein and thiamethoxam was calculated according to the following formula combined with the Scatchard equation. The absorbance data measured by the instrument are shown in Tables 3 and 4. The graph software GraphPadPrism 8.0.1 was used to plot the fluorescence intensity corresponding to each concentration on the horizontal axis with 3 technical replicates to produce Figure 5 and Figure 6 .

[0061] K i =[IC 50 ] / (1+[1-NPN] / K 1-NPN )

[0062] IC 50 : Table 4 and Figure 6 The concentration of thiamethoxam corresponding to the fluorescence intensity of 50% is the IC 50 =5.313 μM, calculated directly by the graphing software GraphPadPrism 8.0.1;

[0063] [1-NPN]: the concentration of free fluorescent dye 1-NPN, the remaining fluorescent dye concentration after 1 μM CSP8 protein binds to 1 μM fluorescent dye 1-NPN, calculated based on the relative value of fluorescence [1-NPN] = 0.84 μM;

[0064] K 1-NPN : The binding constant of CSP8 and 1-NPN, i.e., K 1-NPN =K d =7.04μM.

[0065] Table 3 Absorbance of the binding of protein CSP8 to 1-NPN

[0066]

[0067] Table 4 Absorbance of the binding of protein CSP8 and thiamethoxam

[0068]

[0069] From Table 3, Table 4, Figure 5 and Figure 6 The data obtained by IC 50 , 1-NPN and K1-NPN, put the three data into the above formula to calculate K i The value is 4.74μM. Previous studies have reported (see: Wang SY, Gu SH, Han L, et al. Specific involvement of two amino acid residues in cis-nerolidol binding to odorant-binding protein 5AlinOBP5 in the alfalfa plant bug, Adelphocoris lineolatus (Goeze) [J]. Insect Molecular Biology, 2013, 22 (2), 172-182), K i When the value is less than 10 μM, the binding affinity of CSPs to insecticides is strong, and medium indicates K i Values ​​in the range of 10 to 20 μM weakly indicate K i The value is in the range of 10 to 20 μM. It can be seen that CSP8 has a strong affinity for thiamethoxam molecules (K i =4.74μM) has a strong binding ability.

[0070] Example 3 RNA interference and drug resistance detection

[0071] (1) Design CSP8 primers with T7 promoter, perform PCR amplification with CSP8 plasmid as template, use kit to recover PCR product and measure concentration, and finally obtain template for synthesizing dsRNA. Use Promega T7 RiboMAX Express RNAi System to synthesize dsRNA (according to the method steps in the manual), and finally perform RNA interference experiment after agarose gel electrophoresis to detect dsRNA purity. With dsGFP as the control and dsCSP8 as the treatment group, 5 biological replicates were set up, and the citrus psyllid adults were injected with a microinjector at an injection concentration of 1500 ng / μL and an injection volume of 40 nL. The injected citrus psyllids were placed in a device containing young shoots of Murraya osmanthus prepared in advance and raised for 24 h and 48 h. The citrus psyllids that were disturbed for 24 h and 48 h were collected, and 6 biological replicates of dsGFP and dsCSP8 were collected, respectively. RNA was extracted using the Trizol kit method, and cDNA was synthesized using a cDNA first-chain synthesis kit (YEASEN / Yisheng, Yisheng Biotechnology (Shanghai) Co., Ltd.), and SYBR Green enzyme was used for RT-qPCR to detect the silencing efficiency of dsCSP8 on citrus psyllid adults at 24 h and 48 h. The results are shown in Tables 5, 6 and Figure 7 Among them, the P value was calculated by independent sample t test, and the asterisk indicates that the difference between the experimental group and the control group is significant (*P<0.05; **P<0.01).

[0072] Table 5 Silencing efficiency after interfering with CSP8 for 24h

[0073]

[0074] Table 6 Silencing efficiency after interfering with CSP8 for 48h

[0075]

[0076] From Table 5, Table 6 and Figure 7 It can be seen that the silencing efficiency after injection of dsCSP8 was 85.37% compared with the control group dsGFP 24 hours after interference, and there was a significant difference; the silencing efficiency was 92.80% after 48 hours of interference, and there was a very significant difference.

[0077] (2) Prepare 5ppm of thiamethoxam, select leaves of Murraya odorifera with similar size and growth status for immersion, soak for 30s, and let stand at room temperature for 1h to allow the pesticide to fully penetrate the leaves. Prepare 5 plastic cups of appropriate size, put the leaves in them respectively, set 5 biological replicates, and then suck and blow the citrus psyllids that have been disturbed for 24h into the cups respectively, and let them feed. The citrus psyllids treated with dsGFP and dsCSP8 were counted for 5 biological replicates at each time point corresponding to 12h, 24h, 36h and 48h, respectively. The mortality rate = number of deaths / total number × 100%. The results are shown in Tables 7 and Figure 8 Among them, the mortality statistics corresponding to each time point on the horizontal axis have 5 biological replicates, and the error bar of each point represents the error size of the data of these 5 biological replicates. The P value was calculated using the independent sample t test, and the asterisk indicates that the difference between the experimental group and the control group is significant (*P<0.05; **P<0.01).

[0078] Table 7 Mortality statistics at different time periods after interfering with CSP8

[0079]

[0080] From Table 7 and Figure 8 It can be seen that after silencing CSP8, the mortality rate of citrus psyllid increased significantly, and its resistance to thiamethoxam decreased significantly, showing an extremely significant difference at 36 hours and tending to stabilize after 48 hours.

[0081] It can be seen that the present invention, through the study on the resistance of citrus psyllid to neonicotinoid pesticides, screened out CSP8 based on expression pattern analysis, and after silencing CSP8 using RNAi interference technology, the resistance of citrus psyllid to neonicotinoid pesticides can be effectively reduced.

[0082] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of the drug resistance gene CSP8 in regulating the resistance of citrus psyllid to neonicotinoid pesticides, characterized in that: The nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug resistance includes: resistance to neonicotinoid pesticides.

3. The use according to claim 1, characterized in that: The anti-neonicotinoid pesticides include: thiamethoxam.

4. Application of drug-resistant gene CSP8 in detecting drug resistance of citrus psyllid, characterized in that: The nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.

1.

5. A method for detecting insecticide resistance of citrus psyllid, characterized in that: The following steps are involved: The expression level of the drug-resistant gene CSP8 in the tissues of citrus psyllid was detected. The nucleotide sequence of the drug-resistant gene CSP8 is shown in SEQ ID NO.

1.

6. The detection method according to claim 5, characterized in that: The amplification primer pair of the drug-resistant gene CSP8 includes: CSP8-F as shown in SEQ ID NO.2 and CSP8-R as shown in SEQ ID NO.

3.

7. The detection method according to claim 6, characterized in that: During the detection, GAPDH is used as an internal reference gene, and the amplification primer pair of GAPDH includes: GAPDH-F as shown in SEQ ID NO.4 and GAPDH-R as shown in SEQ ID NO.

5.

8. The detection method according to any one of claims 5 to 7, characterized in that: The detection includes: real-time fluorescence quantitative detection.

9. The detection method according to claim 8, characterized in that: The reaction system for real-time fluorescence quantitative detection is calculated as 10 μL, including: 5 μL of SYBR Green reagent, 0.5 μL of upstream primer and downstream primer respectively, 0.5 μL of cDNA and the balance of ultrapure water.

10. The detection method according to claim 5, characterized in that: The tissues include: feet and / or wings.

Images