Application of BnDHAR3 gene in regulation and control of oil content of rape seeds

Abstract

The invention discloses an application of a BnDHAR3 gene in regulation and control of oil content of rape seeds, a candidate gene influencing the oil content of the rape seeds is obtained by using comparative transcriptome data between high-oil and low-oil rape materials, the rape oil content regulation and control gene BnDHAR3 is successfully separated and cloned through PCR amplification and sequence alignment, and after the BnDHAR3 gene is over-expressed in rape, the rape oil content regulation and control gene BnDHAR3 is obtained. Compared with a control group, the oil content of the transgenic rape seeds is increased by more than 10% at most, and the purpose of increasing the oil yield of plants can be achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a gene BnDHAR3 for regulating the oil content of rapeseed seeds. Increasing the expression level of the BnDHAR3 gene by genetic engineering technology can increase the oil content of rapeseed seeds, thereby achieving the purpose of increasing the oil yield of crops. Background Art

[0002] Vegetable oils and fats are an indispensable component of human diet, an important industrial raw material and bioenergy, and play an important role in national economic and social development. In recent years, as people pursue a healthier diet, vegetable oils and fats have gradually replaced animal oils and fats and have become the main consumer oils in my country's edible oil market. my country's demand for vegetable oils and fats has increased year by year, but production has been declining, and the supply of edible oils has relied heavily on imports.

[0003] Rapeseed accounts for about 40% of edible oil in my country and is an important oil-bearing economic crop in my country. Studies have shown that every 1% increase in the oil content of rapeseed seeds is equivalent to a 2.5% increase in production. Therefore, increasing the oil content of rapeseed seeds is an important measure to ensure the supply of edible oil in my country. Current research predicts that the oil content of rapeseed seeds can reach up to 75%, but the average oil content of existing rapeseed varieties in my country has been hovering around 43%, and there is still a lot of room for improvement. The oil content of rapeseed is a quantitative trait controlled by multiple micro-effect genes and greatly affected by environmental conditions, which makes it very difficult to significantly increase the oil content of rapeseed seeds using traditional breeding techniques. At present, with the continuous development and maturity of molecular biology and sequencing technology, the mining, isolation, cloning and functional research of rapeseed seed oil content regulatory genes are becoming more and more in-depth; using genetic engineering technology and gene editing technology to create new rapeseed varieties with high oil content has become a new direction in rapeseed breeding, with broad development and application prospects.

[0004] The biosynthetic pathways of fatty acids and oils have been studied thoroughly in plants. For example, in the model plant Arabidopsis, the biosynthetic pathways of plant oils mainly include three steps: fatty acid (FA) synthesis, triglyceride (TAG) assembly, and oil body formation). A considerable number of related genes have been isolated and identified from different species, and studies have also shown that the chemical pathways for fatty acid and oil synthesis in different species are basically the same. The main prerequisites for seed oil synthesis include acetyl-CoA, NAD(P)H, and ATP. The sources and regulation of these synthetic precursors directly affect the rate and amount of oil accumulation. Plant oil metabolism is a complex biological process involving multiple genes, with multiple regulatory points and regulatory factors, such as key transcription factors, fatty acid synthesis and transport, TAG accumulation, glycolysis, acetyl-CoA, pentose phosphate pathway, starch synthesis and degradation, etc. The key transcription factors affecting oil synthesis include WRI1, LEC1, and LEC2. In LEC1-overexpressing rapeseed transgenic plants, key genes involved in glycolysis, plastid fatty acid synthesis, and oil accumulation were upregulated, and the fatty acid content increased significantly. LEC2 is a plant-specific B3 transcription factor family, and its transcription level is positively correlated with oil accumulation. However, due to the functional redundancy of most transcription factors, the complexity of studying the regulation of oil content has increased, and the mechanism of action of some transcription factors is still unknown. In recent years, with the release of high-quality rapeseed genomes, several Arabidopsis thaliana homologous rapeseed oil synthesis regulatory genes have been cloned; a small number of new rapeseed oil synthesis regulatory genes such as BnGDSL, BnSDP1 and BnGRF2 have been discovered.

[0005] In the present invention, the inventors conducted transcriptomic comparative analysis between embryos of high-oil rapeseed and low-oil rapeseed varieties at different developmental stages, and screened out that the expression level of the BnDHAR3 gene was significantly different between high-oil and low-oil rapeseed, and the oil content of the heterozygous mutant of the homologous gene in Arabidopsis was reduced by 3-4 percentage points. By isolating and cloning the gene, constructing an overexpression vector, and verifying rapeseed transformation, it was finally confirmed that BnDHAR3 can regulate the change in plant seed oil content. Applying this gene to crop breeding can greatly increase the oil yield of oil crops. Summary of the invention

[0006] The object of the present invention is to provide a BnDHAR3 gene for regulating the oil content of rapeseed seeds, the coding sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide an application of the gene BnDHAR3 in regulating plant oil yield or breeding high-oil-yield rapeseed, thereby increasing the oil content of seeds by increasing the expression level of the BnDHAR3 gene in plants, thereby achieving the purpose of increasing plant oil yield.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] 1. Acquisition of BnDHAR3 gene

[0010] Using two groups of rapeseed resources with large differences in oil content, comparative transcriptomic analysis was conducted between high-oil rapeseed varieties (ZY036) and low-oil rapeseed varieties (93275). It was found that in rapeseed embryos at 25 and 35 days of development, the expression level of the BnaA02G0065900ZS gene in high-oil rapeseed seeds was significantly higher than that in low-oil rapeseed. It is speculated that this gene may regulate the oil content of rapeseed seeds. This gene has three homologous genes in rapeseed, namely BnaA02G0367700ZS, BnaA10G0199800ZS, and BnaC03G0065300ZS. After comparison with the Arabidopsis database, it was found that the homologous gene of BnaA02G0065900ZS in Arabidopsis is a DHAR3 gene encoding dehydroascorbate reductase, so the BnaA02G0065900ZS gene was named BnDHAR3 gene.

[0011] 2. Cloning of the CDS region of the BnDHAR3 gene and construction of a plant overexpression vector

[0012] Using the cDNA of the rapeseed variety ZS11 as a template, PCR amplification was performed with primers BnDHAR3-F: 5′-ATGATAAGACTGAGGTTTCA-3′ (SEQ ID NO.3) and BNDHAR3-R: 5′-TCAGGCCATCACCTTCGGTC-3′ (SEQ ID NO.4). The amplified fragment was verified by sequencing and sequence alignment and was determined to be the full-length CDS sequence of the rapeseed BnDHAR3 gene. Its nucleotide sequence is shown in SEQ ID NO.1, and its encoded amino acid sequence is shown in SEQ ID NO.2.

[0013] 3. Construction and verification of plant overexpression vector of BnDHAR3

[0014] The CDS full-length sequence of the BnDHAR3 gene cloned above was connected to the plant overexpression vector pCAMBIA1305 and named as pCAMBIA1305-BnDHAR3 recombinant vector. The pCAMBIA1305-BnDHAR3 recombinant vector was transformed into Escherichia coli, and after sequencing verification, the recombinant vector was transformed into Agrobacterium strain GV3101.

[0015] 4. Genetic transformation and oil content analysis of rapeseed

[0016] The rapeseed variety Double 6 was transformed by Agrobacterium-mediated rapeseed petiole infection. After antibiotic screening, homozygous T3 generation homozygous transgenic rapeseed was obtained. The seeds of transgenic rapeseed were collected and the oil content was determined.

[0017] The experimental results show that after using genetic engineering technology to increase the expression level of rapeseed BnDHAR3 gene, the oil content of transgenic rapeseed seeds increased by 6.81-11.08% compared with untransformed rapeseed.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0019] The present invention is the first domestic disclosure of the role of the BnDHAR3 gene in increasing the oil content of rapeseed. The present invention uses comparative transcriptome data between high-oil and low-oil rapeseed materials for the first time to obtain candidate genes that affect the oil content of rapeseed seeds. After PCR amplification and sequence alignment, the rapeseed oil content regulatory gene BnDHAR3 is successfully isolated and cloned. The experimental results of the present invention show that after overexpressing the BnDHAR3 gene in rapeseed, the oil content of transgenic rapeseed seeds is increased compared with the control (non-transgenic plants), and the highest increase in the oil content of transgenic rapeseed seeds exceeds 10%. This gene provides a new gene resource for high-oil breeding of rapeseed and can be used to increase the oil yield of rapeseed. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 .The expression levels of BnDHAR3 and its homologous genes in various tissues of rapeseed.

[0021] Figure 2 .The expression level of BnDHAR3 between high-oil and low-oil rapeseed varieties.

[0022] Figure 3 . Schematic diagram of vector construction.

[0023] Figure 4 .Results of oil content determination of BnDHAR3 transgenic rapeseed seeds. DETAILED DESCRIPTION

[0024] Example 1: Acquisition of rapeseed oil content regulating gene BnDHAR3

[0025] First, we selected rape varieties with significant differences in oil content for comparative transcriptomic analysis, and found that in the 35-day-old rape embryo, the expression level of the BnaA02G0065900ZS gene in high-oil rape was significantly higher than that in low-oil rape. After homologous comparison of gene sequences, we found that the homologous gene of this gene in Arabidopsis is a dehydroascorbate reductase DHAR3, so the gene was named BnDHAR3. The BnDHAR3 gene has three homologous genes in rapeseed: BnaA02G0367700ZS, BnaA10G0199800ZS, and BnaC03G0065300ZS. Among them, BnaA02G0367700ZS and BnaC03G0065300ZS genes are not expressed, and BnaA10G0199800ZS is more likely to be expressed in tissues other than seeds. The expression levels of BnDHAR3 and its homologous genes in Zhongshuang 11 are shown in Figure 2. Figure 1 As shown in Figure 2, the expression levels of BnDHAR3 (BnaA02G0065900ZS) in high and low oil materials are as follows: Figure 2 As shown. Using the cDNA of ZS11 rapeseed as a template, the specific primers BnDHAR3-F: 5′-ATGATAAGACTGAGGTTTCA-3′ (SEQ ID NO.3) and BNDHAR3-R: 5′-TCAGGCCATCACCTTCGGTC-3′ (SEQ ID NO.4) of the BnDHAR3 gene were designed for PCR amplification. The PCR amplification system was: 2×Mix buffer 25μL, BnDHAR3-F 2μL, BnDHAR3-R 2μL, cDNA 1μL, ddH2O 20μL. The PCR amplification program was: 94℃ pre-denaturation for 5min; 94℃30s, 56℃30s, 72℃30s, and this cycle for 35 times; 72℃ extension for 10min; and finally stored at 4℃. The PCR product was verified by sequencing and sequence alignment, and the full-length CDS product of the BnDHAR3 gene was obtained.

[0026] Example 2: Cloning of rapeseed oil content regulatory gene BnDHAR3 and construction of plant overexpression vector

[0027] Match the backbone vector, design recombination primers 35S::BnDHAR3-F: 5′-ggacagcccagatcaactagt ATGATAAGACTGAGGTTTCA-3′ (sequence ggacagcccagatcaactagt is the upstream sequence of the SpeI restriction site of the pCAMBIA1305 vector) and 35S::BnDHAR3-R: 5′-gcccttgctcaccatggatcc TCAGGCCATCACCTTCGGTC-3′ (sequence gcccttgctcaccatggatcc is the downstream sequence of the BamH I restriction site of the pCAMBIA1305 vector), use the cDNA of ZS11 rapeseed as a template, amplify the obtained PCR product, purify it with a PCR product purification kit and save it for later use. The plant overexpression vector pCAMBIA1305 was double-digested with SpeI and BamH I restriction endonucleases, detected by 1% agarose gel electrophoresis, and recovered with a gel recovery kit and stored for later use.

[0028] The PCR purified product of the BnDHAR3 gene and the recovered restriction plasmid were recombined using a non-ligase-dependent single fragment rapid cloning kit. The reaction system was: 5×CE II Buffer 4μL, Exnase II 2μL, linearized vector 50-200ng, inserted fragment 10-200ng, and ddH2O supplemented to 20μL. The recombinant product was transformed into Escherichia coli DH5α competent cells, and after inverted culture in a 37°C incubator for 12-16h, the grown single clones were PCR detected with the vector upstream primer 35S: 5′-GACGCACAATCCCACTATCC-3′ and the downstream primer NOS: 5′-GATAATCATCGCAAGACCGG-3′. The single clones verified as positive by PCR were sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. The analysis results showed that the full-length CDS of the BnDHAR3 gene was obtained, and its nucleotide sequence was shown in SEQ ID NO.1, and its encoded amino acid sequence was shown in SEQ ID NO.2. The expression vector plasmid of the positive single colony with correct sequencing was extracted, and the plasmid was the recombinant plasmid pCAMBIA1305-BnDHAR3 (the vector construction diagram is shown in Figure 3 shown).

[0029] Example 3: Agrobacterium transformation of rapeseed oil content regulating gene BnDHAR3

[0030] 1. Agrobacterium Transformation

[0031] (1) Thaw the competent cells of Agrobacterium tumefaciens GV3101 stored at -80°C to an ice-water mixture at room temperature and place them on ice;

[0032] (2) Use a pipette to draw about 100 ng of pCAMBIA1305-BnDHAR3 recombinant plasmid and add it to GV3101 competent cells, and place them on ice for 5 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min.

[0033] (3) Then add about 700 mL of LB liquid medium (10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl) and place in a shaker at 28°C and 200 rpm for 2-3 h;

[0034] (4) Spread the bacterial solution on LB solid medium supplemented with 50 mg / L kanamycin (Kan), 50 mg / L gentamicin (Gent), and 50 mg / L rifampicin (Rif), and culture in an inverted incubator at 28°C for 36-48 h;

[0035] (5) PCR detection was performed on the grown Agrobacterium single clone using the upstream primer 35S: 5′-GACGCACAATCCCACTATCC-3′ and the downstream primer NOS: 5′-GATAATCATCGCAAGACCGG-3′ of the plant expression vector. The positive single clone was shaken to OD 600 =1.8-2.0, and then preserve the bacteria in 50% glycerol and store in -80℃ ultra-low temperature refrigerator for later use.

[0036] 2. Preparation of Agrobacterium suspension with BnDHAR3 target gene:

[0037] (1) Inoculate the Agrobacterium carrying the target gene in 200 mL of LB liquid medium (containing 50 mg / L Kan, 50 mg / L Gent, and 50 mg / L R Fif) at a ratio of 1:100 (volume ratio) and place in a 28°C shaker at 200 rpm until OD 600 The value is about 0.6;

[0038] (2) Place the bacterial solution in a high-speed centrifuge and centrifuge at 8000 rpm for 15 min, discard the supernatant, and collect the bacterial cells;

[0039] (3) Resuspend the Agrobacterium cells in a resuspension solution (5% sucrose and 0.02% surfactant L-77) to an OD of 600 It is about 1.0, and is prepared into Agrobacterium suspension for subsequent plant transformation.

[0040] Example 4: Transformation and identification of rapeseed overexpressing BnDHAR3

[0041] 1. Transformation of rapeseed using the cotyledon petiole infection method. The specific steps are as follows:

[0042] (1) After soaking and disinfecting Zhongshuang No. 6 rapeseed seeds in 70% ethanol solution for 1 min, adding mercuric chloride (HgCl2) solution and soaking and disinfecting for 13-15 min, washing with sterile water for 5 times, and then spreading them on MS culture medium to obtain rapeseed sterile seedlings for use;

[0043] (2) Take the cotyledon petioles of 4-5 day old sterile seedlings, place them in the above Agrobacterium suspension and soak them for 5-8 minutes, shake them gently, then pour out the bacterial solution and absorb the bacterial solution remaining on the explants; place the transformed cotyledon petioles on a co-culture medium (containing 0.2 mg / L 6-benzyladenine (6-BA), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 200 μM acetosyringone) and culture them for 2-3 days;

[0044] (3) The co-cultured explants were transferred to a differentiation medium containing penicillin (Car) and sterilized and differentiated in a dark greenhouse for 5-7 days; then transferred to a selection medium supplemented with Kan (containing 3 mg / L 6-BA, 0.1 mg / L α-naphthylacetic acid (NAA), 5 mg / L silver nitrate (AgNO3), 400 mg / L Car and 15 mg / L Kan) for screening until the explants differentiated into regenerated green shoots;

[0045] (4) When the regenerated shoots grew to 1 cm, the shoots were cut and transferred to rooting medium (containing 0.2 mg / L NAA, 10 mg / L Kan and 400 mg / L Car) for screening;

[0046] (5) After the transformed seedlings have taken root and grown leaves, DNA of the transformed seedlings is extracted and PCR identification is performed;

[0047] (6) The positive seedlings identified by PCR were transplanted into nutrient pots in an artificial climate chamber for growth. After the seeds matured, the individual plants were harvested to obtain T1 generation transgenic rapeseed seeds.

[0048] 2. Use hygromycin to screen homozygous positive transgenic rapeseed plants. The specific steps are as follows:

[0049] (1) Referring to the experimental steps for the above-mentioned sterile rapeseed seedlings, the T1 transgenic rapeseed seeds were sterilized;

[0050] (2) Spread the sterilized seeds on MS solid medium containing 25 mg / L hygromycin, culture them in a dark incubator for about 5 days, and then switch to culture under normal light;

[0051] (3) When two true leaves grow, transplant the positive seedlings into the nutrient pots in the artificial climate chamber;

[0052] (4) After the positive transgenic rapeseed seeds mature, the seeds are harvested individually and numbered and stored in sequence to obtain T2 generation transgenic rapeseed seeds;

[0053] (5) The T2 transgenic rapeseed seeds were screened for hygromycin resistance according to the above experimental steps, and strains with a separation ratio of 3:1 were screened and transplanted into an artificial climate chamber, and individual plants were harvested and numbered and stored in sequence to obtain T3 transgenic rapeseed seeds;

[0054] (6) The T3 transgenic rapeseed seeds were screened for hygromycin resistance according to the above experimental steps, and all the strains with normal growth were screened out to obtain homozygous T3 transgenic rapeseed.

[0055] Example 5: Analysis of oil content in BnDHAR transgenic rapeseed

[0056] Three homozygous transgenic rapeseed lines were selected and the seed oil content was measured using a nuclear magnetic resonance instrument. The results showed that after increasing the expression of the BnDHAR3 gene through genetic engineering technology, the oil content of rapeseed seeds increased significantly, and the oil yield of rapeseed could be increased. Compared with the control plants, after overexpressing the BnDHAR3 gene, the oil content of the seeds of the three transgenic rapeseed lines increased by 6.81%, 11.08% and 9.03% respectively (Figure 2). Figure 4 shown).

Claims

1. Rapeseed BnDHA R3 A gene characterized by The coding sequence of the gene is shown in SEQ ID NO.

1.

2. The rapeseed according to claim 1 BnDHA R3 The application of genes in regulating plant oil production.

3. The use according to claim 2, characterized in that: The plants include rapeseed and Arabidopsis thaliana.

4. The rapeseed according to claim 1 BnDHA R3 Application of genes in breeding of high oil-yielding rapeseed.

5. A method for increasing the oil yield of rapeseed seeds, characterized in that: Overexpression in rapeseed BnDHA R3 The coding sequence of the gene is shown in SEQ ID NO.1.

Images