Application of rice OsSIT1 gene in regulation and control of resistance of rice to rice blast
By studying the OsSIT1 gene of rice and its encoded anti-factor OsSIT1 protein, it was found that the OsSIT1 gene was involved in the regulation of rice's immune response to rice blast disease. After knocking out the OsSIT1 gene, it reduced the defense ability of rice blast bacteria, solved the problem of difficulty in effectively preventing and treating rice blast in the existing technology, and provided a new application strategy for disease-resistant genes.
Patent Information
- Application Number
- CN202411832389.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-12
- Publication Date
- 2025-03-11
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing technology is difficult to effectively prevent and control rice blast, and pesticide prevention and control may lead to environmental pollution and personal health hazards.
By studying the OsSIT1 gene in rice and its encoded anti-pathogenic factor OsSIT1 protein, it was found that the OsSIT1 gene was involved in the regulation of rice's immune response to rice blast disease, and the defensive ability of rice to bacteria was reduced after knocking out the OsSIT1 gene.
After knocking out the OsSIT1 gene, the defense ability of rice to blast bacteria is reduced, indicating the important role of OsSIT1 gene in rice to resist rice blast, and provides a new strategy for application of disease-resistant genes to alleviate the impact of rice blast.
Smart Images
Figure HDA0005185847980000011 
Figure HDA0005185847980000012 
Figure HDA0005185847980000013
Abstract
Description
Technical field:
[0001] The invention belongs to the field of genetic engineering, and in particular, the invention relates to the application of rice OsSIT1 gene in regulating rice resistance to rice blast. Background technology:
[0002] Rice (Oryza sativa L.) is a cereal grain in the family Poaceae and one of the most important food crops in the world, with great economic value. However, the prevalence or emergence of deadly rice pathogens in rice-producing areas can lead to a decrease in the yield and quality of rice production. The invasion of pests and diseases can cause the average output value to drop from 10 tons / hectare to 5 tons / hectare. Among them, the most representative pathogens that infect rice are rice blast (Magnaporthe oryzae), which causes rice blast, a global disease.
[0003] Rice blast can cause devastating damage to rice throughout its life cycle, mainly manifested as leaf blast, node blast, and panicle blast, resulting in a serious reduction in rice yield. The rapid spread of rice blast in the field, coupled with the strong vitality and variability of spores, makes the prevention and control of rice blast imminent. At present, the impact of rice blast is mainly reduced by the application of pesticides, but pesticide control may cause environmental pollution, soil compaction, and pesticide residues will endanger human health; with the development of molecular biology and biological breeding technology, exploring new potential disease-resistant genes and cultivating high-yield disease-resistant rice lines are currently the most economical, effective and safe implementation strategies. In-depth exploration of plant disease resistance networks, analysis and identification of rice blast resistance genes have become particularly important for controlling rice blast and increasing rice crop yields in the future.
[0004] The present invention reveals the regulatory mechanism of rice OsSIT1 gene involved in resistance to rice blast at the molecular level, finds new resistance genes related to rice blast, attempts to effectively apply them to the prevention and control of rice blast, and cultivates rice materials for the prevention and control of rice blast. Summary of the invention:
[0005] The present invention found that the rice OsSIT1 gene is related to the immune response of rice to rice blast. After knocking out the OsSIT1 gene, the defense ability of rice to rice blast fungus is reduced.
[0006] The technical solution of the present invention is as follows:
[0007] The invention provides application of rice OsSIT1 gene in regulating (increasing or reducing) resistance of rice to rice blast fungus.
[0008] Preferably, the cDNA nucleotide sequence of the rice OsSIT1 gene is shown as SEQ ID No.2.
[0009] The present invention also provides application of rice disease resistance factor OsSIT1 protein in regulating (increasing or reducing) rice resistance to rice blast fungus.
[0010] Preferably, the amino acid sequence of the rice disease resistance factor OsSIT1 protein is shown as SEQ ID No.3.
[0011] The present invention also provides a method for studying the resistance of rice to rice blast fungus. When the resistance of rice to rice blast fungus needs to be reduced, the OsSIT1 gene in the rice is silenced or knocked out.
[0012] Preferably, the amino acid sequence of the rice disease resistance factor OsSIT1 protein is shown as SEQ ID No.3.
[0013] The present invention has found that the rice gene OsSIT1 plays an important role in rice resistance to rice blast. The deletion of the rice OsSIT1 gene reduces the basic defense function of rice against rice blast. Therefore, the rice OsSIT1 gene is of great significance for breeding rice strains resistant to rice blast. Description of the drawings:
[0014] Figure 1 Figure 2. Identification and comparison results of rice OsSIT1 homozygous and knock-out mutants.
[0015] Figure 2 The results of the identification of rice OsSIT1 homozygous and knockout mutants for rice blast resistance are shown in Figure 1. Figure 2 A: Spraying bacteria inoculation diagram: Figure 2 B: Statistical graph of hyphae length on diseased leaves;
[0016] Figure 3 Figure 1. Identification results of rice OsSIT1 homozygous and knockout mutants for resistance to rice blast disease. Figure 3 A: Punch inoculation diagram; Figure 3 B: Statistical graph of mycelium area on diseased leaves. Specific implementation method:
[0017] The methods in the following embodiments are conventional methods unless otherwise specified.
[0018] pYLsgRNA-OsU6c vector: recorded in the literature "Zhao Z#,Xie 15(4):620–629.”
[0019] pYLCRISPR / Cas9-MH-GW vector: recorded in the literature “Zhao Z#, Xie X#, Liu W#, Huang J, TanJ, Yu H, Zong W, Tang J, Zhao Y, Xue Y, Chu Z, Chen L*, Liu YG*(2022). STIPCR: an efficient method for amplification and de novo synthesis of long DNA sequences. Molecular Plant 15(4): 620–629.”
[0020] The rice blast fungus is the physiological race RB22 of the rice blast fungus, which is recorded in the literature "Zhang Chongyang. Study on the interaction mechanism between rice and rice blast fungus mediated by rice Bowman-Birk type trypsin inhibitor [D]. Chinese Academy of Agricultural Sciences, 2020."
[0021] Rice Zhonghua 11, recorded in the literature "Feng Yanzhao, Zhu Qingfeng, Xue Hao, et al. Creation of rice Zhonghua 11 dwarf1 mutant using CRISPR / Cas9 technology[J]. Guangdong Agricultural Sciences, 2022, 49(11): 110-118."
[0022] The above biological materials are available to the public from China Agricultural University.
[0023] Example 1. Obtaining Rice OsSIT1 Protein and Its Coding Gene
[0024] The present invention found that the rice OsSIT1 gene is related to the immune response of rice to rice blast. After knocking out the OsSIT1 gene, the defense ability of rice to rice blast fungus is reduced.
[0025] The method for obtaining the rice OsSIT1 gene is as follows:
[0026] The wild-type Zhonghua 11 rice DNA nucleotide sequence was used as a template and the following primers were used to amplify the rice OsSIT1 gene by PCR. The PCR reaction procedure was: 94°C for 2 min, then 98°C for 10 s, 55-60°C for 30 s, 68°C for 1 min / Kd, for 35 cycles, and finally 68°C for 10 min and 16°C for 10 min.
[0027] PCR Primers:
[0028] F:AAGTTTGGCGCAAACGCC;
[0029] R:TCAGAGTAATCTACGATA.
[0030] The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing reaction with primer F, and the sequencing result was compared with the DNA sequence of ZH11 rice OsSIT1 gene.
[0031] The sequencing results are shown in sequence 1 of the sequence table. The nucleotides 1-18 from the 5' end of sequence 1 are the first exon, the nucleotides 19-2043 are introns, and the nucleotides 2043-2128 are the second exon. The cDNA amplification fragment shown in sequence 2 of the sequence table is transcribed to encode the protein shown in sequence 3 of the sequence table.
[0032] The protein shown in Sequence 3 of the sequence listing is named OsSIT1 protein. The gene encoding OsSIT1 protein is named OsSIT1 gene, and its open reading frame is shown in Sequence 2 of the sequence listing.
[0033] Example 2: Functional verification of rice OsSIT1 protein
[0034] 1. Obtaining rice OsSIT1 gene knockout mutant.
[0035] The target position sequence of the target gene was knocked out by Crispr / Cas9 technology to obtain the knockout mutant of the OsSIT1 gene.
[0036] 1. Construction of knockout vector:
[0037] (1) First, based on the sequence of OsSIT1, the target site was determined and the adapter primers OsSIT1cas9-F / OsSIT1cas9-R were designed. The primer sequences are as follows:
[0038] OsSIT1cas9-F:
[0039] TTGTGCAGATGATCCGTGGCATCCCCTGCGTTTCTTTCACGGTTTT AGAGCTAGAAATAG
[0040] OsSIT1cas9-R:
[0041] ACTTGCTATTTCTAGCTCTAAAACCGTGAAAGAAACGCAGGGGAT GAGCCTCAGCGCAG
[0042] The nucleotide sequence was sent to Qingke Biotechnology Co., Ltd. for synthesis.
[0043] (2) gRNA expression cassette amplification: pYLsgRNA-OsU6c plasmid was used as the amplification template, and the resulting products were ligated for amplification. PCR reaction system: pYLsgRNA-OsU6c 1 μL, 2×KOD Buffer 10 μL, dNTPs 0.5 μL, MgSO4 0.5 μL, OsSIT1cas9-F (10 μM) 0.5 μL, OsSIT1cas9-R (10 μM) 0.5 μL, KOD-Plus-Neo 0.5 μL, ddH2O to 20 μL. PCR amplification reaction conditions: first 94°C for 2 min; then 98°C for 10 s, 55-60°C for 30 s, 68°C for 1 min / Kd, for 35 cycles; finally 68°C for 10 min, 16°C for 10 min.
[0044] After amplification, 5 μL of amplified product T1T4 was taken for electrophoresis. The target band size was 580 bp.
[0045] (3) Homologous recombination reaction of sgRNA expression cassette: The pYLsgRNA-OsU6c plasmid was digested with BsaI restriction endonuclease and homologous recombination was performed with the PCR amplification product T1T4 of (2). The enzyme digestion reaction system was: pYLsgRNA-OsU6c 2μL (200ng), BsaI (20U / μL) 0.5μL, 10× Buffer 1μL, ddH2O to 10μL. Enzyme digestion reaction conditions: 37°C, 3h.
[0046] Homologous recombination reaction system: 5×CEⅡBuffer 2μL, ExnaseⅡ1μL, PCR amplification product 5μL (10ng), pYLsgRNA-OsU6c vector after enzyme digestion 2μL (40ng), ddH2O to 10μL. Recombination reaction conditions: 37℃, 30min.
[0047] The recombinant product was transformed into E. coli by heat shock method, and after a single clone was grown, the bacteria were picked for colony PCR detection. The bacterial DNA was subjected to PCR reaction using primers T1-F and gRNA-R, and the target band size was 580bp after electrophoresis. The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing reaction using primer T1-F. After the sequencing result was consistent with the constructed sequence, the strain was expanded and the plasmid was extracted to obtain the recombinant vector pYLsgRNA-OsU6c-T1T4.
[0048] Bacterial liquid PCR primers:
[0049] T1-F:TGGAATCGGCAGCAAAGGAAGGAATCT
[0050] gRNA-R:TGGCACCGAGTCGGTGCTTTTTTT
[0051] The PCR reaction procedure of the bacterial solution was as follows: first 95°C for 2 min; then 98°C for 10 s, 55-60°C for 30 s, and 72°C for 1 min / Kd, for 34 cycles; finally, 72°C for 10 min and 16°C for 10 min.
[0052] (4) Construction of pYLCRISPR / Cas9-MH-GW expression cassette: LR reaction was used for construction. LR reaction system: pYLCRISPR / Cas9-MH-GW 40-50ng, pYLsgRNA-OsU6c-T1T4 40-50ng, LR mix 0.5μL, ddH2O supplemented to 2.5μL. LR reaction conditions: 25℃, 1h.
[0053] The recombinant product was transformed into E. coli by heat shock method, and the colony PCR test was performed after a single clone was grown. The PCR reaction of bacterial DNA was performed using primers T1-F and gRNA-R, and the target band size was 580bp after electrophoresis.
[0054] The PCR reaction procedure of the bacterial solution was as follows: first 95°C for 2 min; then, 98°C for 10 s, 55-60°C for 30 s, and 72°C for 1 min / Kd, for 34 cycles; finally, 72°C for 10 min, and 16°C for 10 min.
[0055] The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing reaction with primer T1-F. After the sequencing result was consistent with the constructed sequence, the strain was expanded and the plasmid was extracted to obtain the plasmid for callus transformation.
[0056] The callus transformation plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd. for callus transformation, and rice OsSIT1 mutant material was prepared with ZH11 rice line as the background. The transformation was identified.
[0057] (5) Identification of rice OsSIT1 mutant materials: Leaves of the rice materials to be identified were cut and total DNA was extracted using the CTAB method. Primers SIT1-F and SIT1-R were used for PCR reaction. The PCR reaction procedure was as follows: 95°C for 2 min, then 98°C for 10 s, 55-60°C for 30 s, 72°C for 1 min / Kd, for 34 cycles; 72°C for 10 min, and 16°C for 10 min.
[0058] PCR identification primers:
[0059] SIT1-F: TTCGCCGGCGTGAACCTCA;
[0060] SIT1-R: AAGTGGTTGCTGGCGTTGC.
[0061] The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing reaction with primer SIT1-F. The sequencing results were compared with the DNA sequence of ZH11 rice OsSIT1 gene. There were two different nucleotide base deletions at the gRNA target site. The comparison results of rice OsSIT1 gene mutants ( Figure 1 ) showed that the rice homozygous mutant ossit1-1 had a single base C deletion at position 290 of the DNA sequence (position 229 of the CDS sequence of the OsSIT1 gene). The rice homozygous mutant ossit1-2 had a multi-base CGTT deletion at positions 290 to 294 of the DNA sequence (positions 229-232 of the CDS sequence of the OsSIT1 gene).
[0062] The results showed that rice OsSIT1 gene knockout mutants Ossit1-1 and Ossit1-2 were obtained.
[0063] 2. The effect of OsSIT1 gene on rice resistance to rice blast fungus.
[0064] To verify that the gene OsSIT1 is involved in the defense response of rice to rice blast, we detected the changes in resistance of OsSIT1 knockout mutants to rice blast. The specific operation is as follows:
[0065] The wild rice blast fungus strain RB22 was activated on oat solid medium, cultured in the dark at 26°C for 7 days, the upper mycelium was scraped off with a sterile glass slide, and cultured in the light at 26°C for 4 days. Sterile ddH2O was added to the culture medium, and spores were scraped with a coating stick. The suspension was filtered into a 50mL centrifuge tube with a filter cloth, and sterilized ddH2O was added to adjust the spore concentration to no less than 1×106 / mL. 1 / 10 volume of tween 20 was added to the spore solution for rice blast fungus inoculation.
[0066] Spray inoculation: Select 2-3 weeks old (3-4 leaves) well-grown rice materials (wild type and mutants Ossit1-1 and Ossit1-2) to be tested, place them in a well-sealed inoculation frame, and water them in advance until the soil is submerged. Then spray 2 ml of spore suspension evenly on the rice material to ensure that there are small water droplets of bacterial liquid on each leaf, and seal the inoculation frame with plastic wrap. After 24 hours of dark treatment at 24°C, restore the normal light cycle, and cultivate in a high humidity environment for 4-7 days to adjust the disease situation. The experiment was repeated three times.
[0067] Punch hole inoculation: Select rice experimental materials (wild type Zhonghua 11 and mutants Ossit-1 and Ossit1-2) that are in good growth condition and free of stress for 4-5 weeks, place them in a well-sealed inoculation frame, and water them in advance until the soil is submerged. Select rice leaves of the same leaf age, with the widest part close to the main vein, and use a sampler to press with uniform force to form a wound to avoid punching through. Pipette 10 μL of a concentration of 1×10 5 The spore suspension of 100 / mL was dripped onto the wound, and the bacterial liquid was sealed with transparent tape to prevent leakage, and the inoculation frame was sealed with plastic wrap. After 24 hours of dark treatment at 24°C, the normal light cycle was restored and cultured in a high humidity environment for 5-7 days to adjust the disease situation. The experiment was repeated three times.
[0068] Lesion area and length: Rice lesions of the same area were cut and scanned using an EPSON scanner, and Image J was used to quantitatively analyze the lesion area and length.
[0069] Vaccination results ( Figure 2-3 ) showed that compared with the wild-type Zhonghua11, the knockout mutant Ossit1-1 ( Figure 2-3 Middle sit1-1), Ossit1-2( Figure 2-3 The extension area of the lesion in sit1-2 (~150mm 2 ) and length (~6.5 cm) are significantly larger than the wild type's expansion area (~50 mm 2 ) and length (~2.5cm), showing a more susceptible phenotype to rice blast fungus and a significantly weakened resistance to rice blast, indicating that OsSIT1 is essential for rice resistance to rice blast.
Claims
1. Application of rice OsSIT1 gene in regulating rice resistance to rice blast fungus, the nucleotide sequence of the rice OsSIT1 gene is shown in SEQ ID No.
1.
2. Application of rice OsSIT1 gene in regulating rice resistance to rice blast fungus, wherein the rice cDNA sequence is shown in SEQ ID No.
2.
3. Application of rice disease resistance factor OsSIT1 protein in regulating rice resistance to rice blast fungus, wherein the amino acid sequence of the rice disease resistance factor OsSIT1 protein is shown in SEQ ID No.
3.
4. The use according to claim 3, characterized in that: The plant is a rice plant; and the disease resistance is resistance to rice blast.
5. A method for reducing resistance of rice to rice blast fungus, characterized in that: Inhibit or terminate the expression of the protein encoded by the rice OsSIT1 protein as claimed in claim 1, wherein the cDNA nucleotide sequence of the OsSIT1 gene is shown as SEQ ID No.
2.
6. The method according to claim 6, characterized in that: The plant is a rice plant; and the disease resistance is resistance to rice blast.