Preparation method of transgenic zebrafish model for specific expression in mitochondria of neutrophil and real-time monitoring of oxidation-reduction state

Abstract

The invention discloses a preparation method of a transgenic zebrafish model capable of specifically expressing on mitochondria of neutrophil and monitoring an oxidation-reduction state in real time. The preparation method comprises the following steps: S1, preparing a skeleton plasmid mini Tol2; amplifying the genome of the zebra fish to obtain a mitochondrial positioning sequence MLS fragment; amplifying to obtain a green fluorescent protein 2 fragment roGFP2 which is sensitive to redox; s2, connecting a skeleton plasmid mini Tol2 with two fragments of MLS and roGFP2 into a plasmid by virtue of a seamless cloning technology, so as to obtain a recombinant expression vector; s3, performing embryo microinjection, and screening transgenic zebrafish to obtain an F0 generation; and S4, obtaining the transgenic zebrafish model. The obtained transgenic zebrafish strain can be used for functional research of zebrafish neutrophil mitochondria, and the expression of an organism on oxidative stress at any time can be observed and reflected at any time by utilizing the expression of the green fluorescent protein in the induction oxidation-reduction state in living fish.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for preparing a transgenic zebrafish model capable of specifically expressing mitochondria in neutrophils and monitoring the redox state in real time. Background Art

[0002] Zebrafish belongs to the genus Brachydanio, Cyprinidae, Cypriniformes. It is easy to raise, has a short reproductive cycle, lays a large number of eggs, and has embryos that are fertilized in vitro, develop in vitro, are transparent, and develop rapidly. Zebrafish has 87% genetic homology with humans, and its hematopoietic system is highly conserved. Its signaling pathways are basically similar to those of humans. It has a clear genetic background, mature gene editing methods, and strong operability. Through the implementation of modeling technologies such as gene editing, physical and chemical mutagenesis, transgenics, and tumor cell implantation, various human disease and tumor models can be constructed, a research platform for drug screening and treatment can be established, and large-scale gene mutation models can be established and screened. In addition, zebrafish embryos are transparent and small, and optical instruments can be used to dynamically observe the development of cells and organs in the body, as well as to visualize the physiological and pathological processes in the body. In summary, the unique biological and genetic characteristics of zebrafish provide an important tool for biomedical research.

[0003] Myeloperoxidase (MPO) is a specific marker of myeloid cells, mainly secreted by neutrophils. The mpx gene encoding MPO is the zebrafish ortholog of the mammalian MPO gene. The length of the zebrafish mpx gene promoter is 8347bp, and mpx mRNA expression can be detected in the intermediate cell mass as early as 18h after fertilization; three days after fertilization, MPO expression can be seen in neutrophils in the circulatory system of zebrafish larvae. Mathias, JR et al. constructed transgenic zebrafish expressing GFP in neutrophils and verified the expression of this gene.

[0004] The mitochondrial localization sequence (MLS) is a special type of signal sequence. Most mitochondrial proteins are synthesized on cytoplasmic ribosomes. They interact with the TOM (translocase of the outer mitochondrial membrane) complex on the outer mitochondrial membrane to help proteins pass through the outer membrane, and then further transported to the inner membrane or matrix through the TIM (translocase of the inner mitochondrial membrane) complex. The protein encoded by the COX8A gene is one of the subunits of cytochrome c oxidase and a component of the respiratory chain complex IV of the inner mitochondrial membrane. The functions of COX8A in mitochondria include activating cytochrome c oxidase activity, participating in mitochondrial electron transfer, transferring electrons from cytochrome c to oxygen, and promoting proton transmembrane transport. Muster, B. Constructed a plasmid of Cox8a-GFP and transfected Hela cells in vitro, and fluorescently imaged the general structure of mitochondria. However, at present, there is still a lack of methods for tracing and imaging mitochondria in animal models in vivo.

[0005] Excessive generation of reactive oxygen species (ROS) in the body leads to a series of reactions mediated by an imbalance between oxidation and antioxidant effects in the body. Mitochondria are both the main site of intracellular ROS production and the main target organ for ROS attack and damage. Excessive ROS can destroy the intracellular oxidation / reduction system, cause oxidative damage to biological molecules including DNA, interfere with DNA and RNA replication, oxidize mitochondrial proteins to lose their normal catalytic degradation function, cause membrane lipid peroxidation, and cause mitochondrial swelling and rupture, release cytochrome C, and lead to mitochondrial dysfunction and cell apoptosis.

[0006] roGFP2 (redox-sensitive Green Fluorescent Protein 2) is a fluorescent protein used in biomedical research. It is an improved version of the original roGFP. Compared with the original roGFP, roGFP2 has higher sensitivity and less phototoxicity, making it more suitable for long-term and high-resolution live cell imaging. In addition, roGFP2 is a redox-sensitive probe based on green fluorescent protein (GFP). It can detect the redox state in cells by changes in its fluorescence properties. It is particularly sensitive to the presence of ROS, especially hydrogen peroxide (H2O2). The key mutation sites of roGFP2 are the serine point mutation at position 147 to cysteine ​​and the glutamine point mutation at position 204 to cysteine ​​in the amino acid sequence of the EGFP protein. Due to the barrel structure of the chromophore and the secondary structure of the β-fold, these two amino acids form a disulfide bond. In the oxidized state, the density distribution of the electron cloud shows that the disulfide bond is complete and orderly formed, while in the reduced state, the two cysteines are far away from each other. RoGFP2 has two different excitation peaks at 405nm and 488nm. Cysteine ​​oxidation leads to an increase in the 405nm excitation peak. Cysteine ​​oxidation also increases excitation at 488nm. RoGFP2 then has a single emission peak at 510nm. Thus, the ratio of the 510nm emission peak to the excitation peak at 488nm or 405nm can reflect the redox state of the cell. Thus, the redox state of roGFP2 can be monitored by measuring the ratio of its fluorescence intensity at two different excitation wavelengths. Summary of the invention

[0007] The purpose of the present invention is to address the above problems and provide a method for preparing a transgenic zebrafish model with mitochondrial-specific expression in neutrophils and real-time monitoring of the redox state.

[0008] The first aspect of the present invention provides a method for preparing a transgenic zebrafish model that specifically expresses a gene on the mitochondria of neutrophils and monitors the redox state in real time, comprising the following steps:

[0009] S1. Preparation of backbone plasmid and insert fragment

[0010] Preparation of a backbone plasmid containing the specific promoter mpx: Take the plasmid (Tg(mpx:mCherry-2A-Rac2D57N), double-digest it with restriction endonucleases BamHI and SalⅠ to obtain the backbone plasmid mini Tol2;

[0011] The mitochondrial localization sequence MLS fragment was amplified from the zebrafish genome;

[0012] Amplify and obtain the redox-sensitive green fluorescent protein 2 fragment roGFP2;

[0013] S2. Preparation of recombinant expression vector

[0014] Through seamless cloning technology, the backbone plasmid mini Tol2 containing the specific promoter mpx was connected to two fragments of MLS and roGFP2 into one plasmid, and MLS was flexibly connected to the roGFP2 fragment through the SGG linker; the recombinant expression vector Tol2-mpx-MLS-roGFP2 was obtained;

[0015] S3. Embryo microinjection and screening of transgenic zebrafish

[0016] The zebrafish fertilized eggs were collected, microinjected with TOL2 transposase mRNA and recombinant expression vector Tol2-mpx-MLS-roGFP2, and incubated; embryos with green fluorescent signals were screened and raised according to conventional methods to obtain F0 generation;

[0017] S4. Obtain a transgenic zebrafish model: hybridize the F0 generation zebrafish with the wild-type zebrafish, screen out transgenic zebrafish with fluorescence and specifically express green fluorescence in the mitochondria of neutrophils, and record them as the F1 generation; self-pollinate the F1 generation zebrafish to obtain the F2 generation, and screen out homozygous and heterozygous transgenic zebrafish that specifically express green fluorescence in the mitochondria of neutrophils; test-cross the F2 generation zebrafish with the wild-type zebrafish, and screen out transgenic zebrafish in which 100% of the offspring specifically express green fluorescent protein in the mitochondria of neutrophils, and preserve them as a pure strain, thus obtaining a transgenic zebrafish model with specific expression on the mitochondria of neutrophils to monitor the redox state in real time.

[0018] The MLS fragment is amplified using primers MLS-F / MLS-R.

[0019] Forward primer MLS-F:

[0020] 5'-AATGTCTCAATATGTGTTTTTAGG-3';

[0021] Reverse Primer:

[0022] 5′-GCTGAACTTGTGGCCGTTTA-3′.

[0023] The amplification primers for the fragment roGFP2 are:

[0024] Forward primer roGFP2-F: 5′-TAAACGGCCACAAGTTCAGC-3′;

[0025] Reverse primer roGFP2-R: 5′-TCGACTTACTTGTACAGCTCGTCCATG-3′;

[0026] The amplification template was plasmid pCAG roGFP2-mito.

[0027] Preferably, in step S4, after the F0 generation develops to sexual maturity, it is hybridized with wild-type zebrafish; 3dpf embryos are obtained, and embryos expressing specific green fluorescence in mitochondria of neutrophils are screened by stereo fluorescence microscopy; and the F1 generation is obtained by conventional breeding.

[0028] Preferably, in step S4, the F1 generation is self-pollinated after developing to sexual maturity to obtain 3dpf embryos, and embryos expressing specific green fluorescence on mitochondria of neutrophils are observed and screened; the embryos are raised for 3-4 months to sexual maturity according to conventional methods, and test-crossed with wild-type zebrafish to screen out offspring with 100% embryos having fluorescent signals, which are homozygous F2 generation embryos and preserved as pure strains, thereby obtaining a transgenic zebrafish model with specific expression on mitochondria of neutrophils to monitor the redox state in real time.

[0029] The second aspect of the present invention provides a recombinant expression vector for cultivating the above-mentioned transgenic zebrafish model, which is obtained by using the mini Tol2 plasmid containing the mpx promoter as the backbone plasmid, inserting the mitochondrial localization sequence MLS fragment and the redox-sensitive green fluorescent protein 2 fragment roGFP2 into the backbone plasmid, and connecting the MLS and roGFP2 fragments through SGGlinker.

[0030] The sequence of the MLS fragment is shown in SEQ ID NO.3.

[0031] The sequence of the roGFP2 fragment is shown as SEQ ID NO.6.

[0032] The recombinant expression vector, the backbone plasmid mini Tol2 is a linearized vector obtained by double digesting the plasmid Tg (mpx: mCherry-2A-Rac2D57N with restriction endonucleases BamHI and SalⅠ.

[0033] The third aspect of the present invention provides a method for preparing the above-mentioned recombinant expression vector, which is obtained by connecting the backbone plasmid, the MLS fragment and the fragment roGFP2 through seamless cloning.

[0034] The beneficial effects of the present invention are:

[0035] (1) The method of the present invention is simple and easy to implement, and can obtain a transgenic zebrafish strain in which mitochondria of neutrophils express specific green fluorescence;

[0036] (2) The transgenic zebrafish strain obtained can be used for the functional study of zebrafish neutrophil mitochondria. The expression of green fluorescent protein that senses the redox state in living fish can be used to observe the body's response to oxidative stress at any time and at any period. The transgenic zebrafish strain obtained by the method of the present invention can be used to study various inflammatory diseases and the effects of external stimuli (such as radiation) on the redox state of mitochondria and their effects on mitochondrial function and pathological mechanisms.

[0037] (3) Given the unique advantages of zebrafish embryos in high-throughput drug screening, this transgenic strain can be used for large-scale screening of drugs in the fields of antioxidant, anti-inflammatory, and anti-radiation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the plasmid map of Tol2-mpx-MLS-roGFP2.

[0039] Figure 2 This is the PCR agarose electrophoresis identification diagram of the Tol2-mpx-MLS-roGFP2 transgenic fish line: lanes 1, 4, and 6 are transgenic fry with an 852bp MLS-SGG LINKER-roGFP2 positive band, and the DNA markers in lane 10 are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp from bottom to top.

[0040] Figure 3 This is the comparison of the sequencing results of the MLS genomic DNA fragments of the Tol2-mpx-MLS-roGFP2 transgenic 3dpf fry.

[0041] Figure 4 This is the alignment of sequencing results of partial roGFP2 genomic DNA fragments of Tol2-mpx-MLS-roGFP2 transgenic 3dpf larvae.

[0042] Figure 5 The Tol2-mpx-MLS-roGFP2 transgenic fish line is shown under an inverted fluorescence microscope with a 50× objective.

[0043] Figure 6 The Tol2-mpx-MLS-roGFP2 transgenic fish line is shown under an inverted fluorescence microscope with a 100× objective.

[0044] Figure 7 The Tol2-mpx-MLS-roGFP2 transgenic fish line is shown under an inverted fluorescence microscope with a 200× objective.

[0045] Figure 8The Tol2-mpx-MLS-roGFP2 transgenic fish line is shown under an inverted fluorescence microscope with a 400× objective. DETAILED DESCRIPTION

[0046] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0048] Example 1 Construction of a recombinant expression vector based on the neutrophil myeloperoxidase promoter mpx to express the mitochondrial redox-sensitive green fluorescent protein roGFP2

[0049] 1. Preparation of zebrafish embryo cDNA and amplification of MLS

[0050] 1. Preparation of zebrafish embryo cDNA:

[0051] RNA was extracted from wild-type zebrafish embryos and cDNA was synthesized using a reverse transcription kit (MCE, catalog number HY-K0510A).

[0052] 2. PCR amplification of mitochondrial localization sequence (MLS) fragment

[0053] The previously synthesized cDNA was subsequently subjected to PCR reaction of MLS-F / MLS-R using primers containing seamless cloning sidearm sequences, using NEB Q5 high-fidelity enzyme, and the reaction system was as follows: cDNA 2μL, 5X Q5 Reaction Buffer 10μl, 10mM dNTPs 1μl, 10μM forward primer (MLS-F) 2.5μL, 10μM reverse primer (MLS-R) 2.5μl, Q5 Hot Start High-Fidelity DNA Polymerase 0.5μl, 5X Q5 High GC Enhancer 10μl, Nuclease-Free Water 21.5μL. The reaction conditions were as follows: 98℃ pre-denaturation for 30s, 98℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s for a total of 35 cycles, 72℃ final extension for 2min, and storage at 4℃.

[0054] Forward primer MLS-F (SEQ ID NO.1):

[0055] 5'-AATGTCTCAATATGTGTTTTTAGG-3';

[0056] Reverse primer MLS-R (SEQ ID NO.2):

[0057] 5′-GCTGAACTTGTGGCCGTTTA-3′.

[0058] The PCR product was separated and identified by 1% agarose gel electrophoresis to obtain a band of about 93 bp (i.e., the MLS fragment), which was then recovered and purified using a gel recovery kit; the purified product was stored at -20°C.

[0059] The sequence of the amplified MLS fragment is as follows (SEQ ID NO.3):

[0060] ATGTCTGGACTTCTGAGGGGACTAGCTCGCGTCCGCGCCGCTCCGGTTCTGCGG GGATCCACGATCACCCAGCGAGCCAACCTCGTTACGCGA.

[0061] 2. Amplify the roGFP2 fragment from the commercial plasmid containing the roGFP2 fluorescent protein

[0062] The plasmid (pCAG roGFP2-mito) with catalog number Plasmid#168509 was obtained from Addgene as a PCR template. Primers were designed using snapgene software based on the plasmid map, and side arm overlapping sequences of seamless cloning were added to the primers for PCR reaction. NEB Q5 high-fidelity enzyme was used, and the reaction system was as follows: pCAG roGFP2-mito (1ug / μl) 0.5μL, 5X Q5 Reaction Buffer 10μl, 10mM dNTPs 1μl, 10μM forward primer roGFP2-F 2.5μL, 10μM reverse primer roGFP2-R 2.5μl, Q5 Hot Start High-Fidelity DNA Polymerase 0.5μl, 5X Q5High GC Enhancer 10μl, Nuclease-Free Water 23μL. The reaction conditions were as follows: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s for a total of 35 cycles, final extension at 72°C for 2 min, and storage at 4°C.

[0063] Forward primer roGFP2-F (SEQ ID NO. 4): 5′-TAAACGGCCACAAGTTCAGC-3′;

[0064] Reverse primer roGFP2-R (SEQ ID NO. 5): 5′-TCGACTTACTTGTACAGCTCGTCCATG-3′.

[0065] The PCR product was separated and identified by 1% agarose gel electrophoresis, and a band of about 741 bp (i.e., the roGFP2 fragment) was obtained, which was then recovered and purified using a gel recovery kit; the purified product was stored at -20°C;

[0066] Please provide the sequence of the amplified roGFP2 fragment (SEQ ID NO.6):

[0067] The roGFP2 fragment is as follows:

[0068] .

[0069] 3. Preparation of the backbone plasmid containing the specific mpx promoter - plasmid mini Tol2

[0070] The plasmid with the catalog number Plasmid#58934, named Tg(mpx:mCherry-2A-Rac2D57N), was obtained from Addgene (USA). According to its plasmid map, the restriction site was found on snapgene to facilitate the subsequent insertion of the fusion fragment.

[0071] The Tg(mpx:mCherry-2A-Rac2D57N) plasmid was double-digested with restriction endonucleases BamH I (Takara, catalog number No.1010S) and Sal I (Takara, catalog number No.1080S). The reaction system was as follows: BamH I 1 μL, Sal I 1 μL, 10T buffer 7.5 μL, plasmid (Tg(mpx:mCherry-2A-Rac2D57N) 200 ng / μL) 5 μL, Nuclease-Free Water 35.5 μL; the reaction conditions were as follows: incubated in an incubator at 37°C for 4 hours.

[0072] The fragment was separated and identified by 1% agarose gel electrophoresis, and a band of about 11788 bp was obtained. The fragment was then recovered and purified using a gel tapping recovery kit to obtain a backbone plasmid containing a specific mpx promoter, named mini Tol2. The purified product was stored at -20°C.

[0073] 4. Construction of a recombinant expression vector based on the neutrophil myeloperoxidase mpx promoter expressing the mitochondrial redox-sensitive green fluorescent protein roGFP2

[0074] Follow these steps:

[0075] 1. Use the seamless cloning kit (Cat. No. D7010S) of Biotime (China) to prepare the following reaction system in a 1.5 ml EP tube: 0.5 μL of the MLS purified fragment (14.5 ng / μL) as shown in SEQ ID NO.3, 2 μL of the roGFP2 purified fragment (9.5 ng / μL) as shown in SEQ ID NO.6, 7.5 μL of the backbone plasmid mini Tol2 (460.2 ng / μL), 10 μL of 2XSeamless Cloning Mix, and the reaction conditions are as follows: incubate in a 50°C metal bath for 15 min.

[0076] 2. Take 5 μL of the product from the above step, add it to 50 μL of DH5α competent cells, mix gently, and place the mixture on ice for 30 min;

[0077] 3. Heat shock in a 42℃ metal bath for 90s, then quickly and steadily return to ice and let stand for 3min;

[0078] 4. Add 500 μL of LB solution without antibiotics, place in a 37°C shaker, and culture for 1 hour;

[0079] 5. Centrifuge the shaken bacterial solution at 5000rpm for 1 min to precipitate the bacteria, discard most of the culture solution, and resuspend the bacteria in the remaining 100μL LB culture solution.

[0080] 6. Pour glass beads onto the resuspended bacterial solution on the LB solid plate containing ampicillin, spread it evenly, and culture it in a 37°C incubator overnight.

[0081] 7. In the clean bench, pick out the colony of the monoclonary, dissolve it in 10μL sterile water and mix it, and perform PCR identification. The reaction system is as follows: PowerPol 2X PCR Mix with Dye 12.5μL, primer MLS-F 1μL, primer roGFP2-R1μL, bacterial solution 1μL, ddH2O 9μL. The reaction conditions are as follows: 98℃ pre-denaturation for 45, 98℃ denaturation for 10s, 58℃ annealing for 30s, 72℃ extension for 30s for a total of 35 cycles, 72℃ final extension for 5min, and storage at 4℃.

[0082] 8. The PCR products were separated and identified using 1% agarose gel, and the positive control band of about 868 bp was identified as the positive clone. The positive clone was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing and comparison. The corresponding bacterial solution of the positive clone with completely correct sequencing comparison was stored at -80°C containing 50% glycerol. The positive clone was the recombinant expression vector, named Tol2-mpx-MLS-roGFP2.

[0083] 9. Use TIANGEN's endotoxin-free plasmid mini-preparation kit with the catalog number DP118 to extract the Tol2-mpx-MLS-roGFP2 plasmid, determine the concentration, and store it at -20°C;

[0084] The plasmid map of Tol2-mpx-MLS-roGFP2 is as follows Figure 1As shown: it contains Tol2 element, neutrophil-specific promoter mpx, mitochondrial localization sequence MLS, SGG flexible linker fragment, redox-sensitive green fluorescent protein roGFP2 sequence, and Tol2 transposase sequence. Among them, neutrophil-specific promoter mpx can drive the expression of neutrophil-specific genes; MLS mitochondrial localization sequence is the nitrogen-terminal sequence of COX8A, which is an important component of the cell respiratory chain and is located in the inner membrane of the cell mitochondria. It is a mitochondrial-localized protein; SGG flexible linker fragment, which connects two different proteins or protein domains, a polypeptide sequence used in fusion protein design to provide the necessary flexibility to maintain their respective functions and structures; roGFP2 fluorescent protein fragment is a redox-sensitive probe based on green fluorescent protein (GFP).

[0085] This plasmid is used to culture transgenic zebrafish expressing green fluorescence specifically in mitochondria of neutrophils.

[0086] Example 2: Cultivation of transgenic zebrafish expressing redox-sensitive green fluorescent protein in mitochondria of neutrophils

[0087] First, the prepared recombinant expression vector is mixed according to the ratio, and then microinjected at the single-cell stage of wild-type embryos. At 3dpf, fluorescence screening is performed relative to the F0 generation, and the positive F0 embryos are cultured according to the standard. Secondly, when the F0 is sexually mature, the F0 is test-crossed with the wild-type zebrafish, and the F1 offspring produced are subjected to fluorescence screening and PCR genotype identification at 3dpf. The positive fluorescence and positive PCR bands are selected for first-generation sequencing, and the remaining young fish are cultured according to the standard. Finally, when the F1 is sexually mature, it is self-pollinated, and the F2 produced can be screened for a series of experiments, such as confocal fluorescence imaging, reading fluorescence values ​​with an enzyme marker, etc. The specific operations are as follows:

[0088] 1. Microinjection of Tol2 system into zebrafish embryos

[0089] (1) Tol2 transposase mRNA was obtained by in vitro transcription. The specific steps are as follows: using plasmid Tol2-mpx-MLS-roGFP2 as a template, Sp6 RNA polymerase was added to transcribe Tol2 transposase mRNA in vitro, and the concentration was measured after purification and recovery, and then stored at -80°C. For specific experimental steps, please refer to the reference (Khattak, S., et al. (2014). "Optimized axolotl (Ambystomamexicanum) husbandry, breeding, metamorphosis, transgenesis and tamoxifen-mediated recombination." Nature Protocol 9(3):529540).

[0090] (2) Select several pairs of wild-type zebrafish with normal development, place them in a mating tank, replace with fresh water for stimulation, remove the baffles the next day to obtain single-cell embryos, wash the embryos several times with egg water and set aside;

[0091] (3) Tol2 transposase mRNA and Tol2-mpx-MLS-roGFP2 plasmid were mixed. The reaction system was as follows: 1.5 μL of Tol2-mpx-MLS-roGFP2 plasmid (50 ng / μL), 3 μL of Tol2 transposase mRNA (50 ng / μL); microinjection instrument reaction parameters: Pressure meter 5.00, Injection Times 0.1 s; 1 nL was injected into each fertilized egg.

[0092] (4) Within 1 hour after the zebrafish fertilized eggs are laid, select normal zebrafish one-cell embryos, place them on a special mold agarose gel injection plate and arrange them neatly. Use a Warner pneumatic microinjection pump PL-90A to inject 1 nL of mixed injection solution into each embryonic cell. After the injection is completed, rinse the embryos on the agar plate into a new culture dish with egg water. After the injection is completed, place the zebrafish in a 28°C constant temperature incubator for hatching, and check for dead embryos every 12 hours and replace with fresh egg water.

[0093] 2. Screening and functional identification of transgenic zebrafish

[0094] (1) After microinjection, 3 dpf zebrafish embryos were obtained and observed under a fluorescent inverted microscope, and embryos with green fluorescent signals were screened out. The DNA in the microinjected embryos was verified by subsequent sequencing of an 852 bp positive band (containing SGG Linker) by PCR electrophoresis, and the embryos were raised according to conventional methods for future use, and were positioned as the F0 generation.

[0095] For details of the electrophoresis pattern, see Figure 2 : Lanes 1, 4, and 6 are transgenic fry in which a 852 bp MLS-SGG LINKER-roGFP2 positive band was detected. The sequence of SGG LINKER (SEQ ID NO.7) is:

[0096] AGTGGCGGCTCCGGCGGT.

[0097] See the sequencing base sequence for details. Figure 3 , Figure 4 The sequencing results of the MLS genomic DNA fragments of the Tol2-mpx-MLS-roGFP2 transgenic 3dpf fish showed that the base alignment of the mitochondrial localization sequence and the SGG flexible junction fragment was consistent with the designed plasmid ( Figure 3 ). The sequencing results of some roGFP2 genomic DNA fragments of Tol2-mpx-MLS-roGFP2 transgenic 3dpf larvae were compared and showed that the sequencing results were consistent with the base alignment of the designed plasmid, especially the mutations of key node amino acids, such as the serine point mutation at position 147 to cysteine; the glutamine point mutation at position 204 to cysteine. Due to the barrel structure of the chromophore and the secondary structure of the β-fold, these two amino acids form a disulfide bond. In the oxidized state, the density distribution of the electron cloud shows that the disulfide bond is complete and orderly formed, while in the reduced state, the two cysteines are far away from each other.

[0098] (2) After the F0 generation develops for 3-4 months to sexual maturity, it is test-crossed with wild-type zebrafish to obtain zebrafish embryos. The 3dpf zebrafish embryos are taken and observed under a fluorescent inverted microscope. Embryos with green fluorescent signals are screened and raised according to conventional methods for future use, and are identified as the F1 generation;

[0099] (3) After the F1 generation develops for 3-4 months to sexual maturity, it is self-pollinated to obtain zebrafish embryos. The 3 dpf zebrafish embryos are taken and observed under a fluorescent inverted microscope, and embryos with green fluorescent signals are screened. They are raised according to conventional methods until they reach sexual maturity at 3-4 months, and are test-crossed with AB-WT wild-type zebrafish. The offspring with all embryos with fluorescent signals are identified as F2 homozygotes, and the offspring with some embryos with fluorescent signals are identified as F2 heterozygotes.

[0100] Details of organelle structure and cell localization of 3dpf transgenic fry under a fluorescence inverted microscope at different magnifications are shown in Figure 5-8 :

[0101] Figure 5 : Tol2-mpx-MLS-roGFP2 transgenic fish line under an inverted fluorescence microscope with a 50× objective lens. In the green fluorescence channel, small, specific green irregular cells can be seen.

[0102] Figure 6 : Tol2-mpx-MLS-roGFP2 transgenic fish line under an inverted fluorescence microscope with a 100× objective lens. It can be seen that COX8A fluorescently localized mitochondria surround the irregular lobed nuclei of neutrophils, presenting irregular vacuolar structures.

[0103] Figure 7 : Display of the Tol2-mpx-MLS-roGFP2 transgenic fish line under an inverted fluorescence microscope with a 200× objective lens. The first row in the figure is a fluorescence channel image, which shows the head, trunk, and tail at 3 dpf. The second row is a merged image of the white light and fluorescence channels, and the third row is a fluorescence channel image, showing the ring-shaped structure formed by mitochondria surrounding the neutrophil-specific lobed nucleus.

[0104] Figure 8 : Tol2-mpx-MLS-roGFP2 transgenic fish line displayed under an inverted fluorescence microscope at 400× objective. The ring-shaped structure formed by mitochondria surrounding the neutrophil-specific lobed nucleus is more obvious, and because mitochondria are constantly fused and divided in living cells, they have different morphologies, such as granular, rod-shaped, and reticular.

[0105] In summary, the present invention obtains a transgenic zebrafish strain expressing specific green fluorescence in mitochondria of neutrophils. The obtained zebrafish strain is used for functional research on mitochondria of zebrafish neutrophils. The expression of green fluorescent protein that senses the redox state in living fish can be used to observe at any time and at any period to reflect the body's performance of oxidative stress. The transgenic zebrafish strain obtained using this method can be used for research on the mechanism of mitochondrial pathological changes in neutrophils in the hematopoietic system of zebrafish. The transgenic zebrafish line obtained by the present invention can be mated with other transgenic zebrafish lines, such as the mpeg1-mcherry transgenic zebrafish line that marks macrophages, to obtain a double transgenic fish line for studying neutrophils and macrophages.

Claims

1. A method for preparing a transgenic zebrafish model that specifically expresses a gene on the mitochondria of neutrophils and monitors the redox state in real time, comprising the following steps: S1. Preparation of backbone plasmid and insert fragment Preparation of a backbone plasmid containing the specific promoter mpx: Take the plasmid (Tg(mpx:mCherry-2A-Rac2D57N), double-digest it with restriction endonucleases BamHI and SalⅠ to obtain the backbone plasmid mini Tol2; The mitochondrial localization sequence MLS fragment was amplified from the zebrafish genome; Amplify and obtain the redox-sensitive green fluorescent protein 2 fragment roGFP2; S2. Preparation of recombinant expression vector Through seamless cloning technology, the backbone plasmid mini Tol2 containing the specific promoter mpx was connected to two fragments of MLS and roGFP2 into one plasmid, and MLS was flexibly connected to the roGFP2 fragment through the SGG linker; the recombinant expression vector Tol2-mpx-MLS-roGFP2 was obtained; S3. Embryo microinjection and screening of transgenic zebrafish The zebrafish fertilized eggs were collected, microinjected with TOL2 transposase mRNA and recombinant expression vector Tol2-mpx-MLS-roGFP2, and incubated; embryos with green fluorescent signals were screened and raised according to conventional methods to obtain F0 generation; S4. Obtaining a transgenic zebrafish model: Crossing the F0 generation zebrafish with the wild-type zebrafish, and screening out transgenic zebrafish with fluorescence and specifically expressing green fluorescence in mitochondria of neutrophils, which are recorded as the F1 generation; The F1 generation zebrafish were self-pollinated to obtain the F2 generation, and homozygous and heterozygous transgenic zebrafish that specifically expressed green fluorescent protein in mitochondria of neutrophils were screened; the F2 generation zebrafish were test-crossed with wild-type zebrafish, and transgenic zebrafish in which 100% of the offspring specifically expressed green fluorescent protein in mitochondria of neutrophils were screened and preserved as pure strains, thus obtaining a transgenic zebrafish model that specifically expressed green fluorescent protein on mitochondria of neutrophils and monitored the redox state in real time.

2. The preparation method according to claim 1, characterized in that: The MLS fragment is amplified using primers MLS-F / MLS-R. Forward primer MLS-F: 5'-AATGTCTCAATATGTGTTTTTAGG-3'; Reverse Primer: 5′-GCTGAACTTGTGGCCGTTTA-3′.

3. The preparation method according to claim 1, characterized in that: The amplification primers for the fragment roGFP2 are: Forward primer roGFP2-F: 5′-TAAACGGCCACAAGTTCAGC-3′; Reverse primer roGFP2-R: 5′-TCGACTTACTTGTACAGCTCGTCCATG-3′; The amplification template was plasmid pCAG roGFP2-mito.

4. The preparation method according to claim 1, characterized in that: In step S4, after the F0 generation develops to sexual maturity, it is hybridized with wild-type zebrafish; 3dpf embryos are obtained, and embryos expressing specific green fluorescence in mitochondria of neutrophils are screened by stereo fluorescence microscopy; and the F1 generation is obtained by conventional breeding.

5. The preparation method according to claim 4, characterized in that: In step S4, the F1 generation is self-pollinated after developing to sexual maturity to obtain 3dpf embryos, and embryos expressing specific green fluorescence in mitochondria of neutrophils are observed and screened; they are raised for 3-4 months to sexual maturity according to conventional methods, and test-crossed with wild-type zebrafish to screen out offspring with 100% embryos having fluorescent signals, which are homozygous F2 generation embryos and preserved as pure strains, thus obtaining a transgenic zebrafish model with specific expression on mitochondria of neutrophils to monitor the redox state in real time.

6. A recombinant expression vector for cultivating the transgenic zebrafish model according to claim 1, characterized in that: The mini Tol2 plasmid containing the mpx promoter is used as a backbone plasmid, a mitochondrial localization sequence MLS fragment and a redox-sensitive green fluorescent protein 2 fragment roGFP2 are inserted into the backbone plasmid, and the MLS and roGFP2 fragments are connected by SGGlinker.

7. The recombinant expression vector according to claim 6, characterized in that: The sequence of the MLS fragment is shown in SEQ ID NO.

3.

8. The recombinant expression vector according to claim 6, characterized in that: The sequence of the roGFP2 fragment is shown as SEQ ID NO.

6.

9. The recombinant expression vector according to claim 6, characterized in that: The backbone plasmid mini Tol2 The linearized vector is obtained by double digesting the plasmid Tg (mpx: mCherry-2A-Rac2D57N) with restriction endonucleases BamHⅠ and SalⅠ.

10. The method for preparing the recombinant expression vector according to claim 6, characterized in that: The backbone plasmid, MLS fragment and fragment roGFP2 were connected by seamless cloning.

Images