Screening method and gene editing method of short-day strawberry breeding target gene sequence

Abstract

The invention discloses a short-day strawberry breeding target gene sequence screening method, which comprises: S1, RNA extraction: taking leaves of short-day strawberries and four-season strawberries before and after flower bud differentiation, and extracting RNA by using a plant RNA rapid extraction kit; s2, carrying out integrity verification on the extracted RNA, detecting the purity and the concentration, and sequencing the RNA; s3, carrying out reverse transcription on the extracted RNA, designing a qRT-PCR (quantitative reverse transcription-polymerase chain reaction) primer, and carrying out PCR reaction to obtain a FaELF3 gene; and S4, cloning the FaELF3 gene in vitro and verifying the deletion mutant function recovery plasmid. The method effectively overcomes the limitation of traditional phenotype screening, fills up the market blank of the current high-temperature-resistant strawberry variety, has a wide application prospect, and is particularly suitable for the strawberry planting industry in tropical and subtropical regions. According to the method disclosed by the invention, the strawberries can also normally bloom at a relatively high temperature, and other important agronomic characters are not influenced.

Description

Technical Field

[0001] The present invention relates to A01H, and relates to the field of plant regeneration through tissue culture technology, and specifically to a screening method for a short-day strawberry breeding target gene sequence and a gene editing method. Background Art

[0002] Short-day strawberry is a cool season crop. Only after a period of low temperature treatment can it break the dormancy period and enter a normal growth cycle. However, with global warming, the continuous rise in temperature has caused many traditional strawberry varieties to fail to develop and bear fruit normally, resulting in a decrease in strawberry productivity. Therefore, it is necessary to develop strawberry varieties that can start flower bud differentiation in a high temperature environment. The existing methods for breeding new strawberry varieties are mostly phenotypic screening methods, which are time-consuming, labor-intensive, and inefficient, and it is difficult to efficiently screen out strawberry varieties that meet specific climatic conditions. Therefore, it is crucial to develop an efficient screening method for strawberry varieties that can meet specific climatic conditions.

[0003] Chinese invention patent CN106134989A discloses a method for cultivating transgenic melanin strawberries, using black soybean pigment genes, and injecting the black soybean pigment genes extracted from black soybeans into the embryos of strawberry seeds through gene transfer technology, and adding a composite organic nutrient solution containing trace elements such as potassium and iron to the soil to cultivate black strawberries rich in vitamin E and iron, but flower bud differentiation and normal growth cannot be achieved at high temperatures. Chinese invention patent CN102094033A discloses the construction of a strawberry NCED gene and its vector, cloning the coding gene of 9-cis-epoxycarotenoid dioxygenase from strawberries, which plays a key regulatory role in the synthesis of ABA under processes or conditions such as maturation, wilting, drought, high temperature and temperature resistance, but no strawberry variety that can differentiate flower buds at high temperatures has been accurately developed. Summary of the invention

[0004] In order to develop an efficient method for screening strawberry varieties that can meet specific climatic conditions, the first aspect of the present invention provides a method for screening short-day strawberry breeding target gene sequences, comprising the following steps:

[0005] S1: RNA extraction: Take leaves of short-day strawberry and four-season strawberry before and after flower bud differentiation, and use the plant RNA rapid extraction kit to extract RNA;

[0006] S2: Verify the integrity of the extracted RNA, test its purity and concentration, and sequence the RNA;

[0007] S3: reverse transcription of the extracted RNA, design of qRT-PCR primers, PCR reaction, and acquisition of FaELF3 gene;

[0008] S4: In vitro cloning of FaELF3 gene and verification of plasmid for restoration of deletion mutant function.

[0009] As a preferred embodiment, the strawberry material is pretreated before RNA extraction, and the specific steps of the pretreatment include: determining the strawberry variety and sampling the strawberry variety, and the strawberry variety is an octoploid short-day strawberry.

[0010] As a preferred embodiment, the sampling is to select three groups of fully expanded leaves of Akihime strawberry in the undifferentiated, early hypertrophy and two-division stages.

[0011] The present invention collects leaves at the undifferentiated stage, early hypertrophy stage, and two-fission stage of short-day strawberry, and uses four-season strawberry as a negative control to remove differentially expressed genes related to basic metabolism such as energy conversion, photosynthesis, nutrient transport and stress resistance. The remaining differentially expressed genes were subjected to GO and KEGG analysis to anchor the differentially expressed genes related to flowering. On this basis, genes with higher log2FC values ​​and fewer homologous genes were further screened out to facilitate the subsequent design of highly specific CRISPR-Cas9 targeting RNA (Guide-RNA). After the above comprehensive analysis, the FaELF3 gene was finally selected as the object of the next step of functional verification. See the GO analysis diagram of the early hypertrophy period. Figure 6 , KEGG analysis diagram of early hypertrophy stage is shown in Figure 7 , GO analysis diagram of the two division stages is shown in Figure 8 , KEGG analysis diagram of the two division stages is shown in Fig. 9 .

[0012] As a preferred embodiment, the method for verifying the integrity of the RNA is a gel method, and the method for detecting the purity and concentration of the RNA is an ultraviolet spectrophotometer method.

[0013] As a preferred embodiment, the base sequence of the qRT-PCR primer is as follows:

[0014] FaELF3-F:GTGGAACAAGTCAATCATGCTTGTTG

[0015] FaELF3-R: TGCAGGTAAAATTGCCTTTGTTCTTT.

[0016] As a preferred embodiment, the reaction conditions of the PCR reaction are as follows: 90-98°C, 5-15min; 90-98°C, 10-20s, 55-65°C, 1-3min, for a total of 40 cycles.

[0017] After testing, it was found that there was a significant difference in the expression level of FaELF3 gene before and after low-temperature-induced flowering of short-day strawberry, while the expression level of this gene in four-season strawberry, which is insensitive to low-temperature induction, was stable before and after flower bud differentiation, indicating that the FaELF3 gene has an inhibitory effect on low-temperature-induced flower bud differentiation of short-day strawberry.

[0018] As a preferred implementation, the specific implementation of step S4 is as follows:

[0019] 4.1 Construction of functional restoration vector: The obtained FaELF3 gene fragment was assembled into the dicotyledonous plant coding optimized 35S:XX-GFP plasmid through seamless cloning kit to construct a complete cloning system;

[0020] 4.2 Identification of vector transformation and functional recovery.

[0021] As a preferred embodiment, the specific steps of constructing the function restoration vector are as follows:

[0022] 4.1.1 Add the insert fragment and vector to the purified PCR product and linearized vector, add 10 μL of linearized vector, and then make up the total volume to 20 μL with sterile water;

[0023] 4.1.2 Incubate the reaction system at 50°C for 15 min;

[0024] 4.1.3 Transformation and clone identification.

[0025] The second aspect of the present invention provides a gene editing method for a short-day strawberry breeding target gene sequence, comprising the following steps: using the FaELF3 gene obtained by the above method,

[0026] M1 determines the adjacent base sequence of the protospacer region based on the FaELF3 gene and designs gRNA;

[0027] M2 constructed a gene-edited strawberry dicotyledonous plant encoding optimized acquired immune system by targeting specific gene fragments for effect verification.

[0028] As a preferred embodiment, the gRNA includes three gene-specific fragments, which are as follows:

[0029] FaELF3-1:AGGTAGAGATAATGAGA

[0030] FaELF3-2:TTATGGGGCCAATGTTCCCA

[0031] FaELF3-3:GAGGGCCAAGAGCTCCTCC

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] (1) The method for screening short-day strawberry breeding target gene sequences of the present invention systematically screens the differentially expressed genes in the initiation stage of flower bud differentiation of strawberries before and after low temperature treatment. It has high accuracy and screening efficiency, and greatly shortens the breeding cycle.

[0034] (2) The screening method for the short-day strawberry breeding target gene sequence described in the present invention is combined with qRT-PCR technology to verify the expression of key genes, and the FaELF3 gene that is highly related to the strawberry low-temperature induced flowering signaling pathway is screened out. It is clarified that the FaELF3 gene plays an inhibitory role in the flower bud differentiation process of strawberry, limits the flower bud differentiation of strawberry at higher temperatures, and can stably control the performance traits of the variety.

[0035] (3) The screening method for the target gene sequence of short-day strawberry breeding described in the present invention designed a CRISPR-Cas9 targeting RNA (Guide-RNA) sequence with extremely high specificity for directed modification of the FaELF3 gene, thereby successfully breeding a new heat-resistant strawberry variety that can initiate flower bud differentiation under high temperature conditions.

[0036] (4) The screening method for the short-day strawberry breeding target gene sequence of the present invention uses CRISPR-Cas9 technology to knock out the gene in a targeted manner, so that the strawberry can bloom normally at higher temperatures without affecting other important agronomic traits, such as yield, fruit taste and stress resistance.

[0037] (5) The screening method for the short-day strawberry breeding target gene sequence of the present invention effectively overcomes the limitations of traditional phenotypic screening, fills the current market gap in high-temperature-resistant strawberry varieties, has broad application prospects, and is particularly suitable for strawberry cultivation in tropical and subtropical regions. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a bar graph of the relative expression values ​​of the FaELF3 gene.

[0039] Figure 2 This is a fluorescence image showing that the protein expressed by the function restoration plasmid fused with FaELF3 gene and GFP emits green fluorescence in the cell nucleus.

[0040] Figure 3 The flowering status of Faelf3-1 plants after being treated under different temperature conditions;

[0041] Figure 4 The flowering status of Faelf3-5 plants after being treated under different temperature conditions;

[0042] Figure 5 This is the flowering status of wild-type plants after being treated under different temperature conditions;

[0043] Figure 6 This is the GO analysis diagram of short-day strawberry in the early hypertrophy stage;

[0044] Figure 7 This is the KEGG analysis diagram of the early hypertrophy stage of short-day strawberry;

[0045] Figure 8 This is the GO analysis diagram of the two-fission period of short-day strawberry;

[0046] Fig. 9 This is the KEGG analysis diagram of the two-fission period of short-day strawberry. DETAILED DESCRIPTION

[0047] Example

[0048] A method for screening a short-day strawberry breeding target gene sequence comprises the following steps:

[0049] S1: RNA extraction: Take leaves of short-day strawberry and four-season strawberry before and after flower bud differentiation, and use the plant RNA rapid extraction kit to extract RNA;

[0050] S2: Verify the integrity of the extracted RNA, test its purity and concentration, and sequence the RNA;

[0051] S3: reverse transcribe the extracted RNA, design qRT-PCR primers, and obtain the FaELF3 gene;

[0052] S4: In vitro cloning of FaELF3 gene and verification of plasmid for restoration of deletion mutant function.

[0053] The plant RNA rapid extraction kit is the EASYspin plant RNA rapid extraction kit from Adelaide Biological Company.

[0054] The specific implementation of step S1 is as follows:

[0055] 1.1 Grind the sample using liquid nitrogen grinding method: freeze the sample in liquid nitrogen and then grind it using a grinder;

[0056] 1.2 Take out 500 μL of lysate RLT, pour it into a 1.5 mL centrifuge tube, add 50 μL of PLANTaid, mix well and set aside;

[0057] 1.3 After grinding the plant tissue into fine powder in liquid nitrogen, take 100 mg of the fine powder and transfer it into the above centrifuge tube containing RLT and PLANTaid, and immediately shake it vigorously by hand for 20 seconds to fully lyse;

[0058] 1.4 Use a pipette tip to mix and vortex to help lysis or vortex vigorously until a satisfactory homogenate result is obtained, shearing the DNA to reduce viscosity and increase yield;

[0059] 1.5 Centrifuge the lysate at 13000 rpm for 8 minutes to precipitate the insoluble fragments and PLANTaid bound to polysaccharides and polyphenols;

[0060] 1.6 Transfer the supernatant of the lysate to a new centrifuge tube, add anhydrous ethanol (0.5 times the volume) equal to half the volume of the supernatant, and mix immediately by pipetting. Centrifugation is not required.

[0061] 1.7 Please note: If you need to increase the yield, you can double the liquid nitrogen grinding method using 1 mL of lysis buffer RLT and 100 μL of PLANTaid and 200 mg of sample;

[0062] 1.8 Add the product of 1.6 to the adsorption column RA in batches (less than 720 μL each time), place the adsorption column RA in a collection tube, centrifuge at 13000 rpm for 2 min, discard the waste liquid, and ensure that all the liquid passes through the filter membrane after centrifugation without residue;

[0063] 1.9 Add 700 μL of deproteinized solution RW1, let it stand at room temperature of 25°C for 1 minute, then centrifuge at 13000 rpm for 30 seconds and discard the waste liquid;

[0064] 1.10 Add anhydrous ethanol, then add 500 μL of rinsing solution RW, centrifuge at 13000 rpm for 30 seconds, discard the waste liquid, add 500 μL of rinsing solution RW, and repeat the above steps;

[0065] 1.11 Place the adsorption column RA back into the empty collection tube and centrifuge at 13000 rpm for 2 minutes to remove as much rinse solution as possible to avoid the inhibition of downstream reactions by residual ethanol in the rinse solution;

[0066] 1.12 Take out the adsorption column RA from the collection tube and put it into an RNase-free centrifuge tube. According to the expected RNA yield, add 50 μL of RNase-free water to the middle of the adsorption membrane, then leave it at room temperature for 1 minute, and then centrifuge at 12000 rpm for 1 minute;

[0067] 1.13 If the expected RNA yield is greater than 30 μg, you can add 50 μL of RNase-free water, repeat step 7, and combine the two washes, or use the first elution solution to re-wash the adsorption column to obtain a higher RNA concentration. Washing twice with RNA wash solution can obtain a higher RNA yield, but the concentration will be lower.

[0068] The specific implementation of step S2 is as follows:

[0069] The method of integrity verification is as follows:

[0070] 2.1 Take 3 μL of the above RNA sample, add 2 μL of bromophenol blue, mix thoroughly and load the sample for electrophoresis; if the electrophoresis results show two clear bands, one of which is about twice as wide as the other, corresponding to 28S rRNA and 18S rRNA respectively, it indicates that the RNA extraction quality is good; if the bands are fuzzy or unclear, it means that the RNA extraction quality does not meet the standard and RNA extraction needs to be repeated.

[0071] The purity and concentration methods are as follows:

[0072] 2.2 Take 1 μL RNA sample and drop it onto the probe of the zero-calibrated micro-volume UV spectrophotometer. If the displayed spectrum shows a single peak and the A260 / A280 value is between 1.8 and 2.0, it indicates that the RNA is of high purity. If the A260 / A280 value is greater than 2, it indicates that the RNA may contain ethanol that has not been completely evaporated. If the A260 / A280 value is less than 1.8, it indicates that the sample may contain proteins or phenols and the RNA sample has been contaminated.

[0073] The method of RNA sequencing is as follows:

[0074] 2.3 Send RNA to Novogene for RNA sequencing.

[0075] The base sequences of the qRT-PCR primers in step S3 are as follows:

[0076] FaELF3-F:GTGGAACAAGTCAATCATGCTTGTTG

[0077] FaELF3-R:TGCAGGTAAAATTGCCTTTGTTCTTT

[0078] The specific implementation of qRT-PCR in step S3 is as follows:

[0079] Using a Bio-Rad fluorescence quantifier, take a qRT-PCR 96-well plate, according to the design of the above qRT-PCR primers, first vertically drip 8.4μL of the template in each well, then drip 11.6μL of the primers on the wall; cover with a film, centrifuge and mix in a specific centrifuge; add samples according to the above system, and set the program in the fluorescence quantitative PCR instrument as follows: 95℃10min; 95℃15s, 60℃1min, a total of 40 cycles. Then process the data using the Ct method. Perform 3 biological replicates and 3 technical replicates.

[0080] The specific implementation of step S4 is as follows:

[0081] 4.1 Construction of functional restoration vector: The FaELF3 gene fragment was assembled into the 35S:XX-GFP plasmid optimized for dicotyledonous plants through seamless cloning kit to construct a complete cloning system; (the 35S:XX-GFP plasmid is a universal plasmid purchased from Addgene)

[0082] 4.1.1 Add the above-mentioned purified PCR product (cDNA fragment of FaELF3 gene) and linearized vector at a molar ratio of 3:1 for each insert fragment (FaELF3 gene) and vector (35S:XX-GFP plasmid), add 10 μL 2X Seamless Cloning Mix, and then adjust the total volume to 20 μL with Nuclease free water;

[0083] 4.1.2 Incubate the reaction system at 50°C for 15 min;

[0084] 4.1.3 Transformation and cloning identification;

[0085] 4.1.3.1 Take 5 μL of the reaction sample from the previous step and add it to 100 μL of DH5α competent cells (note that the volume of the DNA sample added should not exceed 1 / 10 of the competent cell volume), mix gently, and place the mixture on ice for 30 minutes;

[0086] 4.1.3.2 Heat shock in a 42°C water bath for 90 seconds, then quickly return to an ice bath and let stand for 3 to 5 minutes;

[0087] 4.1.3.3 Add 500 μL of SOC or LB culture medium without antibiotics, mix gently, and culture at 37℃ with shaking for 1 h;

[0088] 4.1.3.4 Centrifuge the bacterial solution at 5000 rpm for 1 min to separate and precipitate the bacteria, remove most of the culture solution, and resuspend the bacteria in the remaining 100 μL of culture solution. Then spread all of it evenly on the LB plate containing antibiotics and culture it in a 37°C incubator overnight;

[0089] 4.1.3.5 After 24 hours, pick the clones on the plate for colony PCR.

[0090] 4.2 Identification of vector transformation and functional recovery:

[0091] 4.2.1 The function restoration plasmid of FaELF3 gene obtained by in vitro cloning was transferred into the homologous Arabidopsis gene loss-of-function mutant through pollen tube-mediated method. The specific operation is as follows: select Arabidopsis plants of the day, and 0.5 hours after pollination, use a fine brush to dip the above function restoration plasmid solution and apply it on the stigma of Arabidopsis until droplets can be seen on the stigma with the naked eye; repeat the application once after 1 hour.

[0092] 4.2.2 Then, the 35S overexpression promoter was used to overexpress the FaELF3-GFP recombinant protein. At the molecular level, observe the subcellular localization and transcriptional activation activity: 2-4 days after the infection of tobacco, take a 2mm×2mm leaf at the marked site, place the leaf face down in distilled water, use tweezers to grab the cover slip, and slowly cover it to avoid the formation of bubbles. Observe under a fluorescence microscope, place the slide on the stage, first make basic optical adjustments to the microscope to see a clear image in the bright field; then use 488nm light for fluorescence excitation, and you can see that the protein expressed by the functional recovery plasmid containing the FaELF3 gene fused with GFP emits green fluorescence in the cell nucleus. The results are attached. Figure 2 .

[0093] 4.2.3 At the phenotypic level, observe whether the function restoration plasmid can restore the phenotype of the homologous Arabidopsis loss-of-function mutant. After double verification, the strawberry function restoration plasmid 35S:FaELF3-GFP was transferred into the Arabidopsis AT2G25930 (AtELF3) loss-of-function mutant elf3-6 (CS3792), which can partially restore the early flowering phenotype of elf3-6, further verifying the speculation that the strawberry ELF3 protein plays a flowering inhibitory role in the Arabidopsis loss-of-function mutant, which is consistent with functional expectations.

[0094] A gene editing method for a short-day strawberry breeding target gene sequence comprises the following steps:

[0095] M1 determines the PAM sequence of the FaELF3 gene and designs gRNA;

[0096] M2 constructed a codon-optimized CRISPR system for gene editing in strawberry dicots targeting specific gene fragments and verified its effectiveness.

[0097] The gRNA includes three gene-specific fragments, which are as follows:

[0098] FaELF3-1:AGGTAGAGATAATGAGA

[0099] FaELF3-2:TTATGGGGCCAATGTTCCCA

[0100] FaELF3-3:GAGGGCCAAGAGCTCCTCC

[0101] The specific implementation of the effect verification is as follows:

[0102] The wild type is the Japanese short-day strawberry variety "Suizhu", and the base sequence is as follows: ATGAAGAGAGG AGGTAGAGATG ATGAGA AGG TTATGGGGCCAATGTTCCC A AGGCTCCATGTGAATGATGCAGATAAAG GAGGGCCAAGAGCTCCTC CA A GGAACAAGATGG;

[0103] The base sequence of the functional loss mutant Faelf3-1 with fragment deletion is as follows: (the entire deletion from the last three bases at the 3' end of the first target site of FaELF3-1 to the third to last base at the 3' end of the third target site)

[0104] ATGAAGAGAGGAGGTAGAGATGATG____________CCAAGGAACAAGA TGG

[0105] The base sequence of the frameshift loss-of-function mutant Faelf3-5 is as follows: (a T is inserted into the first target site of FaELF3-1, causing a frameshift)

[0106] ATGAAGAGAGG AGGTAGAGATGATGTAGA AGG TTATGGGGCCAATGTTCC

[0107] CA AGGCTCCATGTGAATGAT C CAGATAAAG GAGGGCCAAGAGCTCCTCCA

[0108] AGGAACAAGATGG

[0109] The test results are shown in Table 1 below:

[0110] Table 1

[0111]

[0112]

[0113] Conclusion: Different mutants showed different degrees of early flowering or flowering insensitivity to low temperature, indicating that the ELF3 gene has the characteristics of inhibiting flowering and being regulated by low temperature in the short-day strawberry variety "Suizhu". Among them, the large fragment deletion mutant Faelf3-1 has the most prominent phenotype. The actual picture of Faelf3-1 is shown in Figure 3 , the actual picture of Faelf3-5 can be seen Figure 4 , the actual picture of wild type is shown in Figure 5 .

[0114] After testing, the strawberry ELF3 gene-related loss-of-function mutants did not show other significant phenotypes, and the expression levels of potential off-target genes similar to the above three gRNA sequences were not affected, proving the high specificity and safety of the gRNA sequence design.

Claims

1. A method for screening target gene sequences for short-day strawberry breeding, characterized in that: The following steps are involved: S1: RNA extraction: Take leaves of short-day strawberry and four-season strawberry before and after flower bud differentiation, and use the plant RNA rapid extraction kit to extract RNA; S2: Verify the integrity of the extracted RNA, test its purity and concentration, and sequence the RNA; S3: reverse transcription of the extracted RNA, design of qRT-PCR primers, PCR reaction, and acquisition of FaELF3 gene; S4: In vitro cloning of FaELF3 gene and verification of plasmid for restoration of deletion mutant function.

2. The method for screening short-day strawberry breeding target gene sequences according to claim 1, characterized in that: The strawberry material is pretreated before RNA extraction. The specific steps of the pretreatment include: determining the strawberry variety and sampling the strawberry variety. The strawberry variety is an octoploid short-day strawberry.

3. The method for screening short-day strawberry breeding target gene sequences according to claim 2, characterized in that: The sampling is to select three groups of fully expanded leaves of Akihime strawberry in the undifferentiated, early hypertrophy and two-division stages.

4. The method for screening short-day strawberry breeding target gene sequences according to claim 1, characterized in that: The RNA integrity verification method is a gel method, and the RNA purity and concentration detection method is an ultraviolet spectrophotometer method.

5. The method for screening short-day strawberry breeding target gene sequences according to claim 1, characterized in that: The base sequences of the qRT-PCR primers are as follows: FaELF3-F:GTGGAACAAGTCAATCATGCTTGTTG FaELF3-R: TGCAGGTAAAATTGCCTTTGTTCTTT.

6. The method for screening short-day strawberry breeding target gene sequences according to claim 1, characterized in that: The reaction conditions of the PCR reaction are as follows: 90-98°C, 5-15min; 90-98°C, 10-20s, 55-65°C, 1-3min, for a total of 40 cycles.

7. The method for screening short-day strawberry breeding target gene sequences according to claim 1, characterized in that: The specific implementation of step S4 is as follows: 4.1 Construction of functional restoration vector: The obtained FaELF3 gene fragment was assembled into the dicotyledonous plant coding optimized 35S:XX-GFP plasmid through seamless cloning kit to construct a complete cloning system; 4.2 Identification of vector transformation and functional recovery.

8. The method for screening short-day strawberry breeding target gene sequences according to claim 7, characterized in that: The specific steps of constructing the functional restoration vector are as follows: 4.1.1 Add the insert fragment and vector to the purified PCR product and linearized vector, add 10 μL of linearized vector, and then make up the total volume to 20 μL with sterile water; 4.1.2 Incubate the reaction system at 50°C for 15 min; 4.1.3 Transformation and clone identification.

9. A gene editing method for a short-day strawberry breeding target gene sequence, characterized in that: The FaELF3 gene obtained by the method according to any one of claims 1 to 8 comprises the following steps: M1 determines the adjacent base sequence of the protospacer region based on the FaELF3 gene and designs gRNA; M2 constructed a gene-edited strawberry dicotyledonous plant encoding optimized acquired immune system by targeting specific gene fragments for effect verification.

10. The gene editing method for short-day strawberry breeding target gene sequence according to claim 9, characterized in that: The gRNA includes three gene-specific fragments, which are as follows: FaELF3-1:AGGTAGAGATAATGAGA FaELF3-2:TTATGGGGCCAATGTTCCCA FaELF3-3:GAGGGCCAAGAGCTCCTCC.

Images