Application of Circ2977 as colorectal cancer diagnostic marker and therapeutic target

Abstract

The invention discloses application of Circ2977 as a diagnostic marker and a therapeutic target of colorectal cancer. The research proves that the level of Circ2977 in CRC tissue is higher than that of normal para-carcinoma tissue, and Circ2977 exists in tumor-derived outer vesicles, so that endothelial cell migration and tubule formation are enhanced. The research finds that Circ2977 regulates and controls the expression of VEGFA / SOX2 by adsorbing miR-874-3p, and promotes CRC cell proliferation, migration and invasion and angiogenesis. The research of the invention reveals the effect of Circ2977 in CRC progress and angiogenesis, and provides a new diagnostic marker and therapeutic target for colorectal cancer.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the application of Circ2977 as a diagnostic marker and therapeutic target for colorectal cancer. Background Art

[0002] Colorectal cancer (CRC) is a malignant tumor that seriously endangers human health, and its incidence ranks third among all malignant tumors. Clinical studies have shown that despite the implementation of CRC screening programs, the development of diagnostic technology and the improvement of treatment levels, the early diagnosis rate of CRC can be increased to 80%; however, epidemiological surveys show that the 5-year survival rate of patients with metastatic CRC is only 12% in both developing and developed countries, and the CRC mortality rate ranks second in the world in cancer deaths. The diagnosis and treatment of metastatic colorectal cancer is still one of the research difficulties and hotspots in related fields. 1. Diagnosis: At present, the diagnosis of metastatic CRC in clinical practice mainly relies on imaging examinations, but the sensitivity of imaging detection is low, and the detection rate of early metastatic CRC is low; on the other hand, the existing traditional tumor markers have poor diagnostic sensitivity and specificity for CRC, which are the reasons why patients miss the best time for treatment. 2. Treatment: At present, the treatment strategy for metastatic CRC is mainly chemotherapy-assisted anti-vascular targeted therapy; chemotherapy has large toxic side effects and is prone to drug resistance, while the clinically widely used anti-vascular targeted therapy is not satisfactory due to factors such as the lack of biomarkers to monitor the vascular status of tumors. Studies have shown that the formation of tumor angiogenesis is an important link in the formation of the early pre-metastatic microecology of tumors, which plays an important role in tumor growth, invasion and metastasis. This suggests that we can explore the mechanism of angiogenesis in early metastatic tumors of CRC to find targets that can be used for CRC diagnosis and / or treatment.

[0003] Recently, the function of extracellular vesicles (EVs) in cancer has attracted increasing attention. EVs are lipid bilayer-delimited vesicles secreted by various cells and reported to be carriers of DNA, noncoding RNA, and protein for intercellular signal transduction. Among them, circular RNA (circRNA) is a type of structurally stable circular noncoding RNA. Most circRNAs are derived from the exons of protein-coding genes and are produced through the reverse splicing process. They have sites that bind to microRNAs (miRNAs). CircRNAs are involved in multiple processes such as tumorigenesis, development, and metastasis. Many studies have confirmed that circRNAs are closely related to angiogenesis in CRC. The covalently closed ring structure of circRNAs gives them the advantages of conservation and stability. CircRNAs can be easily detected in serum samples of patients and collected extracellular vesicles, indicating that circRNAs may be a promising non-invasive diagnostic marker for human cancer diagnosis. However, how tumor-derived extracellular vesicle circRNAs regulate the formation of the pre-metastatic microenvironment by inducing cancer progression and angiogenesis remains to be further studied. Summary of the invention

[0004] The purpose of the present invention is to address the above-mentioned problems and provide an application of Circ2977 as a diagnostic marker and therapeutic target for colorectal cancer.

[0005] In order to achieve its purpose, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides use of a reagent for detecting a biomarker in a sample in the preparation of a product for diagnosing colorectal cancer, wherein the biomarker is Circ2977.

[0007] Compared with normal controls, the expression level of Circ2977 was upregulated in patients.

[0008] The content of Circ2977 in the patient's test sample is obtained by total RNA extraction, reverse transcription, and quantitative PCR; the test sample is preferably a colorectal cancer tissue or cell or extracellular vesicle or serum sample.

[0009] The second aspect of the present invention provides the use of a Circ2977 expression inhibitor in the preparation of a drug for preventing and treating colorectal cancer.

[0010] The Circ2977 expression inhibitor includes siRNA.

[0011] Preferably, the sequence of the siRNA is:

[0012] Sense strand sequence: 5'-GUUCUGCACUUACACAGGU-3',

[0013] Antisense strand sequence: 5'-ACCUGUGUAAGUGCAGAAC-3'.

[0014] The third aspect of the present invention provides the use of Circ2977 as a target in screening drugs for treating colorectal cancer.

[0015] The drug inhibits the expression of Circ2977.

[0016] In any of the above uses, the transcribed nucleotide sequence of Circ2977 is as shown in SEQ ID NO.1.

[0017] In any of the above applications, Circ2977 regulates the expression of VEGFA / SOX2 by adsorbing miR-874-3p, thereby promoting CRC cell proliferation, migration and invasion, and angiogenesis.

[0018] The beneficial effects of the present invention are:

[0019] The present study confirmed that the level of Circ2977 in CRC tissues was higher than that in adjacent normal tissues, and that Circ2977 was present in tumor-derived extracellular vesicles, enhancing endothelial cell migration and tubule formation. The present study found that Circ2977 regulates the expression of VEGFA / SOX2 by adsorbing miR-874-3p, promoting CRC cell proliferation, migration and invasion, and angiogenesis. The present study revealed the role of Circ2977 in CRC progression and angiogenesis, providing a new diagnostic marker and therapeutic target for colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1Figure 3: Circ2977 was significantly overexpressed in CRC cells and extracellular vesicles. A. Heat map showing hierarchical clustering of differentially expressed CircRNAs in two groups (CT: tumor, CN: normal); B. Volcano map showing the expression profiles between tumor tissues and adjacent tissues, with the following screening criteria: │Fold Change│>2; P<0.05, red dots in the figure indicate upregulated CircRNAs, and blue dots indicate downregulated CircRNAs; C. GO functional analysis of differentially expressed CircRNAs; D. Venn diagram showing the intersection of the top 20 upregulated differentially expressed CircRNAs obtained by whole transcriptome sequencing and the highly expressed CircRNAs in the CRC serum extracellular vesicle database exoRBase; E. TEM image of extracellular vesicles, scale bar = 100 nm; F. Isolated SW480-EVs, Caco G. Nano flow cytometry detection of extracellular vesicle markers (CD9, CD63, CD81); H. Nano flow cytometry detection of extracellular vesicle particle size distribution and number of SW480-EVs; I. Expression of Circ2977 mRNA in SW480-EVs and Caco2-EVs; J. Laser confocal imaging showed that dense extracellular vesicle particles could be observed in HUVECs cells.

[0021] Figure 2The purpose is to verify the circular nature of Circ2977 and the expression of CircRNA in CRC serum, tissues and cells: A. The formation process of Circ2977 located on the CDC42 gene on chromosome 1 and Sanger sequencing to verify the reverse splicing site of Circ2977; B. Agarose gel electrophoresis to confirm the PCR product of Circ2977 and electrophoresis analysis of PCR products using divergent primers and convergent primers of Circ2977; C. qRT-PCR to detect the expression abundance of Circ2977 after specific treatment with RNaseR and actinomycin D to verify its circular nature; E. qRT-PCR was used to detect 45 CRC patients and 13 polyp patients The expression levels of Circ2977 in the serum of 20 healthy controls were compared, and GAPDH was used as the internal reference to draw the ROC curve according to the expression of Circ2977 in serum; F. The relationship between Circ2977 expression and lymph node metastasis and distant metastasis in CRC patients; GH. The expression of Circ2977 in CRC patients was analyzed according to the depth of intestinal wall infiltration and TNM staging; I. The correlation scatter plot between Circ2977 and VEGFA expression in CRC patients; J. ROC curve of CEA and Circ2977; K. The expression of Circ2977 in colorectal cancer tissues and adjacent tissues; L. qRT-PCR was used to detect the expression of Circ2977 in CRC cell lines.

[0022] Figure 3 The results showed that knockdown of Circ2977 inhibited CRC cell proliferation, migration, and invasion in vitro, and promoted CRC cell apoptosis: A. qRT-PCR was used to detect the knockdown effect of Circ2977; BC. CCK8 and clone formation experiments were used to detect the effects of knockdown of Circ2977 on cell proliferation; D. AnnexinV-FITC / PI flow cytometer was used to detect apoptosis; EF. Transwell experiments with or without Matrigel and scratch healing experiments were used to detect the effects of knockdown of Circ2977 on the migration and invasion abilities of SW480 and Caco2 cells.

[0023] Figure 4 The effects of knocking down Circ2977 and inhibiting the expression of miR-874-3p on the growth and angiogenesis of colorectal cancer in vivo are shown: A. Concept diagram of nude mouse subcutaneous transplanted tumor; B. Image of nude mouse transplanted tumor; C. Quantitative analysis of tumor volume. D. Quantitative analysis of tumors in each group; E. Immunohistochemical detection of cell proliferation markers (Ki67), vascular markers (CD31), vascular mimicry markers (PAS + / CD31 -) expression; F. Immunohistochemical analysis of VEGFA, VEGFR1, and SOX2 expression after Si-Circ and / or Antagomir treatment. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0025] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0026] Experimental research methods of the present invention: High-throughput sequencing was used to analyze the expression of differential CircRNA in CRC tumors and adjacent tissues. Ultracentrifugation was used to isolate extracellular vesicles from CRC cells. Real-time fluorescence quantitative PCR (qRT-PCR) was used to identify and verify the extracellular vesicle Circ2977 and to detect the level of Circ2977 in CRC cells and serum specimens. Sanger sequencing, RNase R and actinomycin D experiments were used to verify the ring structure of Circ2977. Functional loss experiments were used to explore the effects of extracellular vesicle Circ2977 on CRC growth, invasion, and angiogenesis in vitro and in vivo.

[0027] The experimental results of the present invention: Circ2977 is significantly highly expressed in CRC tissues and extracellular vesicles, and the receiver operating characteristic curve (ROC) shows that the expression of Circ2977 in serum has high sensitivity and specificity for the detection of CRC. The high expression of Circ2977 in the serum of CRC patients is significantly correlated with the tumor differentiation state, intestinal wall infiltration depth, lymph node metastasis and distant metastasis, and has a strong correlation with the patient's serum VEGFA content, suggesting that Circ2977 has the potential to be used as a diagnostic biomarker. In vitro and in vivo functional experiments showed that Circ2977 promotes CRC cell proliferation, stemness, invasion and angiogenesis.

[0028] The specific research process is as follows:

[0029] Example 1

[0030] 1 Materials and methods

[0031] 1.1 Experimental Materials

[0032] 1. Cell culture

[0033] Human CRC cell lines SW480, Caco2, HCT116, Lovo, human colon cell line NCM460, and human umbilical vein endothelial cells HUVECs were obtained from the Key Laboratory of Clinical Laboratory Diagnosis, Ministry of Education, Chongqing Medical University. All cells were cultured in DMEM / high glucose medium (gbico, Thermo Fisher, USA) containing 10% fetal bovine serum (LONSA SCIENCE SRL, Uruguay) at 37°C and 5% CO 2 , cultured in an incubator with saturated humidity.

[0034] 2. Experimental Animals

[0035] All animal experiments in this study were approved by the Medical Ethics Committee of Chongqing Medical University. BALB / c nude mice (female, 4-5 weeks old) were purchased from Beijing Huafukang Biotechnology Co., Ltd. and raised under specific pathogen-free (SPF) conditions at the Animal Center of Chongqing Medical University. The nude mice were randomly divided into 4 groups, with 5 mice in each group. They were raised under the same conditions, and diet and other conditions were not controlled. After the nude mice adapted to the experimental conditions for 1 week, 4×106SW480 cells transfected with Si-NC+miR-874-3p-NC, Si-circ, miR-874-3p-Antagomir, and Si-circ+miR-874-3p-Antagomir were suspended in 100 μL serum-free DMEM and injected subcutaneously into the left forelimb axilla of each nude mouse. The status changes of nude mice in each group were observed at different times, and the size of the tumor was recorded. After 25 days, the nude mice were killed by cervical dislocation. All the tumor samples removed were photographed and weighed, then fixed with 4% paraformaldehyde, embedded in wax blocks, and the tissue sections were used for immunohistochemical staining of various indicators.

[0036] 3. Study subjects: Circ2977

[0037] Analysis of the UCSC (http: / / genome.ucsc.edu / ) online database software revealed that the CDC42 gene was located on human chromosome 1; according to the CDC42 circular RNA information included in the authoritative circular RNA database CircBase (http: / / circrna.org / ), chr1:22404921-22413359 of the CDC42 gene formed a closed circular RNA molecule through head-to-tail connection, and RNA-seq named it circRNA2977 (exoRbase ID: exo_circ_33146).

[0038] The sequence of human Circ2977 is as follows (SEQ ID NO.1):

[0039] GTCATCATCAGATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACAG。

[0040] The mouse Circ2977 sequence is as follows (SEQ ID NO.2):

[0041] .

[0042] 1.2 RNA extraction, reverse transcription (RT-PCR) and real-time quantitative PCR (qRT-PCR) detection

[0043] According to the instructions of the reagent manufacturer, total cell RNA was extracted using the SteadyPure Quick Extraction Kit, and serum RNA was extracted using the SteadyPure Blood, Serum and Plasma Small RNA Extraction. The method for extracting RNA from extracellular vesicles was to add 140 μL of chloroform to the extracellular vesicles and vortex to mix for 15 seconds. Incubate at room temperature for 3 minutes, and centrifuge at 4°C, 12000g for 15 minutes. Collect the upper liquid and add anhydrous ethanol to mix and transfer to the RNeasy adsorption column, and centrifuge at 8000g for 15 seconds. Then add Buffer RWT and centrifuge at 8000g for 15 seconds, and add Buffer RPE and centrifuge at 8000g for 15 seconds, and discard the filtrate. Finally, centrifuge at 12000g for 1 minute, dry, add an appropriate amount of RNase-free water to the middle of the adsorption membrane, and centrifuge at 8000g for 1 minute to obtain RNA.

[0044] The concentration and purity of the extracted total RNA were determined using a NanoDrop One (Thermo Fisher Scientific, USA) ultra-micro UV spectrophotometer. Evo M-MLVRTPremix (Accurate Biotechnology, China) was used to reverse transcribe mRNA and reverse transcribe it into cDNA at 37°C for 15 min and 85°C for 5 s. qRT-PCR was performed on a Bio-Rad CFX96TM (Bio Rad, USA) using a SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biotechnology, China). The qRT-PCR reaction was performed at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and a primer-specific annealing temperature of 60°C for 30 s. The qRT-PCR primer sequences are shown in the table. GAPDH / U6 was used as an internal reference, and the relative quantification value of RNA was calculated using the 2-ΔΔCt method.

[0045] PCR primer sequences are shown in Table 1:

[0046] Table 1

[0047]

[0048] 1.3 Isolation and identification of extracellular vesicles

[0049] Extracellular vesicles were isolated by differential ultracentrifugation. The supernatant of serum-free cultured CRC cells was centrifuged at 300g for 10 min, 2000g for 10 min, and 10,000g for 30 min at 4°, and finally centrifuged at 100,000g for 70 min in an ultracentrifuge to obtain extracellular vesicle precipitates that had been freed of cell debris, large particles, microvesicles, and other impurities, and then resuspended in 1xPBS. The morphology of EVs was observed by TEM, the concentration of EVs and the size distribution of EVs were determined by Flow NanoAnalyzer (NanoFCM, China), and EVs protein markers were detected by Western blotting and FlowNanoAnalyzer.

[0050] 1.4 Extracellular vesicle uptake experiments

[0051] The extracted exosomes were mixed with 1umol / ml CM-Dil and incubated in the dark for 10 minutes. The labeled exosomes were added to HUVEC cell slides and incubated in the dark for 4 hours. After fixation with 4% paraformaldehyde, the cells were permeabilized with PBS solution containing 0.4% Triton X-100 at room temperature for 10 minutes, and washed with PBS three times. 200ul PBS was added to dilute 2-5ul fluorescently labeled phalloidin stock solution, incubated at room temperature for 20 minutes, stained, and washed with PBS 2-3 times. DAPI was used to stain the cell nucleus for 5 minutes, and confocal photography was performed.

[0052] 1.5 Vector construction and cell transfection

[0053] 4×10 5 CRC cells were seeded in six-well plates and waited for 12 h to allow them to adhere to the wall and then transfected with the transfection reagent GP-transfect-Mate (purchased from Gene Pharma, China) according to the manufacturer's instructions. siRNA and siNC targeting the Circ2977 reverse splicing site were synthesized (Tsing ke, China), and the knockdown efficiency was detected by qRT-PCR. The inhibitor of miR-874-3p (miR-874-3p-Antagomir) was purchased from Qingke Bio (Tsing ke, China). The sequences of siRNA and inhibitors are shown in Table 2.

[0054] Table 2 Sequence information of siRNA and miR inhibitors

[0055]

[0056] 1.6 Western blot

[0057] Total protein of cells was extracted and protein concentration was determined by BCA method. Equal amount of protein was separated on SDS-PAGE gel at 90V, 30min, 120V, 60min, and transferred to PVDF membrane (Biosharp, China), blocked with 5% BSA in TBST for 2h, and then incubated with primary antibodies against CD63 (1:1000) (Wanlei), ALIX (1:1000) (Wanlei), CANX (1:1000) (Wanlei), and βactin (1:1000) (Proteintech, China) at 4℃ overnight. Then incubated with secondary antibody (1:5000) (ZSGB-BIO, China) at 37℃ shaker for 1h. Band intensity was analyzed using ECL chemiluminescence kit (Biosharp, China).

[0058] 1.7 RNase R digestion experiment

[0059] Total RNA (2 μg / group) from SW480 and Caco2 cells was incubated with 10 U / μg RNase R (Solarbio, China) at 37°C for 0, 10, 20, and 30 min, and then the abundance of linear and circular RNAs was analyzed by qRT-PCR.

[0060] 1.8 Actinomycin D tolerance test

[0061] SW480 and Caco2 cells were seeded in 6-well plates, and actinomycin D (MCE, USA) was added at a final concentration of 100 ng / ml the next day for 0, 4, 8, 12, and 24 hours. Total RNA was extracted. qRT-PCR was used to analyze the stability of Circ2977, CDC42, and GAPDH mRNA.

[0062] 1.9 CCK8, colony formation

[0063] The proliferation ability of cells was detected using CCK8 kit (MCE, USA) and clone formation assay. In clone formation assay, the treated cells were first added to 6-well plates at 1000 / well, and the cells were observed and the medium was changed every 5 days. After 12 days, the cells were fixed, stained, photographed and counted.

[0064] 1.10 Migration and invasion assay

[0065] Transwell and scratch assays were used to detect the migration ability of cells. 4*104 cells were added to the upper chamber, and 500ml serum-free medium was added to the lower chamber. For the scratch assay, the cells were streaked after each well was fully grown, then washed twice with PBS and replaced with serum-free medium, and photographed at 0h, 24h, and 48h. For the invasion assay, 50ul of diluted matrix gel (Corning, USA) was added to the upper chamber of the chamber 1h in advance and placed in the incubator, 6*104 cells were added to the upper chamber, and 500ml serum-free medium was added to the lower chamber. Transwell assays were fixed, stained, and photographed after 36h.

[0066] 1.11 Bioinformatics prediction

[0067] In order to find circRNAs associated with extracellular vesicles, we intersected the top 20 differentially expressed circRNAs with the expression folds obtained from the whole transcriptome sequencing of CRC tissues with the highly expressed circRNAs in the CRC serum extracellular vesicle database exoRBase. We used circBank, StarBase and Circular RNA Interactome with CRC tissue sequencing data to predict potential target miRNAs of Circ2977. It is worth mentioning that when predicting possible target molecules, we always selected the intersection of 2-3 data sets for subsequent verification.

[0068] 1.12 Statistical analysis

[0069] All experiments were repeated at least three times, and all results were expressed as mean ± standard deviation (SD). GraphPad Prism 9.5 was used for statistical analysis and graph generation. The differences between the two groups were analyzed using a two-tailed Student's t test, and * / P<0.05, ** / P<0.01, *** / P<0.001, **** / P<0.0001 were considered statistically significant.

[0070] 2 Experimental results and analysis

[0071] 2.1 Screening and identification of Circ2977 as a highly expressed circRNA in CRC and extracellular vesicles

[0072] In order to understand the expression profile of circRNA in CRC, six pairs of whole transcriptome sequencing libraries of CRC tissues and adjacent tissues were constructed by RNA-seq. Hierarchical clustering showed that there were differences in the expression profiles of CcircRNA between the two groups ( Figure 1 A). With fold change>2.0 and P<0.05 as the cutoff criteria, there were 40 up-regulated CircRNAs and 533 down-regulated CircRNAs among the differentially expressed CircRNAs ( Figure 1 B). GO functional annotation showed that the differentially expressed genes were enriched in those related to the extracellular vesicle composition of CRC ( Figure 1 C). In order to find CircRNAs associated with extracellular vesicles, we intersected the top 20 upregulated differentially expressed genes obtained by sequencing with the highly expressed CircRNAs in the CRC serum extracellular vesicle database exoRBase, among which only Circ2977 was highly expressed in extracellular vesicles ( Figure 1D). To verify the expression of Circ2977 in CRC extracellular vesicles, we first isolated and identified extracellular vesicles. Extracellular vesicles from SW480 cells and Caco2 cells were isolated by differential centrifugation and subjected to TEM and Nano flow cytometry experiments. The results showed that the extracellular vesicles were approximately 40-140 nm in size, spherical in shape, and had a typical cup-shaped structure ( Figure 1 E, F). In addition, Western blotting and nano flow cytometry were used to detect biomarkers of extracellular vesicles (CD63, CD9, CD81, Alix, CANX) ( Figure 1 G, H). Subsequently, we extracted RNA from extracellular vesicles to verify the expression of this gene and found that Circ2977 was indeed highly expressed in extracellular vesicles, so we chose Circ2977 for subsequent research ( Figure 1 I). Dil-labeled extracellular vesicles from SW480 cells were added to HUVECs for incubation. Laser confocal imaging showed that dense extracellular vesicle particles (red) were observed in HUVECs, indicating that extracellular vesicles containing Circ2977 can be internalized into HUVECs ( Figure 1 J).

[0073] 2.2 Identification of the Circular Characteristics of Circ2977 and Its Clinical Application Value

[0074] Before further exploring whether Circ2977 can be used as a valuable clinical serological marker, we first studied the characteristics of Circ2977. Circ2977 is formed by cleavage of CDC42 located at chr1:22404921-22413359. According to the annotations of NCBI (https: / / www.ncbi.nlm.nih.gov / ) and circBase database (http: / / www.circbase.org / ), it eventually forms a 536nt circular transcript. The Circ2977 cleavage process model is shown in ( Figure 2 To verify the closed-loop structure of Circ2977, we designed convergent and divergent primers for Circ2977 and the corresponding CDC42 linear transcript. Circ2977 was amplified using divergent primers and confirmed by Sanger sequencing ( Figure 2 A, B). The sequence is consistent with RNAseq and circBase database annotations. In SW480 cells, Circ2977 can only be amplified from cDNA but not from gDNA ( Figure 2 B). In addition, Circ2977 was more stable than linear CDC42 in SW480 and Caco2 cells treated with RNase R and actinomycin D (a transcription inhibitor) ( Figure 2C, D). Next, we collected serum samples from clinical CRC patients and normal subjects, and detected the expression of Circ2977 by qRT-PCR. The results showed that Circ2977 was significantly highly expressed in the serum of CRC patients, and was higher than that of the polyp patient group. The ROC curve of Circ2977 expression drawn based on this was AUC of 0.8067, p<0.0001 ( Figure 2 E). This suggests that Circ2977 has good sensitivity and specificity to distinguish CRC patients from healthy people. In addition, high expression of Circ2977 in the serum of CRC patients is associated with tumor differentiation status, intestinal wall infiltration depth, lymph node metastasis and distant metastasis ( Figure 2 At the same time, Circ2977 has a strong correlation with the angiogenic factor VEGFA detected in the serum of clinical patients ( Figure 2 I). The diagnostic sensitivity and specificity of the ROC curve of combined use with CEA are better than those of CEA alone ( Figure 2 J). In the sequencing data of cancer tissues and adjacent normal tissues of 6 patients with metastatic colorectal cancer, Circ2977 was highly expressed in CRC tissues ( Figure 2 K). qRT-PCR experiments also verified that Circ2977 was highly expressed in CRC cell lines ( Figure 2 L).

[0075] 2.3 In vitro study of the effects of Circ2977 on cell proliferation, apoptosis, migration, and invasion

[0076] To explore the function of Circ2977 in CRC cells, we designed two siRNAs targeting the cleavage region. Then, loss-of-function assays were performed in SW480 and Caco2 cells, where Circ2977 is relatively highly expressed. After transfection with these two siRNAs, the expression of Circ2977 in both cell lines was significantly reduced by siRNA#1 ( Figure 3 A). CCK-8 assay showed that downregulation of Circ2977 inhibited the proliferation of SW480 and Caco2 cells ( Figure 3 B). Cloning experiments showed that downregulation of Circ2977 inhibited the stemness of SW480 and Caco2 cells ( Figure 3 C). Flow cytometry Annexin and PI double staining results showed that downregulation of Circ2977 significantly enhanced cell apoptosis ( Figure 3 D). Subsequently, the migration and invasion abilities of cells after siRNA transfection were detected by Transwell assay and wound healing assay. The results showed that after knocking down the expression of Circ2977, the migration and invasion abilities of SW480 and Caco2 cells were significantly inhibited ( Figure 3E, F). The above results indicate that Circ2977 contributes to the proliferation, migration, and invasion of CRC cells in vitro and inhibits CRC cell apoptosis.

[0077] 2.4Circ2977 promotes tumor growth and angiogenesis in vivo by inhibiting miR-874-3p

[0078] To investigate the effects of Circ2977 and miR-874-3p on tumor growth and angiogenesis in vivo, SW480 cells treated with Circ2977 knockdown and inhibitor of miR-874-3p expression (Antagomir) and negative control cells were injected into the axilla of 4-5 week-old female nude mice ( Figure 4 A). After 25 days of observation, the results showed that the Circ2977 knockdown group reduced the volume and weight of the tumor, while the addition of miR-874-3p inhibitor could partially reverse this effect ( Figure 4 BD). In addition, we used paraffin sections of nude mouse subcutaneous tumors for immunohistochemical staining to evaluate the expression levels of Ki-67, CD31, PAS+ / CD31-, VEGFA, VEGFR1, and SOX2 in tumor tissues. The results showed that in tumor tissues where Circ2977 was knocked down, Ki-67, a cell proliferation marker, CD31, angiogenesis-related molecule (brown structure indicated by black arrows), and PAS, a common marker for vascular mimicry, were significantly upregulated. + / CD31 - The expression of Circ2977 (the purple-red tubular structure indicated by the black arrow) decreased, while the addition of miR-874-3p inhibitor to tumor tissue promoted tumor growth and angiogenesis, and could partially rescue the inhibitory effect of knocking down Circ2977 ( Figure 4 E). The immunohistochemistry results of VEGFA and SOX2 showed that knocking down Circ2977 inhibited the expression of VEGFA, SOX2 and VEGFA receptor VEGFR1, while the addition of miR-874-3p inhibitor could partially reverse this effect ( Figure 4 F). Therefore, we can conclude that Circ2977 can promote the growth and angiogenesis of CRC in vivo through miR-874-3p.

Claims

1. Use of a reagent for detecting biomarkers in a sample in the preparation of a product for diagnosing colorectal cancer, characterized in that: The biomarker is Circ2977.

2. The use according to claim 1, characterized in that: Compared with normal controls, the expression level of Circ2977 was upregulated in patients.

3. The use according to claim 2, characterized in that: The content of Circ2977 in the patient's test sample is obtained by total RNA extraction, reverse transcription, and quantitative PCR; the test sample is preferably a colorectal cancer tissue or cell or extracellular vesicle or serum sample.

4. Application of Circ2977 expression inhibitors in the preparation of drugs for the prevention and treatment of colorectal cancer.

5. The use according to claim 4, characterized in that: The Circ2977 expression inhibitor includes siRNA.

6. The use according to claim 5, characterized in that: The sequence of the siRNA is: Sense strand sequence: 5'-GUUCUGCACUUACACAGGU-3', Antisense strand sequence: 5'-ACCUGUGUAAGUGCAGAAC-3'.

7. Application of Circ2977 as a target in screening drugs for the treatment of colorectal cancer.

8. The use according to claim 7, characterized in that: The drug inhibits the expression of Circ2977.

9. The use according to any one of claims 1 to 8, characterized in that: The transcribed nucleotide sequence of Circ2977 is shown in SEQ ID NO.

1.

10. The use according to any one of claims 4 to 8, characterized in that: Circ2977 regulates the expression of VEGFA / SOX2 by adsorbing miR-874-3p, promoting CRC cell proliferation, migration and invasion, and angiogenesis.

Images