SNP (Single Nucleotide Polymorphism) marker combination associated with anti-flow character of large yellow croaker and application

Abstract

The invention provides a larimichthys crocea anti-flow character associated SNP marker combination and breeding application, the combination is prepared from a probe of 13 SNP molecular marker combinations for detecting larimichthys crocea muscle elasticity characters, and information of positions, alleles with changed sites and reference genes of all SNP molecular markers on chromosomes is shown in a table 1. According to the SNP marker combination disclosed by the invention, the optimal larimichthys crocea individuals with the anti-flow potential and a certain scale can be selected from the breeding offspring in advance for breeding and breed conservation, and the larimichthys crocea individuals are bred to the parent without breeding and breed conservation of a large number of offspring seeds in the breeding process, so that the breeding cost can be greatly reduced. By utilizing the SNP marker combination, the problem that non-lethal detection of the muscle elasticity of the large yellow croaker cannot be realized in a traditional breeding mode can be solved, and smooth development of anti-flow character breeding work of the large yellow croaker can be ensured.

Description

Technical Field

[0001] The present invention belongs to the field of fish genetic breeding, relates to the technical field of fish molecular marker-assisted breeding, and specifically relates to a SNP marker combination associated with the flow resistance trait of large yellow croaker and its breeding application. Background Art

[0002] Yellow croaker is currently the largest-scale marine cage-cultured fish in China, with an annual aquaculture output of over 280,000 tons. With the breakthrough in artificial breeding technology of yellow croaker, research on genetic breeding of yellow croaker has also been gradually carried out. So far, four new varieties of yellow croaker, namely "Minyou No. 1", "Donghai No. 1", "Yongdai No. 1" and "Fufa No. 1", have been bred one after another. However, the existing new varieties of yellow croaker still cannot meet the current development needs of deep-sea aquaculture industry, which seriously restricts the high-quality development of the current deep-sea aquaculture industry of yellow croaker. Promoting the development of deep-sea aquaculture industry of yellow croaker is an effective way to improve the quality and efficiency of yellow croaker aquaculture and industrial transformation and upgrading. It is also an important strategic measure to implement the concept of big food, demand food from rivers, lakes and seas, and promote the development of my country's deep-blue fishery. "New varieties of deep-sea aquaculture fish" has now been included in the "Major Technical Demands for the Development of Agricultural and Rural Industries in 2022". Therefore, in order to meet the development needs of deep-sea aquaculture of yellow croaker, it is necessary to cultivate new varieties of yellow croaker that are suitable for deep-sea aquaculture to promote the high-quality development of deep-sea aquaculture industry of yellow croaker in my country.

[0003] Deep-sea aquaculture is an emerging aquaculture method. Its aquaculture area is generally in the deep-sea waters 3km offshore and more than 10m deep, with good water exchange, large aquaculture area and wide space for fish activities. The strength of the large yellow croaker's ability to resist current is an important indicator for judging whether it can be aquacultured in the deep sea. Since the detection of traditional resistance to current can cause damage to the fish body surface, and in severe cases, it can cause the death of the fish, traditional detection methods cannot be used to screen the breeding population, and the breeding of large yellow croaker with strong resistance to current must be carried out from the genotype level. However, the breeding cost is too high based on the whole genome selection method, so the technical route of using molecular markers to assist breeding is more feasible. As we all know, the change of phenotypic traits is the result of the dual influence of environment and genes. Therefore, it is necessary to select large yellow croaker with strong resistance to current under the same aquaculture mode (same environmental factors), and by analyzing its genotype, determine the SNP marker combination associated with the resistance to current of large yellow croaker, and then carry out the breeding of large yellow croaker with strong resistance to current through molecular marker-assisted technology. In view of this, a molecular marker-assisted breeding technology for improving the resistance to current of large yellow croaker is needed. Summary of the invention

[0004] In response to the above technical problems, the present invention provides a SNP marker combination associated with the flow resistance trait of large yellow croaker and a corresponding breeding application, which can achieve low-cost and efficient genetic improvement of the flow resistance trait of large yellow croaker, and can be used for genotype identification, flow resistance trait association analysis and genomic selection breeding of large yellow croaker breeding populations.

[0005] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0006] In a first aspect, the present invention provides a combination of SNP markers associated with the flow resistance trait of large yellow croaker, which is based on whole genome resequencing of flow-resistant and non-flow-resistant large yellow croaker populations and uses whole genome association analysis ( Figure 1 The 16 SNP markers were screened by Manhattan plot, and the nucleotide sequences of these SNP markers are shown in Table 1.

[0007] Table 1 Nucleotide sequences where SNP markers are located

[0008]

[0009] The specific meanings of the English headers in Table 1 above are as follows: Mark represents the number of the single nucleotide polymorphism marker; Chr (chromosome) represents the chromosome number; Position represents the physical position of the SNP marker on the chromosome; REF represents the reference allele of the SNP site; ALT represents the altered allele of the SNP site; P represents the significant value of the SNP marker in the whole genome association analysis. MAF represents the frequency of the minor allele, and MarkerR2, that is, the phenotypic explanation rate PVE, represents the proportion of phenotypic differences explained by each SNP marker.

[0010] The sequences of 50 bp before and after the 16 sites on the genome are as follows, where the SNP sites are in brackets.

[0011] (1)LG2_15637606

[0012] GCTGCTGCTGCTGCTGCCACTGGTCACAATGCATGTTTTGCAACTCATTT(A / C)AT ACAGATGTTTTTAAAAAGAAAAAGAAAAACACACCAAAACTCGGGACA(SEQ ID NO.1);

[0013] (2)LG4_11158806

[0014] AAAAAAGCCATAAGGATTGTAATAATGTAGGTTTTTCACAAACACGC(C / T)A ACACAATAAAGTTGGTGAATCTTGTAGAATAGAGCACAGCACAAATAAT(SEQ ID NO.2);

[0015] (3)LG4_16110143

[0016] GAATCCCAACAGAAAGCAATGTTACCTTAAGTATAATGCGTTTGGTAGCC(C / T)AC TAGGTTGCCAACCCCGCAATTTAGTTCTTTGCAGCTTTTTATTCATGG(SEQ ID NO.3);

[0017] (4)LG4_17909643

[0018] TGTATGAGGTGGAACAGAGGGAGACCACAGCTCTCCAAAAACTCTACTGT(A / G)GGCCAGGACACACTGTGCAATTCAGATAAGTCACTGATAACTACTCAGAG(SEQ ID NO.4);

[0019] (5)LG5_8367699

[0020] TCAAATGTGAGCACAAATTACCAGTTAGTACACCACTCTTTGCCAACATT(C / T)TT TTATTTTGGTTTTTTTTTCTGTCTTTTCCCCAGTGGTCTTCCAGCT(SEQ ID NO.5);

[0021] (6)LG5_16555811

[0022] TTCTTTGCTTAAAGAGCCTGAGCGGGGCAGGAGGCTTTGGTTGATGTTTC(A / G)T ATGAATAGAATTCCAGAACAGAAATAATCTATTTTTTTTTGGGT(SEQ ID NO.6);

[0023] (7)LG7_14490445

[0024] TTTGCCGGTTATGGCCTCTTAAAGGTCCAGTGTGTACGATTTCAGGGGCT(C / A)TG TTTACAGAACATGACAGGAATGGAACATAACCTGTATAGATATTTATC(SEQ ID NO.7);

[0025] (8)LG8_27200376

[0026] TAGTATTTCTACCACAATTCATATTCAAGAGATTTTCAGAGACCCGTCAA(G / A)GT TTAAATAAATAGCTTCTTACTTTAGGCTTGAAGAGAGACAGGAAGGAT(SEQ ID NO.8);

[0027] (9)LG8_27667693

[0028] CACAACTAAAGAAAGAGTTGATCCTATGAAACGCCAAGCTTTTTGAGCTG(T / C)G GCATGGAAAATGGCACTGATATGCAACGAGTGGAGTTTGTGTCACTGCT(SEQ ID NO.9);

[0029] (10)LG8_27759293

[0030] TGTCGAACGCCGCGATGAGAAAAAAAAAGCCGGCTGTGTTCTCGCTGTCG(T / C)CGTACAATAACAGGTGTGTGCACAGGTGCGTGTACGTGTGTGCTGATTAG(SEQ ID NO.10);

[0031] (11)LG12_3539141

[0032] ATATATTTTTTTTACGAGCATGTGTGTAATCTCAGCGGACAGGTGTGAAA(G / A)GG ATGCTTGTAGATGATGATGTTGTTTGACAAGATGCAACAGCGAATTTA(SEQ ID NO.11);

[0033] (12)LG12_11690127

[0034] TCTTGGTCTGTGCTTGTTAAAATCATAAGACTCAGCCCCCCTCTTATGAT(G / A)AAATTCAATAAAAATATCTGATTAATGCAAAAGCACAATGTTAAATATGC (SEQ ID NO. 12);

[0035] (13)LG19_28477706

[0036] GTCACAGAGTCCCATCAGGTATGATTTTTGTGCCGTTCGTGAGCTTAAAT(G / C)TA CCAACTTTACTTTGCTTAAGAAGAACTCTGACCTGTTTGCACCGCAGG(SEQ ID NO.13);

[0037] (14)LG22_20801417

[0038] CTCATCAACATGCATGACTGCTCAGCCCTGTGTGTGTCTGTGTGTGTGTG(C / T)GC ACTGTATTGTGTTTAGTATAACATGGTTTTGTCTTGTGCTGGTGGACT (SEQ ID NO. 14);

[0039] (15)LG24_14857586

[0040] AGTTGAACTGTGGTTGTTTCATGTATCTGGGTTGCCTGCGTCGCTTGGGA(A / G)A AATGACAAAGCAAAGATAAAATGATCCCAGCACTTATCAAATACTGCGC (SEQ ID NO. 15);

[0041] (16)LG24_15510376

[0042] TTGCTGTATGCCTACATATATATCTGCGATCTCGCACGGCACAAAGTCAC(A / G)CA CCACTGAGTATTTCACAGATTTTGGGGATACTGGATCATATTTTATGA (SEQ ID NO. 16).

[0043] In a second aspect, the present invention provides a chip loaded with the above-mentioned SNP marker group associated with the flow resistance trait of large yellow croaker.

[0044] Preferably, the chip is a solid-state chip or a liquid-phase chip.

[0045] The third aspect of the present invention provides the use of the above-mentioned SNP marker combination or chip associated with the flow resistance trait of large yellow croaker in the identification of the flow resistance trait genotype or the flow resistance trait breeding of large yellow croaker.

[0046] A fourth aspect of the present invention provides a method for breeding large yellow croaker for flow resistance traits, comprising the following steps:

[0047] (1) Collect and keep alive the basic population of large yellow croaker for breeding, and cultivate it to parents as candidate parents, with a female-to-male ratio of 3:1;

[0048] (2) Using a non-lethal sampling method, collect fin ray samples from the dorsal fin of large yellow croaker parents, store them in anhydrous ethanol, and replace the anhydrous ethanol every 12 hours within 24 hours;

[0049] (3) extracting DNA from parental fin samples, performing genotyping on the above-mentioned SNP markers, and ensuring that the genotyping of all SNP markers is successful;

[0050] (4) Based on the genotyping results, the Bayes Lasso model was used to calculate the breeding value GEBV of parental individuals using the R language package BGLR;

[0051] (5) The parent individuals of large yellow croaker were ranked according to their GEBV levels, and the top 10% of the individuals were selected as breeding parents for artificial breeding. The male-female ratio was controlled at 3:1, and the offspring obtained were the new germplasm of large yellow croaker that was resistant to flow.

[0052] The research results show that the proportion of the flow-resistant population of large yellow croaker bred using the present invention increased from 64% to 88%.

[0053] Therefore, the fifth aspect of the present invention also provides the application of the above-mentioned SNP marker combination associated with the flow resistance trait of large yellow croaker in the genetic improvement of flow resistance.

[0054] Functions and Effects of the Invention

[0055] (1) The 16 SNP marker combinations of the present invention can be used to quickly and accurately select large yellow croaker breeding parents with strong flow resistance, greatly improving breeding efficiency.

[0056] (2) The SNP marker combination of the present invention can be used to select the best large yellow croaker individuals of a certain size with flow resistance from the breeding offspring in advance, and then culture and preserve the seeds and cultivate them to the parents. There is no need to culture and preserve a large number of offspring seedlings during the breeding process, which can greatly reduce the breeding cost.

[0057] (3) The use of the SNP marker combination of the present invention can solve the problem that the traditional breeding method cannot realize the non-disabling (lethal) detection of the flow resistance ability of large yellow croaker, and can ensure the smooth development of the breeding work of large yellow croaker flow resistance traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Manhattan plots of genome-wide association analyses are shown;

[0059] Figure 2 The percentage of large yellow croaker resistant to current in the resistant breeding population and the non-resistant breeding population is shown (* represents P < 0.05). DETAILED DESCRIPTION

[0060] The present invention is described in detail below in conjunction with the embodiments and the accompanying drawings. However, the following embodiments should not be considered as limiting the scope of the present invention.

[0061] Example 1 Detection of SNP marker combinations in large yellow croaker populations with different flow resistance

[0062] In 2021, a genotyping experiment of different populations of yellow croaker with different resistance to flow was carried out, following the following steps:

[0063] (1) Using an anti-flow device with a flow rate of 1 m / s and anti-flow for 30 min as the screening conditions, the large yellow croaker population was divided into an anti-flow group and a non-anti-flow group, with each group containing no less than 150 fish.

[0064] (2) The genomic DNA of large yellow croaker individuals from the resistant and non-resistant populations was extracted and whole genome resequencing was performed.

[0065] (3) The genotyping success rate of the SNP markers included in the present invention is 100%.

[0066] (4) The detection of the SNP marker combination included in the present invention in large yellow croaker populations with different flow resistance abilities is shown in Table 2:

[0067] Table 2 Detection of SNP marker combinations in large yellow croaker populations with different flow resistance

[0068]

[0069]

[0070] Example 2 Cultivation of new germplasm of anti-flow large yellow croaker

[0071] In 2022, the present invention was used to carry out the breeding of large yellow croaker with strong anti-flow ability, and a new F1 generation of large yellow croaker germplasm with strong anti-flow ability was cultivated. The specific steps are as follows:

[0072] (1) More than 600 large yellow croaker parents were selected from the breeding base population as candidate parents, with a male-female ratio of 3:1.

[0073] (2) Collect fin ray samples from the posterior end of the dorsal fin of candidate large yellow croaker parents, store them in anhydrous ethanol, and replace the anhydrous ethanol every 12 hours within 24 hours.

[0074] (3) Extract genomic DNA from samples and perform genotyping using SNP liquid phase breeding chips.

[0075] (4) The genotyping success rate of the SNP marker combination of the present invention is 100%.

[0076] (5) The Bayes Lasso model was used to calculate the breeding value (GEBV) of the parent individuals using the R language package BGLR. The GEBV of the candidate parent individuals was calculated (the smaller the value, the stronger the resistance to flow). The males and females were ranked according to their height, and the top 10% of the individuals were selected as the breeding parent group, with a male-female ratio of 3:1 (see Table 3):

[0077] Table 3 Breeding values ​​of breeding parents

[0078]

[0079]

[0080] (6) In April 2022, about 480,000 new F1 generation yellow croaker germplasm seedlings with strong flow resistance were obtained through artificial induction of spawning.

[0081] (7) From June 2022 to May 2024, the traits of the fry, young fish and broodstock of the anti-current F1 generation of large yellow croaker were evaluated (more than 200 fish). Among them, the proportion of the anti-current population in the large yellow croaker anti-current breeding system increased from 38% to 50% (P < 0.05) for fry (average weight 2.03g) at a flow rate of 0.15m / s; the proportion of the anti-current population of large yellow croaker (average weight 38g) at a flow rate of 0.5m / s increased from 30% to 38% (P < 0.05); the proportion of the anti-current population of large yellow croaker (average weight 575g) at a flow rate of 1m / s increased from 64% to 88% (P < 0.05), and the breeding effect was significant ( Figure 2 ).

[0082] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. The present invention may be subject to various changes and improvements without departing from the spirit and scope of the present invention. These changes and improvements fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A SNP marker combination associated with flow resistance of large yellow croaker, characterized in that: The probes were prepared from the combination of 16 SNP molecular markers for detecting the flow resistance of large yellow croaker. The location of each SNP molecular marker on the chromosome, the allele of the site change, and the reference gene information are shown in the following table:

2. A chip loaded with the SNP marker combination associated with the flow resistance trait of large yellow croaker according to claim 1.

3. The chip according to claim 2, characterized in that: The chip is a solid-state chip or a liquid-phase chip.

4. Use of the SNP marker combination associated with the flow resistance trait of large yellow croaker according to claim 1 in the genotype identification of the flow resistance trait of large yellow croaker or the breeding of the flow resistance trait.

5. A method for breeding large yellow croaker for flow resistance, characterized in that: The method is carried out using the SNP marker combination according to claim 1, comprising the following steps: (1) Collecting and keeping alive the basic population of large yellow croaker for breeding, and cultivating it to parents as candidate parents; (2) Samples were collected using a non-lethal sampling method and stored in anhydrous ethanol, with the anhydrous ethanol replaced every 12 hours within 24 hours; (3) extracting DNA from parental samples, performing genotyping on the above-mentioned SNP markers, and ensuring that the genotyping of all SNP markers is successful; (4) Calculate the breeding value GEBV of the parent individuals based on the genotyping results; (5) The parent individuals of large yellow croaker were ranked according to their GEBV levels, and the individuals with the highest ranking were selected as breeding parents for artificial breeding. The male-female ratio was controlled at 3:1, and the offspring obtained were the new germplasm of large yellow croaker that was resistant to flow.

6. The method for breeding large yellow croaker for flow resistance according to claim 5, characterized in that: In step (1), the male-female ratio of the candidate parents is 3:1; In step (2), a non-lethal sampling method is used to collect a fin ray sample from the end of the dorsal fin of the large yellow croaker parent; In step (3), DNA is extracted from the parental fin ray sample; In step (4), the Bayes Lasso model is used to calculate the breeding value GEBV of parent individuals using the R language package BGLR.

7. The method for breeding large yellow croaker for flow resistance according to claim 5, characterized in that: in, Males and females were ranked according to GEBV, and the top 10% of the individuals were selected as the breeding parent group, with a male-female ratio of 3:

1.

8. Use of the SNP marker combination associated with the flow resistance trait of large yellow croaker according to claim 1 in genetic improvement of flow resistance.

Images