Application of reagent for inhibiting expression of EhAQP1, EhPTP2 and EhMetAP2 genes in preparation of medicine for preventing and / or treating shrimp enterocytozoonosis hepatopenaei

Abstract

The invention provides application of a reagent for inhibiting expression of EhAQP1, EhPTP2 and EhMetAP2 genes in preparation of a medicine for preventing and / or treating shrimp enterocytozoonosis hepatopenaei, and particularly belongs to the technical field of shrimp culture. The invention provides an application of a reagent for inhibiting expression of EhAQP1, EhPTP2 and EhMetAP2 genes in preparation of a medicine for preventing and / or treating enterocytozoonosis hepatopenaei of shrimps. By inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes, the number of spores of enterocytozoon hepatopenaei can be reduced, and the prevention and treatment of enterocytozoon hepatopenaei diseases can be realized.

Description

Technical Field

[0001] The invention belongs to the technical field of shrimp breeding, and particularly relates to application of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in preparing a medicine for preventing and / or treating shrimp hepatoenterozoan disease. Background Art

[0002] Ecytonucleospora hepatopenaei (EHP) is a typical single-cell eukaryotic organism that is an obligate intracellular parasite. It mainly infects the hepatic tubular epithelial cells of the hepatopancreas of shrimp. It grabs nutrients from shrimp to ensure its own energy metabolism and growth and reproduction, causing shrimp immune and metabolic disorders, and ultimately causing slow growth and a serious decline in aquaculture production of farmed shrimp. Hepatopancreatic microsporidiosis (HPM), or shrimp hepatopancreatic microsporidiosis, caused by this pathogen is one of the important pathogens that have endangered the development of shrimp aquaculture in recent years. At present, there is no obvious and effective treatment for EHP infection. In the aquaculture process, the risk of infection is mainly reduced by strengthening seed quarantine and the management of aquaculture inputs and the environment. Shrimp are invertebrates that lack a specific immune system and lack theoretical support for the development of conventional vaccines. Therefore, it is very difficult to prevent and control EHP in the shrimp aquaculture process. EHP has the ability to spread vertically and horizontally, and its dormant spores can withstand adverse environmental conditions and infect farmed shrimp again when the time is right. Therefore, it is difficult to completely eliminate it from the breeding system during the breeding process. The development of EHP prevention and control products is imperative and of great significance to the development of the industry. Summary of the invention

[0003] The object of the present invention is to provide an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes for use in the preparation of a drug for preventing and / or treating shrimp hepatoenteric cytosis. By inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes, the number of shrimp hepatoenteric cytosis spores can be reduced, thereby achieving the prevention and treatment of shrimp hepatoenteric cytosis.

[0004] The invention provides application of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in preparing a medicine for preventing and / or treating shrimp hepatoenteric cytosis.

[0005] The invention also provides the use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a medicine for reducing the number of shrimp hepatocystis spores.

[0006] Preferably, the agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in shrimp hepatocellular carcinoma.

[0007] Preferably, the shrimp comprises prawns; and the prawns comprise Penaeus vannamei.

[0008] Preferably, the agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes comprises an RNAi agent.

[0009] Preferably, the RNAi agent comprises siRNA; the siRNA comprises siRNA interfering with the expression of EhAQP1, siRNA interfering with the expression of EhPTP2 and siRNA interfering with the expression of EhMetAP2.

[0010] Preferably, the siRNA interfering with the expression of EhAQP1 comprises a sense chain primer having a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer having a nucleotide sequence as shown in SEQ ID NO.2; the siRNA interfering with the expression of EhPTP2 comprises a sense chain primer having a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer having a nucleotide sequence as shown in SEQ ID NO.4; the siRNA interfering with the expression of EhMetAP2 comprises a sense chain primer having a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer having a nucleotide sequence as shown in SEQ ID NO.6.

[0011] The present invention also provides a siRNA for preventing and / or treating shrimp hepatoenteric cytosis, wherein the siRNA comprises siRNA interfering with the expression of EhAQP1, siRNA interfering with the expression of EhPTP2 and siRNA interfering with the expression of EhMetAP2.

[0012] Preferably, the siRNA interfering with the expression of EhAQP1 comprises a sense chain primer having a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer having a nucleotide sequence as shown in SEQ ID NO.2; the siRNA interfering with the expression of EhPTP2 comprises a sense chain primer having a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer having a nucleotide sequence as shown in SEQ ID NO.4; the siRNA interfering with the expression of EhMetAP2 comprises a sense chain primer having a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer having a nucleotide sequence as shown in SEQ ID NO.6.

[0013] Preferably, the shrimp comprises prawns; and the prawns comprise Penaeus vannamei.

[0014] The present invention provides the use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a drug for preventing and / or treating shrimp hepatoenteric cytosis. By inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes, the number of shrimp hepatoenteric cytosis spores can be reduced, thereby achieving the prevention and treatment of shrimp hepatoenteric cytosis. The test results show that the present invention uses RNA interference to silence the EhAQP1, EhPTP2 and EhMetAP2 genes in shrimp hepatoenteric cytosis, which can reduce the spore load in different time periods and achieve the prevention and treatment of shrimp hepatoenteric cytosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0016] Figure 1 This is a graph showing the verification results of the expression levels of EhAQP1, EhPTP2, and EhMetAP2 provided by the present invention;

[0017] Figure 2 A spore counting result diagram provided by the present invention;

[0018] Figure 3 This is a graph showing the absolute quantitative results of spores provided by the present invention. DETAILED DESCRIPTION

[0019] The present invention provides the use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a drug for preventing and / or treating shrimp hepatoenteric cytosis. In a specific embodiment, the agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes an agent for inhibiting the expression of shrimp hepatoenteric cytosis EhAQP1, EhPTP2 and EhMetAP2 genes in shrimp. In a specific embodiment, the shrimp includes prawns; the prawns include white shrimp. The present invention discovered the virulence genes EhAQP1, EhPTP2 and EhMetAP2 genes that play a role in EHP infection, isolated and purified EHP spores from infected shrimps, and performed whole genome sequencing, and successfully annotated EhAQP1, EhPTP2 and EhMetAP2 in the EHP genome. By inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes, the prevention and treatment of shrimp hepatoenteric cytosis can be achieved.

[0020] The nucleotide sequence of EhAQP1 is shown in SEQ ID NO.7: ATGCAAGTCAGTAAAAAATTAATAGCACAGAGAGTCTTTGCTGAATTTTTATGCTCATGTATTTTTGGGTTTGCTGTCTACTCTGCCATTTTAAACACTAAATCTGAAGAAGTTTCTGTTTCAGGCACTACTGTTGGACTTACCGTTGGTTTTTCTGGGATAGCCCTCATATATACCTTTGCAGACCACTCGGTTGCACATTTCAACCCTGCCATTACCATTTCCACCATTTTGACAGGTAAAATAGAAATAGCCATGGGCATTTGCTATGTATGTGCACAGCTGATAGGATTTTTGGTTGCTAGTCTTTTGGTGGTTGTTTGCTTTCCTTACGGGTATTCTGAGACACTTGAGCTTATTACGCCTGCTAAAGTTACAGAGGATTTGTCGACAACAAGTTTGTTTTTTACTGAATTTATTTTAAGCTTCATTTTGGTGTTTGTTGCGTTTGAGGTTGGAATTAACGCTGTTAGAGAGCCTGGGGTTACTTTGTTTATTGGCGAACCACAAAAAGACAGGTCAATATTGGCACCTCTTACCATAGGATTGACTTTAGGCTTTTTAGGATTTTTGGCTTCAACCACATCCGGTGGTGCTTTCAACCCTGGAATAGTATTTGGACCTGCTATTTTAGGGTCTAATTATAGTGATTTTTGGGTTTACATTGTAAGTGAGTTATCAGGGGGTCTTTTAGGTGCATTAGTTCAAGTATTTTTGTTGTTTAAATAA。

[0021] The nucleotide sequence of EhPTP2 is shown in SEQ ID NO.8: ATGAGTCTTTATAATGCACTGGTGCTATTAACTACTATAAAAGCAGGAACAGTAAACATGCCTTTGCCTGGACAAGGACAAAACAATGCGCAACAAGATCCAATTGCAAGACACATTCAGGACATGAAGGTGGAAACAGAAGAAGCAAAAAGAAGGGCTGCAGCAGAATGCCAGCAGAGCCTCATAGAGAAAAACGTACAGGTAGATGGTGCACAACAAAAAGTAGATCCTTCTGAGTTTACTGCGTGTGTTGAAGCAAAAAAGAAGAAATTATTCCAGTTGTCAAAGTCAATCAATTCACTCATTAAAAATGAAATGTCAAAGCCAATTCAAAAGCCATGCGTGGTCAAATTAAACCAGGCAACCAAAAACTGCTACACAAAGGCAGCACTCAAGGAATGGCTCAAGGGTTCAAAATACAGTTTGGATGTGTTTAAGAACGTAGTTGAAATATGGAACACAGAAAAAGAAAAGTTGATAGCAATGATTGTTCATGAAACACCAAAGTACGAGTTAATTTTACCACCAAAAGTATGCAAGTCTTTCTTTAAAAGACCTTCATATAAGATGGACGTAAACAGGGCAGGAGATATGATCAATTCACAGGGTAAGCCTAACGAAAAGAAGGACATTGCAAAGGATTGCAGGCCATGCAGCGACTTTGCTAACACCACAGAAGGTGCATTTGCAGAGTGCAAGAACACATGCGATCCAATGTCTATGATTGTCAATGTTAGCGATAGCATCCACACAGTACACAGGCCAACCACCTTACCATCTGGTAAAGATGACCATAAAAAGCCAACTCCATCTGAAAGTGAAATAAACAATGAAACATTAACATCCAACGAATAA。

[0022]

[0023] The present invention also provides the use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a drug for reducing the number of shrimp hepatocystis spores. By inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes, the number of shrimp hepatocystis spores can be reduced. In a specific embodiment, the agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes an agent for inhibiting the expression of shrimp hepatocystis EhAQP1, EhPTP2 and EhMetAP2 genes in shrimp. In a specific embodiment, the shrimp includes prawns; the prawns include Penaeus vannamei.

[0024] In a specific embodiment, the reagent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes an RNAi reagent. In a specific embodiment, the RNAi reagent includes siRNA; the siRNA includes siRNA that interferes with the expression of EhAQP1, siRNA that interferes with the expression of EhPTP2 and siRNA that interferes with the expression of EhMetAP2. In a specific embodiment, the siRNA that interferes with the expression of EhAQP1 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.2; the siRNA that interferes with the expression of EhPTP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.4; the siRNA that interferes with the expression of EhMetAP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0025] The present invention also provides an siRNA for preventing and / or treating shrimp hepatoenteric cytosis, wherein the siRNA includes siRNA interfering with the expression of EhAQP1, siRNA interfering with the expression of EhPTP2, and siRNA interfering with the expression of EhMetAP2. The test results show that the present invention can reduce the expression of the interfering genes (EhAQP1, EhPTP2, EhMetAP2) and the spore load of shrimps that were originally severely infected with EHP in a specific time period by injecting siRNA to interfere with EHP infection / EHP physiological activities, thereby achieving the prevention and treatment of shrimp hepatoenteric cytosis. In a specific embodiment, the siRNA interfering with the expression of EhAQP1 includes a sense strand primer having a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand primer having a nucleotide sequence as shown in SEQ ID NO.2; the siRNA interfering with the expression of EhPTP2 includes a sense strand primer having a nucleotide sequence as shown in SEQ ID NO.3 and an antisense strand primer having a nucleotide sequence as shown in SEQ ID NO.4; the siRNA interfering with the expression of EhMetAP2 includes a sense strand primer having a nucleotide sequence as shown in SEQ ID NO.5 and an antisense strand primer having a nucleotide sequence as shown in SEQ ID NO.6. In a specific embodiment, the shrimp includes prawns; the prawns include Penaeus vannamei.

[0026] To further illustrate the present invention, the use of the reagent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes provided by the present invention in the preparation of a drug for preventing and / or treating shrimp hepatoenteric cytosis is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1

[0028] Experimental subjects: Penaeus vannamei seriously infected with EHP were obtained from the Lüsi Base of Jiangsu Marine Fisheries Research Institute. The mean weight of Penaeus vannamei seriously infected with EHP (n=180) was 3.2±1.8g. They were raised in a glass pond with constant aeration at an ambient temperature of 28±2℃ for 24h.

[0029] SiRNA synthesis: Bioengineering (Shanghai) Co., Ltd. The synthesized siRNA oligo was dried by centrifugation under reduced pressure, and the product was dried at the bottom of the tube in the form of dry powder. After being dissolved in DEPC water, it was prepared into a 20uM sample for subsequent experiments.

[0030] The sequences of synthesized siRNA oligos are listed in Table 1.

[0031] Table 1 Sequence information

[0032] Gene name Sequence (5′→3′) EhAQP1-siRNA Sense strand: CCAUUACCAUUUCCACCAUTT (SEQ ID NO. 1) Antisense strand: AUGGUGGAAAUGGUAAUGGTT (SEQ ID NO.2) EhPTP2-siRNA Sense strand: GCACUGGUGCUAUUAACUATT (SEQ ID NO. 3) Antisense strand: UAGUUAAUAGCACCAGUGCTT (SEQ ID NO. 4) EhMetAP2-siRNA Sense strand: GGGACUCACAGCAAUGGAATT (SEQ ID NO.5) Antisense strand: UUCCAUUGCUGUGAGUCCCTT (SEQ ID NO.6) NC-siRNA Sense strand: UUCUCCGAACGUGUCACGUTT (SEQ ID NO.10) Antisense strand: ACGUGACACGUUCGGAGAATT (SEQ ID NO.11)

[0033] Each siRNA was injected at a dose of 2 μg (2 μg / g) per gram of shrimp weight. The injection was injected into the tail muscle of shrimp severely infected with EHP. Before the injection, the hepatopancreas of 6 shrimps were randomly taken as 0h samples. After the injection, the three experimental groups and the control group (EhAQP1-siRNA, EhPTP2-siRNA, EhMetAP2-siRNA as experimental groups; NC-siRNA as control group) were sampled at 12h, 24h, 48h, and 72h. The hepatopancreas of 6 shrimps were taken as samples at each node in each group.

[0034] RNA and DNA extraction: The samples taken at each time point in each group were ground into homogenate using a biological tissue nucleic acid extraction grinder (speed 6.0 m / sec, time 35 s). The obtained homogenate was used for RNA extraction, and the rest was reserved for subsequent spore counting. According to the kit instructions, the total RNA of the hepatopancreas was extracted using the RNAEasyFast Animal Tissue / Cell Total RNA Extraction Kit (TIANGEN, DP451). The total DNA of the hepatopancreas was extracted using the Marine Animal Tissue DNA Extraction Kit (TIANGEN, DP324). The concentration and purity of the extracted RNA and DNA were evaluated by Nanodrop2000 (Thermo Fisher, USA), and their integrity was verified by 1.0% agarose gel electrophoresis. The extracted RNA and DNA were stored at -80°C.

[0035] qPCR was used to verify the expression of the interference gene, with β-tublin as the internal reference gene.

[0036] The cDNA template was synthesized using a reverse transcription kit (TIANGEN, KR118), with β-tubulin as the internal reference gene. Three biological replicates and three technical replicates were performed for each verified gene. PCR was performed in a 20 μL reaction system, containing 10 μL SYBR Green, 2 μL (10 μmol / L) primers, 2 μL cDNA template and 6 μL DEPC-treated water (negative control). The PCR program was 95°C for 3 min, followed by 40 cycles of 95°C for 10 s and 60°C for 45 s. 2 -ΔΔCt Methods The fold change of gene expression relative to the control group was calculated, and the results were expressed as mean ± standard deviation (SD). The fold difference of each target was obtained from three independent biological replicates.

[0037] Verification of EhAQP1, EhPTP2, and EhMetAP2 expression levels ( Figure 1 ).

[0038] The results of EhAQP1 interference showed that the siRNA-EhAQP1 group showed a significant gene downregulation trend between 12h and 72h ( Figure 1A in Figure 1 shows a significant difference at 12h compared with the control group (siRNA-NC) (p<0.05). In particular, at 24h, the expression level of EhAQP1 reached the lowest point, while there was no significant expression change in the control group as a whole. The siRNA-EhPTP2 group ( Figure 1 B) showed significant downregulation of expression at 24h (p<0.01), and the interference effect was most obvious at this time point compared with the control group. However, at 48h and 72h, the expression of the EhPTP2 gene seemed to gradually recover. Figure 1 C), the EhMetAP2 gene expression in the interference group showed a downward trend from 24h to 72h, and significant downregulation was observed at 24h and 72h, respectively (p<0.05 and p<0.001).

[0039] Spore counts were performed under a light microscope (hemocytometer), and spores were absolutely quantified by qPCR.

[0040] Take a sample from each group and dilute it 100 times with ultrapure water. Take 6 μL of the diluted homogenate suspension and drop it on a clean slide. Then, take 2 μL of fluorescent dye and 2 μL of 10% KOH and mix them with the homogenate suspension on the slide. Let the mixture stain for 3 minutes. Finally, drop a total volume of 10 μL of the mixed solution on a clean hemocytometer, observe and count under a fluorescence microscope. Repeat the counting 3 times and calculate the average value to ensure accuracy.

[0041] Spore count results ( Figure 2 ).

[0042] The number of spores in the three interference groups showed different degrees of reduction. In the EhAQP1 and EhMetAP2 interference groups, the number of spores showed a downward trend, with significant decreases at 72h and 48h, respectively ( Figure 2 A in Figure 2 C). The EhPTP2 interference group did not show an overall downward trend, but the number of spores at 48 h was significantly lower than that of the control group ( Figure 2 B).

[0043] Real-time quantitative PCR was used to analyze the quantification of EHP spores. The reaction mixture contained 2 μL of extracted DNA, 2× TaqMan FastAdvanced MasterMix, each specific primer (10 μmol / L), and 0.1 μM TaqMan probe. Three biological replicates and three technical replicates were performed. The reaction was performed under PCR conditions including 95°C for 20 s, followed by 50 cycles of 95°C for 1 s and 60°C for 20 s.

[0044] Table 2 Primer information

[0045] Primer name Sequence (5′→3′) β-tubulin-F GAAAGAAGTAGACGAGCAGATG(SEQ ID NO.12) β-tubulin-R TTGTGTTGCCTATGAATGTAGC(SEQ ID NO.13) SSUrRNA-F GGTGGTGTTAAAAGCCATTGAGTTT(SEQ ID NO.14) SSUrRNA-R CCCACCTATACCATGCCTCCTAT(SEQ ID NO.15) EhAQP1-qF GACAGGTCAATATTGGCAC(SEQ ID NO.16) EhAQP1-qR CCCTAAAATAGCAGGTCCA(SEQ ID NO.17) EhPTP2-qF CTCAAGGAATGGCTCAAGGGT(SEQ ID NO.18) EhPTP2-qR CCTGCCCTGTTTACGTCCAT(SEQ ID NO.19) EhMetAP2-qF TGCATTTGAAACAACCAGGC(SEQ ID NO.20) EhMetAP2-qR CTTACGCTGCAACTCTCTGT(SEQ ID NO.21)

[0046] The TaqMan probe 5′-CCGTTCCGCTACTC-3′ (SEQ ID NO. 22) was labeled with the fluorescent dye 6-FAM at the 5′ end and MGB at the 3′ end. The probe was designed based on the SSU rRNA gene of EHP and was used for absolute quantification of EHP spores.

[0047] Absolute quantification of spores ( Figure 3 )

[0048] In the EhAQP1 interference group, the copy number of EHP was lower than that of the control group from 12h to 72h, with significant differences observed at 12h and 48h, and very significant differences at 72h ( Figure 3 In the EhPTP2 interference group, a significant decrease was observed only at 48 h, while the number of spores increased sharply at 72 h compared with the control group ( Figure 3 For the EhMetAP2 interference group, intra-group comparison showed that the copy number of EHP continued to decrease; however, compared with the control group, it only showed a significant decrease at 48h ( Figure 3 C).

[0049] The present invention conducted an in-depth analysis of the transcriptome data of the EHP reflex experiment of healthy shrimp for 1 to 14 days, and found that the infection period of EHP is about 6 days, 1 to 2 days are mainly dominated by germination, and 3 to 4 days are mainly dominated by proliferation. In the experiment of the present invention, EhAQP1 and EhPTP2 mainly play a role in the germination and invasion stages of the early infection. Interfering with EhAQP1 will cause the spore load to drop significantly in the early stage. EhMetAP2 plays a key role in the subsequent proliferation stage. After interfering with EhMetAP2, the spore load will continue to drop in the later stage. Interfering with different genes will reduce the spore load in different time periods.

[0050] In summary, the present invention silenced EhAQP1, EhPTP2, and EhMetAP2 in EHP-infected shrimp by intramuscular injection of siRNA, and found that siRNA interference showed different inhibitory effects on different genes, and this effect was time-dependent; this may mainly depend on the target gene being interfered with. For EhAQP1, interference was most effective in the early stage (12h to 24h), and for EhPTP2, interference was most effective at 48h; and the interference effect of EhMetAP2 was more significant at 48h and 72h. In short, the silencing of EhAQP1, EhPTP2, and EhMetAP2 genes all led to different degrees of reduction in spore load.

[0051] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a drug for preventing and / or treating shrimp hepatoenterocystis disease.

2. Application of agents that inhibit the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of drugs that reduce the number of shrimp hepatocystis spores.

3. The use according to claim 1, characterized in that: The agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in shrimp hepatocellular carcinoma.

4. The use according to claim 3, characterized in that: The shrimp includes prawns; the prawns include Penaeus vannamei.

5. The use according to claim 1, characterized in that: The agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes RNAi agents.

6. The use according to claim 5, characterized in that: The RNAi agent includes siRNA; the siRNA includes siRNA interfering with the expression of EhAQP1, siRNA interfering with the expression of EhPTP2 and siRNA interfering with the expression of EhMetAP2.

7. The use according to claim 6, characterized in that: The siRNA interfering with the expression of EhAQP1 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.2; the siRNA interfering with the expression of EhPTP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.4; the siRNA interfering with the expression of EhMetAP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.

6.

8. An siRNA for preventing and / or treating shrimp hepatoenteritis, characterized in that: The siRNA includes siRNA interfering with the expression of EhAQP1, siRNA interfering with the expression of EhPTP2 and siRNA interfering with the expression of EhMetAP2.

9. The siRNA according to claim 8, characterized in that The siRNA interfering with the expression of EhAQP1 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.2; the siRNA interfering with the expression of EhPTP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.4; the siRNA interfering with the expression of EhMetAP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.

6.

10. The siRNA according to claim 8, characterized in that The shrimps described include prawns; the prawns include Penaeus vannamei.

Images