Two MYB transcription factors participating in regulation and control of pulegone biosynthesis and application of two MYB transcription factors

Abstract

According to the invention, a schizonepeta limonene synthase (StLS) gene promoter is used as a bait, and two MYB transcription factors, namely StMYB76 and StMYB13, participating in regulation and control of the biosynthesis of the schizonepeta pulegone are screened by using a biological screening method. The nucleotide sequences of the two kinds of genes are shown as SEQ: NO.1 and SEQ: NO.2. The invention further discloses a preparation method of the two kinds of genes. The two MYB transcription factors can be combined with the StLS promoter element and activate the expression of the StLS promoter element; the transcript abundance of related genes StLS, StL3OH, StIPD and StPR for synthesizing the pulegone of the schizonepeta can be obviously enhanced; the accumulation of pulegone in the herba schizonepetae leaves can be promoted. The method can be used for transcriptional regulation and control of plant pulegone biosynthesis, and provides a theoretical basis and a research direction for improving a regulation and control mechanism of labiatae plant volatile oil synthesis and molecular breeding.

Description

Technical Field

[0001] The invention relates to the field of plant molecular biotechnology and genetic engineering, and relates to two MYB-type transcription factors (StMYB76 and StMYB13) involved in transcriptional regulation of pulegone biosynthesis and applications thereof. Background Art

[0002] Schizonpeta tenuifolia, a plant of the Labiatae family, is a famous traditional Chinese herbal medicine, widely used to treat colds and early stage sores. The main chemical components of Schizonpeta tenuifolia include volatile oils, flavonoids and glycosides, among which the volatile oil components are particularly noteworthy. It is reported that the main components of Schizonpeta tenuifolia volatile oil are menthane monoterpenoid compounds such as pulegone, limonene and menthone, which account for more than 90% of the total volatile oil. Pulegone is an oxygen-containing monoterpenoid compound and is the main volatile oil component in Labiatae plants such as Schizonpeta tenuifolia, mint and Elsholtzia cava, with pharmacological effects such as anti-inflammatory, antiviral and analgesic.

[0003] Terpenoids are the largest class of plant secondary metabolites, with biological activities such as antioxidant, anti-inflammatory, anti-cancer, and tumor inhibition. Terpenoids can be classified according to the number of basic isoprene units (C5H8) that make up the terpenoid skeleton: monoterpenes (10C), sesquiterpenes (15C), diterpenes (20C), etc. There are two pathways for the synthesis of terpenes, namely the mevalonic acid (MVA) pathway and the 2-methyl-D-erythritol-4-phosphate pathway (MEP pathway). The common precursors of terpenes derived from the MVA or MEP pathway, dimethylallyl diphosphate (DMAPP) and isopentenyl diphosphate (IPP), are catalyzed by prenyltransferase to produce direct precursors geranyl pyrophosphate (GPP), farnesyl diphosphate (FPP) and geranylgeranylpyrophosphate (GGPP), which are then catalyzed by terpene synthase to produce various terpene compounds.

[0004] The applicant previously combined transcriptome sequencing, gene cloning, heterologous expression and VIGS gene transient silencing and other technologies to conduct in vivo and in vitro functional verification of key enzyme genes that may be involved in the biosynthesis of monoterpenes in Nepeta volatile oil. The applicant successfully screened and identified key enzyme genes in the biosynthesis pathway of pulegone, including limonene synthase (StLS), limonene hydroxylase (StL3OH), isomenthenol dehydrogenase (StISPD), isomenthenol reductase (StIPR) and pulegone reductase (StPR), and verified their functions, providing an important theoretical basis for subsequent research.

[0005] In medicinal plants, transcription factors are key regulators of the biosynthesis and accumulation of secondary metabolites. Among them, MYBs are a family of transcription factors (TFs) unique to plants, which play an important role in plant growth and development, primary and secondary metabolism regulation, and biotic and abiotic stress responses. Previous studies have shown that the R2R3-MYB transcription factor FaMYB63 can directly activate key genes in the phenylpropanoid biosynthesis pathway (such as FaEGS1, FaEGS2, FaCAD1, FaEOBI, and FaMYB10), thereby inducing the biosynthesis of eugenol. In Panax notoginseng, PnMYB1, as a positive regulator of saponin biosynthesis, interacts with PnbHLH to regulate the synthesis of saponins, while PnMYB4 competitively inhibits the formation of the PnMYB1-PnbHLH complex and inhibits the promoter activity of saponin biosynthesis genes, thereby negatively regulating the accumulation of saponins. Moreover, under salt stress, the high accumulation of SmMYB1R1-L in Salix matsudana leads to high expression of SmEXPA13, thereby improving the plant's tolerance to salt stress.

[0006] The menthane monoterpenoid compounds in nepeta essential oil are closely related to its quality and resistance, but the molecular mechanism of its regulation is still unclear. Therefore, this study used the rate-limiting enzyme in the biosynthesis pathway of pulegone monoterpenoid, namely the limonene synthase (StLS) gene, as bait to develop a transcription factor involved in the positive regulation of pulegone monoterpenoid synthesis in nepeta, which is of great significance for improving the quality and resistance of nepeta essential oil. Summary of the invention

[0007] The purpose of the present invention is to provide two MYB transcription factors involved in the biosynthesis of pulegone, the two transcription factors are StMYB76 and StMYB13, and their CDS sequences are shown in SEQ: NO.1 and SEQ: NO.2. The specific features are as follows:

[0008] 1. Sequence characteristics:

[0009] The CDS of StMYB76 is 801 bp in length, theoretically encoding 267 amino acids, with an isoelectric point (pI) of 5.10 and a theoretical molecular weight (Mw) of 65533.07 Da. The CDS of StMYB13 is 753 bp in length, theoretically encoding 251 amino acids, with an isoelectric point (pI) of 5.11 and a theoretical molecular weight (Mw) of 59910.38 Da. StMYB76 and StMYB13 contain a highly conserved PLN03091superfamily at the N-terminus. The results of the evolutionary relationship analysis with the members of the MYB family of the Lamiaceae family showed that StMYB76 and StMYB13 were clustered into a branch with SmMYB76 and SmMYB13 of Salvia miltiorrhiza Bunge., a plant of the Lamiaceae family, respectively, and both belong to the R2R3-MYB family. There are 6 highly conserved motifs, of which motif 4, motif 1 and motif 2 constitute the PLN03091superfamily.

[0010] 2. Gene function

[0011] Both StMYB76 and StMYB13 can significantly induce the activity of the promoter of StLS, a key gene for pulegone synthesis, and significantly increase the transcript abundance of other key enzyme genes in the pulegone synthesis pathway, such as StL3OH, StIPR, and StPR, thereby enhancing the accumulation of pulegone in Nepeta tenuifolia leaves.

[0012] The main purpose of the present invention is to provide the application of the two MYB transcription factors (StMYB76 and StMYB13) involved in the regulation of pulegone biosynthesis in plants in the transcriptional regulation of pulegone biosynthesis, especially in the genetic engineering of improving the content and composition of pulegone in plants.

[0013] When StMYB76 and StMYB13 were transiently overexpressed in Nepeta tenuifolia leaves, they could strongly induce the accumulation of pulegone, resulting in a large amount of pulegone in the leaves. Based on this, StMYB76 and StMYB13 can be used for transcriptional regulation of pulegone biosynthesis in plants, thereby increasing their pulegone content.

[0014] StMYB76 and StMYB13 are the first MYB members reported to regulate pulegone biosynthesis in Nepeta tenuifolia.

[0015] The present invention uses Nepeta tenuifolia, a plant of the Labiatae family, as a test material, and applies biotechniques such as gene cloning, real-time quantitative PCR, yeast single hybridization, and transient expression to separate and identify MYB members StMYB76 and StMYB13 involved in the regulation of Nepeta tenuifolia pulegone biosynthesis. Studies have found that StMYB76 and StMYB13 can bind to elements in the StLS promoter and activate their expression; in addition, expressing StMYB76 and StMYB13 transcription factors in Nepeta tenuifolia leaves can not only positively regulate the transcription level of StLS, but also significantly affect the transcript abundance of other key enzyme genes in the pulegone synthesis pathway; when StMYB76 and StMYB13 transcription factors are transiently overexpressed in Nepeta tenuifolia leaves, the pulegone monoterpene content in the leaves is significantly increased. The present invention uses Nepeta tenuifolia, a plant of the Labiatae family, as a test material, and applies biotechniques such as biological analysis, in vitro yeast single hybridization, and in vivo transient expression to separate and identify two MYB transcription factors, namely StMYB76 and StMYB13, that have transcriptional regulatory effects on Nepeta tenuifolia pulegone biosynthesis. The invention can be used for the transcriptional regulation of the biosynthesis of pulegone monoterpene in plants, and provides a theoretical basis and research direction for improving the regulatory mechanism and molecular breeding of volatile oil synthesis in Lamiaceae plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 :Visual analysis of the gene regulatory network between StLS genes and transcription factors.

[0017] Figure 2 :Visual analysis of the functional elements of the StLS gene promoter.

[0018] Figure 3 :Analysis of the evolutionary relationship between StMYB76 and StMYB13 and MYB family members in Lamiaceae.

[0019] Figure 4 : Analysis of interaction between StMYB76 and StMYB13 and StLS promoter elements. (A: Schematic diagram of truncation of the promoter region 2000bp upstream of StLS; B: Self-activation analysis of StLS-P1, StLS-P2, and StLS-P3; C: Yeast one-hybrid analysis of StLS-P1 with StMYB76 and StMYB13; D: Yeast one-hybrid analysis of StLS-P2 and StLS-P3 with StMYB76 and StMYB13)

[0020] Figure 5:Detection of pulegone content in leaves of Nepeta tenuifolia after transient overexpression of StMYB76 and StMYB13 and analysis of gene expression patterns related to the pulegone biosynthesis pathway. (A: Changes in expression levels of key genes in the StMYB76 and pulegone biosynthesis pathway; B: Changes in expression levels of key genes in the StMYB13 and pulegone biosynthesis pathway; C: Changes in the content of pulegone monoterpene components in Nepeta tenuifolia after overexpression of StMYB76 and StMYB13) DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with the examples and drawings, taking genes StMYB76 and StMYB13 having this function as examples. In the following examples, conventional gene manipulation methods refer to the Molecular Cloning Experiment Guide (3rd edition).

[0022] Example 1: Screening and cloning of Nepeta tenuifolia StMYB76 and StMYB13 genes

[0023] 1. Experimental methods

[0024] The present invention confirms the transcription factors in the gene set based on the transcriptome data of Nepeta tenuifolia and obtains its binding motifs. The sequence of 2000bp upstream of StLS (SEQ: NO.3) is used as the promoter region, and the binding sites therein are retrieved, and finally 1192 transcription factors that can bind to the StLS promoter region are screened. Combined with the PlantCare online tool (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ), the cis-acting elements in the StLS promoter region are predicted, and according to the prediction results, the MYBHV1 binding site is focused on. The gene sequence of MYBHv1 (Hordeum vulgare subsp. vulgare) was obtained through the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and combined with the homologous alignment data of transcription factor binding motifs, two MYB transcription factors StMYB76 (SEQ: NO.1) and StMYB13 (SEQ: NO.2) that may affect the biosynthesis of pulegone by regulating the expression of the StLS gene were screened.

[0025] According to the CDS sequence, specific primer pairs SEQ: NO.4 and SEQ: NO.5 and SEQ: NO.6 and SEQ: NO.7 were designed, and PCR amplification was performed to obtain the full-length sequences of StMYB76 and StMYB13, and sequencing verification was performed. The PCR reaction system was 10ul, and the components were 2×Phanta Max Master Mix 5ul, cDNA 1ul, upstream and downstream primers 0.4ul each, and sterile water 3.2ul. The PCR program was 95℃ pre-denaturation for 3min, 35 cycles of 95℃15s, 55℃15s and 72℃1min, 72℃5min, and 72℃hold.

[0026] (II) Experimental results

[0027] After sequencing verification, the StMYB76 sequence SEQ: NO.1 and the StMYB13 sequence SEQ: NO.2 were obtained, which matched the transcriptome data of Nepeta tenuifolia.

[0028] Example 2: Analysis of interaction with target gene StLS

[0029] 1. Experimental methods

[0030] Primer combination used for yeast one-hybridization StMYB76 upstream primer:

[0031] agtggtctctgtccagtcctATGGGTAGGTCTCCTTGCTGTG and yeast one-hybrid StMYB76 downstream primers:

[0032] ggtctcagcagaccacaagtTCATTTCATTTCCAAGCTTCTGTAA and yeast one-hybridization StMYB13 upstream primer: agtggtctctgtccagtcctATGGGACGATCTCCCTGCTG and yeast one-hybridization StMYB13 downstream primer:

[0033] ggtctcagcagaccacaagtTCATTTCATCTCCAAACTTCTGTAATC, respectively amplify the full-length sequence of StMYB76 (SEQ: NO.1) and StMYB13 (SEQ: NO.2), load it into the pGADT7 vector, and obtain the prey vectors pGADT7-StMYB76 and pGADT7-StMYB13. In addition, according to the analysis results of the promoter cis-acting elements, the StLS promoter region was cut into three segments, and the primer combination yeast single hybrid StLS-P1 upstream primer was used: agtggtctctgtccagtcctGAAGATTTATTCTCATTTTTTAGGATAATATTTATTCTCA

[0034] and yeast one-hybrid StLS-P1 downstream primer: ggtctcagcagaccacaagtCGCTCCTGCAATTTACTATCG

[0035] And yeast one-hybrid StLS-P2 upstream primer:

[0036] agtggtctctgtccagtcctCACTACATAATTAAAAACAAAAACACTACATAAAAC

[0037] And yeast one-hybrid StLS-P2 downstream primers:

[0038] ggtctcagcagaccacaagtGAATTTTCTTCAATAATGGGCCTAAAAG

[0039] And yeast one-hybrid StLS-P3 upstream primer:

[0040] agtggtctctgtccagtcctGAAATTGATGAAATTGATGCAAAAACTG

[0041] And yeast one-hybrid StLS-P3 downstream primers:

[0042] ggtctcagcagaccacaagtAATTAAATCTATATAACTTTTTCTTCTCTTTTTTTCG, insert the StLS-P1, StLS-P2 and StLS-P3 promoter sequences into the pAbAi vector to construct the bait vectors pAbAi-StLS-P1, pAbAi-StLS-P2 and pAbAi-StLS-P3. The bait vectors were linearized with BstBI enzyme and transformed into the Y1HGold yeast strain, and the transformed yeast was diluted 4 times by 10 times and inoculated on SD / -Ura solid medium containing different concentrations of AbA (0, 100, 200, 400 and 600 ng mL-1) for self-activation detection. pAbAi-StLS-P1, pAbAi-StLS-P2, pAbAi-StLS-P3 were co-transformed into yeast cells with pGADT7-StMYB76 and pGADT7-StMYB13, respectively, using a yeast transformation kit (Coolaber. Beijing). Spot identification experiments were performed on SD / -Leu / AbA solid medium containing AbA (600ng mL-1) and cultured at 28°C for 2-3 days. The interaction between the transcription factor and the promoter fragment was determined based on the growth of yeast on selective medium.

[0043] (II) Experimental results

[0044] like Figure 4 The results of yeast one-hybrid (YIH) experiments showed that StMYB76 and StMYB13 both had the effect of activating the promoter of StLS-P2, a key enzyme gene for pulegone synthesis, but had no effect on the promoters of StLS-P1 and StLS-P3.

[0045] Example 3: Analysis of induced pulegone accumulation

[0046] 1. Experimental methods

[0047] Thermo Scientific TM The Phreac-GFP vector was linearized by FastDigest Eco31I (Type IIs), and the primer combination was used to transiently overexpress StMYB76 upstream primer:

[0048] tatattaaacgtctctaaaaATGGGTAGGTCTCCTTGCTGTG and transient overexpression StMYB76 downstream primer: aatttaatgaaaccagagcgTCATTTCATTTCCAAGCTTCTGTAATCCAAAAC and transient overexpression StMYB13 upstream primer: tatattaaacgtctctaaaaATGGGACGATCTCCCTGCTG and transient overexpression StMYB13 downstream primer:

[0049] aatttaatgaaaccagagcgTCATTTCATCTCCAAACTTCTGTAATCCAAAACT, respectively amplify the full-length sequence of StMYB76 (SEQ: NO.1) and StMYB13 (SEQ: NO.2), and use ClonExpressⅡOne StepCloing Kit to homologously recombinant StMYB76 and StMYB13 with the linearized Phreac-GFP vector. The recombinant plasmid was transformed into Agrobacterium GV3101 competent cells and cultured in liquid culture medium containing 50 mg / L kanamycin to OD600=0.6. The bacterial solution was centrifuged at 4000 rpm at room temperature, and the cells were collected and resuspended with a resuspension solution (10 mM / L MES, 10 mM / L MgCl, 200 μM / L AS). The resuspension containing Phreac-GFP, Phreac-GFP-StMYB76 and Phreac-GFP-StMYB13 was cultured at 25°C and 50 rpm for 2-3 hours. The injection infiltration method was used to infect S. tenuifolia leaves. The suspension was slowly injected into the lower epidermis of the leaves until the entire leaves were infiltrated. The leaves were cultured for three days under the conditions of 16 h / d light intensity of 10000X and humidity of 25°C.

[0050] The injected leaves were frozen in liquid nitrogen for subsequent pulegone content detection and gene expression analysis. The StLSqPCR primers were StLS qPCR upstream primer: ACGGATTCACTCGCAAAGGACAC and StLS qPCR downstream primer: TTGGCACATCACCTCTGCTCACC, the StL3OH qPCR primers were StL3OH qPCR upstream primer: CTCGCCAATGTAGAGGTT and StL3OH qPCR downstream primer: GGGAGTGGGGATTAAGAC, the StIPD qPCR primers were StIPD qPCR upstream primer: TGGGACAGCCGACGATGTGGAGAGTT and StIPD qPCR downstream primer: AAAGCCGCCTCATCCGAAGCCAAAAA, the StIPR qPCR primers were StIPR qPCR upstream primer: AAGCCGGTGGTGGAAAGAAT and StIPR qPCR downstream primer: CCACTTGTAGGAGATTGGCT, the StPR qPCR primers were StPR qPCR upstream primer: TCCCAACATGAAAACGAAAGG and StPR qPCR downstream primer: GCGGCACAACTAAATCGAAAA, StMYB76 qPCR primer: StMYB76 qPCR upstream primer: GCGTGGACTAAAGAAGAAGAC and StMYB76 qPCR downstream primer: GTTGCCGAGAAGGCTATG, StMYB13 qPCR primer: StMYB13 qPCR upstream primer: TCGCCTACATCCGCTCCCA and StMYB13 qPCR downstream primer: TCTCGTTGTCGGTCCTTCC, with Nepeta tenuifolia StEF internal reference gene, qPCR primer: StEF qPCR upstream primer: GACAAGCCTCTTCGTCTCCC and StEF qPCR upstream primer: GTTCGATGCAACAAACCCAC. The above operation was repeated once for each of the three positive clones of each gene, constituting three biological replicates. The qPCR reaction system consisted of 5 μL of 2×ChamQ UniversalSTBR qPCR Master Mix, 0.2 μL of upstream and downstream primers, 0.5 μL of cDNA, and 4.1 μL of RNase-free ddH2O.The reaction program is: pre-denaturation: 95℃ for 30s; cycle reaction: 95℃ for 10s, 60℃ for 30s, 40 cycles, all samples are set with 3 technical replicates, in order to determine whether the fluorescence quantitative amplification is specific, melting curve analysis is performed after amplification, the program is as follows: gradually increase the temperature from 60℃ to 95℃, read once every 0.5℃, each time for 5s, and continuously record the changes in fluorescence signals. The experimental data are expressed as 2. -ΔΔCT The relative expression of genes was analyzed by calculation method.

[0051] The content of pulegone monoterpene components in the leaves of Nepeta after transient overexpression was determined by gas chromatograph (8860 (G2790A), Agilent Technologies). Take 0.05 g of Nepeta leaves from the same part, add 0.7 mL of camphor internal standard solution, add 4 steel balls and grind in a tissue grinder (60HZ, 60s), then centrifuge at 12,000r / min for 5 minutes, add an appropriate amount of anhydrous sodium sulfate and centrifuge again at 12,000r / min for 1 minute, take the supernatant and filter through a 0.22μm organic filter membrane to obtain the sample. Each sample was repeated three times. The gas phase program is as follows: Gas chromatography conditions are as follows: Agilent 19091S-433HP-5ms capillary column (250μm×30m×0.25μm), programmed temperature conditions: start at 50°C, hold for 3min, increase to 90°C at a rate of 3°C / min, increase to 150°C at a rate of 5°C / min, increase to 220°C at a rate of 10°C / min, hold for 5min; the injection port temperature is 250°C; the carrier gas is nitrogen; the volume flow rate is 1.0mL / min; the injection volume is 1μL; no splitting.

[0052] (II) Experimental results

[0053] like Figure 5 The results of gene expression analysis and pulegone content analysis showed that compared with the Phreac-GFP (OE) control group, the expression of StLS gene in the experimental group of Phreac-GFP-StMYB76 and Phreac-GFP-StMYB13 overexpression plants was significantly increased, and the expression of pulegone biosynthesis-related genes StL3OH, StIPD and StPR genes was also significantly increased. Not only that, the content of pulegone in Nepeta leaves was also significantly increased.

[0054] The present invention uses Nepeta tenuifolia of the Lamiaceae family as a test material, applies biotechniques such as gene cloning, real-time quantitative PCR, yeast single hybridization and transient expression, separates and identifies that Nepeta tenuifolia StMYB76 and StMYB13 have transcriptional regulatory effects on pulegone biosynthesis, and can be applied to the genetic engineering of pulegone biosynthesis in plants.

Claims

1. Two MYB transcription factors involved in the regulation of pulegone biosynthesis in Nepeta tenuifolia, characterized in that: The amino acid sequences of the transcription factors StMYB76 and StMYB13 are shown in the sequence listings SEQ NO.1 and SEQ NO.

2.

2. The two MYB transcription factors involved in the regulation of schizonepeta pulegone biosynthesis according to claim 1, characterized in that: The CDS of StMYB76 is 801 bp in length, theoretically encoding 267 amino acids, with an isoelectric point of 5.10 and a theoretical molecular weight of 65533.07 Da. The CDS of StMYB13 is 753 bp in length, theoretically encoding 251 amino acids, with an isoelectric point of 5.11 and a theoretical molecular weight of 59910.38 Da. StMYB76 and StMYB13 contain a highly conserved PLN03091 superfamily at the N-terminus. The results of evolutionary relationship analysis with members of the MYB family of the Lamiaceae family showed that StMYB76 and StMYB13 were clustered into a branch with SmMYB76 and SmMYB13 of the Lamiaceae plant Salvia miltiorrhiza, respectively, and both belong to the R2R3-MYB family. They have 6 highly conserved motifs, of which motif 4, motif 1 and motif 2 constitute the PLN03091 superfamily.

3. Use of the two MYB transcription factors involved in the regulation of pulegone biosynthesis in Nepeta tenuifolia according to claim 1 in the transcriptional regulation of pulegone biosynthesis in plants.

4. The use according to claim 3, which is the use of two MYB transcription factors in genetic engineering for regulating the content and component improvement of plant pulegone.

5. The use according to claim 3, wherein the two MYB transcription factors involved in the regulation of pulegone biosynthesis in Nepeta can bind to the StLS promoter element and activate its expression; the transcript abundance of Nepeta pulegone synthesis-related genes StLS, StL3OH, StIPD, and StPR can be significantly enhanced; and the accumulation of pulegone in Nepeta leaves can be promoted.

Images