SiRNA for inhibiting XDH gene expression and conjugate and application thereof

Abstract

The invention belongs to the field of biological medicine, and particularly relates to siRNA for inhibiting XDH gene expression and a conjugate and application thereof, the siRNA comprises a positive-sense strand and an antisense strand, the positive-sense strand and / or the antisense strand has the length in the range of 19-25 nucleotides, and the antisense strand is reversely complementary with a segment on a target gene. The siRNA and the siRNA conjugate provided by the invention have a very high inhibition effect on the goslings, and can well reduce the blood uric acid level of the goslings, so that the morbidity of the goslings on the gout of the goslings is greatly reduced.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a siRNA for inhibiting XDH gene expression and a conjugate and application thereof. Background Art

[0002] RNA interference (RNAi) refers to a gene silencing phenomenon induced by double-stranded RNA in molecular biology. Its mechanism is to inhibit gene expression by hindering the transcription or translation of specific genes. When double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into cells, the mRNA is degraded and gene expression is silenced. Small interfering RNA (siRNA) with a length of 20-25nt can trigger RNAi, which can specifically downregulate or shut down the expression of specific genes. It has the characteristics of high efficiency, easy synthesis and easy operation, so this technology has been widely used in the field of exploring gene function and gene therapy for infectious diseases and malignant tumors.

[0003] N-acetylgalactosamine (GalNAc) is a monosaccharide that can be recognized by sialic acid glycoprotein receptors highly expressed in hepatocytes. Using GalNAc derivatives such as divalent or trivalent branched linkers connected to the 3' end of the siRNA sense strand can promote the specific targeting of siRNA to liver tissue, thereby improving its bioavailability and reducing the dosage and side effects.

[0004] Gout in goslings is a metabolic disease caused by urate deposition caused by goose astrovirus. In recent years, goose astrovirus infection has been widely prevalent in major goose breeding areas in my country. Goose astroviruses are characterized by weight loss, slow growth, and susceptibility to infection by other pathogens. Currently, it has not been effectively controlled, causing huge economic losses to the goose industry. Goose astrovirus (GoAstV) is a member of the genus Astrovirus in the family Astroviridae. It is non-enveloped, has a genome of approximately 8.0 kb, and is a single-stranded positive-strand RNA virus. Infection can cause diarrheal enteritis, nephritis, and urate deposition in goslings. It is one of the important causes of gout in goslings, and the mortality rate caused by this disease can range from 20% to 50%.

[0005] Studies have shown that goslings are more susceptible to GoAstV, while adult geese are often latently infected. In the early stages of the GoAstV epidemic, only geese were infected, but as GoAstV became widespread in my country, the infected spread to Cherry Valley ducks, turnstones, and chickens. The amount of virus excreted in the first few days after GoAstV infection is proportional to time, reaching a peak at 5 to 7 days, followed by a decrease in the viral load, and virus excretion can be detected 15 days after infection or even longer. The symptoms after infection mainly manifest as depression, loss of appetite, white feces, swollen joints, and a preference for lying down and unwillingness to move; pathological examinations show swollen and pale kidneys, enlarged spleens, and urate deposits on the surface of the heart and liver, forebrain ventricles, joint cavities, and ureters. The growth performance of resistant goslings is severely reduced.

[0006] Some studies have reported that yolk antibodies are effective in treating goose astrovirus infection, but are ineffective in treating the middle and late stages of the disease. The reason may be that the goose astrovirus has been cleared by the goose's immune system at this time, and yolk antibodies have no therapeutic effect on gout caused by infection.

[0007] Goose morphological virus infection mainly causes gout attacks by causing increased blood uric acid levels, so lowering uric acid can effectively relieve gout symptoms and improve the survival rate of geese. Commonly used uric acid-lowering drugs include xanthine oxidase (XDH) inhibitors, urate anion transporter 1 (URAT1) inhibitors, and urate oxidase.

[0008] XDH inhibitors include small molecules such as allopurinol and febuxostat, which inhibit XDH enzyme activity and block the conversion of purine substrates to uric acid, thereby effectively reducing uric acid levels. However, this type of small molecule drug has a short half-life and needs to be taken daily to ensure a stable uric acid-lowering effect, which is not suitable for disease control in economic animals such as geese.

[0009] Commonly used URAT1 inhibitors include benzbromarone, which inhibits the reabsorption of uric acid by the renal tubules, increases the excretion of uric acid, and reduces the level of uric acid in the blood. Similar to XDH small molecule inhibitors, daily medication is required to maintain the efficacy. In addition, benzbromarone has been reported to cause abnormal liver and kidney function.

[0010] Urate oxidase drugs include recombinant human urate oxidase (rasburicase) and recombinant non-mammalian urate oxidase (pegloticase). These drugs are mainly used to treat hyperuricemia crisis or refractory hyperuricemia caused by radiotherapy and chemotherapy for malignant tumors. They are generally not used to treat chronic gout and are relatively expensive.

[0011] There is currently no targeted treatment for gout in geese. Conventional antibacterial and antiviral methods are ineffective in treating goose astrovirus infection, and there is no commercial vaccine to prevent goose astrovirus infection. The current uric acid-lowering drugs used by humans are not suitable for the treatment of geese, so there is an urgent need to develop effective drugs specifically for gout in geese. Summary of the invention

[0012] The present invention designs corresponding siRNAs for XDH, and their modified sequences, as well as applications in treating gout in geese.

[0013] The first technical solution of the present invention discloses a siRNA for inhibiting the expression of XDH gene, comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially reverse-complementary to form a double-stranded region, and the siRNA is applied to a drug for treating gout, and the siRNA is any one of the following (1) to (10):

[0014] (1) The sense strand is CCCUCAGCUUCUUCUUCAANn (SEQ ID NO: 51), and the antisense strand is UUGAAGAAGAAGCUGAGGGNn (SEQ ID NO: 61);

[0015] (2) The sense strand is GCUUCUUCUUCAAAUUCUANn (SEQ ID NO: 52), and the antisense strand is UAGAAUUUGAAGAAGAAGCNn (SEQ ID NO: 62);

[0016] (3) The sense strand is GGACUAUAAUGAAAAAAAANn (SEQ ID NO: 53), and the antisense strand is UUUUUUUUUCAUUAUAGUCCNn (SEQ ID NO: 63);

[0017] (4) The sense strand is GACUAUAAUGAAAAAAAAANn (SEQ ID NO: 54), and the antisense strand is UUUUUUUUUUCAUUAUAGUCNn (SEQ ID NO: 64);

[0018] (5) The sense strand is GGCAAUAUGUUAAAAAAAANn (SEQ ID NO: 55), and the antisense strand is UUUUUUUUAACAUAUUGCCNn (SEQ ID NO: 65);

[0019] (6) The sense strand is GCAAUAUGUUAAAAAAAAANn (SEQ ID NO: 56), and the antisense strand is UUUUUUUUUAACAUAUUGCNn (SEQ ID NO: 66);

[0020] (7) The sense strand is GGGAGUGAUAUAAAAUCAANn (SEQ ID NO: 57), and the antisense strand is UUGAUUUUAUAUCACUCCCNn (SEQ ID NO: 67);

[0021] (8) The sense strand is GGAGACCAAUGGAAAUUUANn (SEQ ID NO: 58), and the antisense strand is UAAAUUUCCAUUGGUCUCCNn (SEQ ID NO: 68);

[0022] (9) The sense strand is GGAACUAAGUGUCAGAUAANn (SEQ ID NO: 59), and the antisense strand is UUAUCUGACACUUAGUUCCNn (SEQ ID NO: 69);

[0023] (10) The sense strand is GCAAAAUAAAACUAAAAAANn (SEQ ID NO: 60), and the antisense strand is UUUUUUAGUUUUUAUUUUGCNn (SEQ ID NO: 70);

[0024] Wherein N is any one of G, U, A, C, T, dG, dU, dA, dC, and dT; n is the number of N, and n is an integer from 0 to 3.

[0025] Furthermore, N is any one of G, U, A, and C, and n is 2.

[0026] Furthermore, the n is 0.

[0027] When n is 0, the siRNA is any one of the following (1) to (10):

[0028] (1) The sense strand is CCCUCAGCUUCUUCUUCAA (SEQ ID NO: 71), and the antisense strand is UUGAAGAAGAAGCUGAGGG (SEQ ID NO: 81);

[0029] (2) The sense strand is GCUUCUUCUUCAAAUUCUA (SEQ ID NO: 72), and the antisense strand is UAGAAUUUGAAGAAGAAGC (SEQ ID NO: 82);

[0030] (3) The sense strand is GGACUAUAAUGAAAAAAAA (SEQ ID NO: 73), and the antisense strand is UUUUUUUUUCAUUAUAGUCC (SEQ ID NO: 83);

[0031] (4) The sense strand is GACUAUAAUGAAAAAAAAA (SEQ ID NO: 74), and the antisense strand is UUUUUUUUUUCAUUAUAGUC (SEQ ID NO: 84);

[0032] (5) The sense strand is GGCAAUAUGUUAAAAAAAA (SEQ ID NO: 75), and the antisense strand is UUUUUUUUUAACAUAUUGCC (SEQ ID NO: 85);

[0033] (6) The sense strand is GCAAUAUGUUAAAAAAAAA (SEQ ID NO: 76), and the antisense strand is UUUUUUUUUAACAUAUUGC (SEQ ID NO: 86);

[0034] (7) The sense strand is GGGAGUGAUAUAAAAUCAA (SEQ ID NO: 77), and the antisense strand is UUGAUUUUAUAUCACUCCC (SEQ ID NO: 87);

[0035] (8) The sense strand is GGAGACCAAUGGAAAUUUA (SEQ ID NO: 78), and the antisense strand is UAAAUUUCCAUUGGUCUCC (SEQ ID NO: 88);

[0036] (9) The sense strand is GGAACUAAGUGUCAGAUAA (SEQ ID NO: 79), and the antisense strand is UUAUCUGACACUUAGUUCC (SEQ ID NO: 89);

[0037] (10) The sense strand is GCAAAAUAAAACUAAAAAA (SEQ ID NO: 80), and the antisense strand is UUUUUUAGUUUUUAUUUUGC (SEQ ID NO: 90).

[0038] Furthermore, the combination of two Ns includes GU, UG, UA, AU, CC, CU, AA, AG, CA, GG, and CG. The obtained siRNAs are shown in Table 1.

[0039] Furthermore, the siRNA is selected from YJV-001-1842, YJV-001-1850, YJV-001-4377, YJV-001-5818, YJV-001-5819, and YJV-001-7500.

[0040] Furthermore, at least one nucleotide in the siRNA is modified; the modified nucleotide is selected from one or more of a modified sugar moiety at the 2' position, or at least one phosphate group is a phosphate group containing a modified group, or a nucleotide analog.

[0041] Further, the nucleotide modified with the sugar moiety at the 2' position includes a 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethoxyethyl (2'-O-DMAEOE) or 2'-ON-methylacetamido (2'-O-NMA) modified nucleotide.

[0042] Furthermore, the phosphate group containing a modified group is specifically a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond with a sulfur atom.

[0043] Further, the nucleotide analogue is selected from one of isonucleotide, LNA, ENA, cEt BNA, UNA or GNA.

[0044] Furthermore, the structures of the sense strands of the modified siRNA molecules are shown in SEQ ID NOs: 21-30; and the structures of the antisense strands of the modified siRNA molecules are shown in SEQ ID NOs: 31-40.

[0045] The second technical solution of the present invention discloses that the siRNA conjugate contains any of the above-mentioned siRNAs and a ligand conjugated to the siRNA, wherein the ligand includes GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, and N-acetylglucosamine derivatives or analogs.

[0046] Furthermore, the siRNA conjugate conjugated with the ligand is selected from Table 3, which can help siRNA be delivered to the target organ or tissue and enter the cell, including monoclonal antibody, bispecific antibody, monosaccharide, polysaccharide, cationic polymer, etc.

[0047] Among them, the ligand is L96, and the structural formula of L96 is as follows:

[0048]

[0049] The third technical solution of the present invention discloses a biomaterial, which is any of the following:

[0050] 1) A vector containing the siRNA described in the first technical solution or the siRNA conjugate described in the second technical solution;

[0051] 2) A reagent or a kit containing the siRNA described in the first technical solution or the siRNA conjugate described in the second solution or the vector described in 1);

[0052] 3) A pharmaceutical composition, consisting of the siRNA molecule described in the first technical solution or the siRNA conjugate described in the second technical solution and other pharmaceutically acceptable components.

[0053] Wherein, the pharmaceutically acceptable other components include but are not limited to water, saline, pH buffer, protective agent, osmotic pressure regulator, excipient, diluent, disintegrant, binder, lubricant, sweetener, preservative or a combination thereof. The protective agent can be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose.

[0054] The above-mentioned carriers include but are not limited to magnetic nanoparticles (such as Fe2O3), carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamidoamine dendrimers, polylysine, chitosan, poly D-type or L-type lactic acid / glycolic acid copolymers, poly (aminoethyl ethylene phosphate) and poly methacrylate-N, N-dimethylaminoethyl ester and one or more of their derivatives.

[0055] The dosage form of the pharmaceutical composition can be a liquid preparation (e.g., injection) or a lyophilized powder injection. The lyophilized powder injection is mixed with a liquid excipient during administration to prepare a liquid preparation. The liquid preparation can be, but is not limited to, administered subcutaneously, intramuscularly, or intravenously, and can also be, but is not limited to, administered to the lungs by spraying, or administered to other organs (e.g., liver) via the lungs by spraying.

[0056] The siRNA, siRNA conjugate, related biological materials and pharmaceutical composition of the present invention are used for the treatment of gout in geese.

[0057] Beneficial effects:

[0058] The siRNA of the present invention is coupled to GalNAc to effectively deliver the siRNA to the liver, interfere with the XDHmRNA in the liver, effectively reduce the expression of XDH protein, reduce the synthesis of uric acid, and thus play a role in treating gout in geese. In addition, the incidence of gout in geese from hatching to slaughter can be reduced with a very small number of administrations. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is a graph of blood uric acid levels in geese after drug administration.

[0060] Figure 2 This is a graph showing the incidence of gout in geese after drug administration.

[0061] Figure 3 The figure shows the urate deposition outside the cardiac pericardium of diseased and healthy geese. DETAILED DESCRIPTION

[0062] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0063] The term "linked" as used herein, when referring to the connection between two molecules, means that the two molecules are connected by a covalent bond or the two molecules are associated via a non-covalent bond (eg, a hydrogen bond or an ionic bond).

[0064] "Oligonucleotide" of the present invention is a nucleotide sequence containing 10-50 nucleotides or nucleotide base pairs. In some embodiments of the present invention, the oligonucleotide has such a core base sequence, which is at least partially complementary to the coding sequence in the target gene expressed in the cell. The nucleotides can be optionally modified. In some embodiments of the present invention, after the oligonucleotide is delivered to the cell expressing the gene, the oligonucleotide can inhibit or block the expression of the gene in vitro or in vivo.

[0065] The term "inhibit" as used herein, when referring to the expression of a given gene, means that gene expression is reduced when the cell, cell population or tissue is treated with the siRNA, pharmaceutical composition and siRNA conjugate of the present invention, compared to cells, cell populations or tissues that have not been treated.

[0066] The term "inhibit" in the present invention is used interchangeably with "reduce", "silence", "downregulate", "suppress" and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0067] Each nucleotide in the sense strand and the antisense strand is independently a modified or unmodified nucleotide. In the context of the present invention, unless otherwise specified, "conjugation" refers to the covalent connection between two or more chemical moieties each having a specific function, also referred to as "coupling"; accordingly, "conjugate" refers to a compound formed by covalent connection between the chemical moieties, also referred to as a "conjugate". Further, "siRNA conjugate" refers to a compound formed by covalently connecting one or more chemical moieties having a specific function to siRNA, also referred to as "siRNA conjugate".

[0068] In the above and below, unless otherwise specified, generally, "G", "C", "A", "T" and "U" represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. However, it should be understood that the term "ribonucleotide" or "nucleotide" may also refer to modified nucleotides, nucleotide analogs (surrogate replacement moieties) as described in further detail below.

[0069] In the context of the present invention, the expressions "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand are each paired with a base on the other strand in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one strand is always paired with thymine (or uracil) on the other strand, and guanine is always paired with cytosine, the two strands are considered to be complementary to each other, and the sequence of the strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0070] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; "completely reverse complementary" means that there is no base mismatch between the two nucleotide sequences. In the above and below, the existence of "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position of the former is changed compared with the latter. For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position of the former is U, C, G or T, it is determined that there is a nucleotide difference at that position between the two nucleotide sequences. In some embodiments, when a nucleotide at the original position is replaced by an abasic nucleotide or its equivalent, it can also be considered that a nucleotide difference has occurred at that position.

[0071] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0072] A set of siRNAs targeting the XDH gene (NCBI RefSeq ID XM_048078421.2; NCBIGene ID: 106031596) was designed based on the transcriptome sequence: including 10 pairs of unmodified siRNAs, as shown in Table 1; the siRNAs in Table 1 were further modified, as shown in Table 2; and the modified siRNAs were further conjugated with ligands to obtain conjugates, as shown in Table 3.

[0073] Table 1

[0074] Name SEQ ID NO: siXDH sense strand sequence (5'-3') SEQ ID NO: siXDH antisense strand sequence (5'-3') Position in XM_048078421.2 YJV-001-1842 1 CCCUCAGCUUCUUCUUCAAGU 11 UUGAAGAAGAAGCUGAGGGUG 1842 YJV-001-1850 2 GCUUCUUCUUCAAAUUCUACC 12 UAGAAUUUGAAGAAGAAGCUG 1850 YJV-001-4377 3 GGACUAUAAUGAAAAAAAAAA 13 UUUUUUUUCAUUAUAGUCCUA 4377 YJV-001-4378 4 GACUAUAAUGAAAAAAAAAAA 14 UUUUUUUUUCAUUAUAGUCCU 4378 YJV-001-5818 5 GGCAAUAUGUUAAAAAAAAAA 15 UUUUUUUUAACAUAUUGCCAG 5818 YJV-001-5819 6 GCAAUAUGUUAAAAAAAAAAA 16 UUUUUUUUUAACAUAUUGCCA 5819 YJV-001-6624 7 GGGAGUGAUAUAAAAUCAAGG 17 UUGAUUUUAUAUCACUCCCCG 6624 YJV-001-6699 8 GGAGACCAAUGGAAAUUUAUG 18 UAAAUUUCCAUUGGUCUCCAA 6699 YJV-001-6840 9 GGAACUAAGUGUCAGAUAACC 19 UUAUCUGACACUUAGUUCCAU 6840 YJV-001-7500 10 GCAAAAUAAAACUAAAAAAUA 20 UUUUUUAGUUUUAUUUUGCAA 7500

[0075] Table 2

[0076] Name SEQ ID NO: siXDH sense strand sequence (5'-3') SEQ ID NO: siXDH antisense strand sequence (5'-3') YJV-001-1842 m2 21 fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU 31 mU-s-fU-s-mG-fA-mA-fG-mA-fA-mG-fA-mA-mG-mC-fU-mG-fA-mG-fG-mG-s-mU-s-mG YJV-001-1850 m2 22 fG-s-mC-s-fU-mU-fC-mU-fU-fC-fU-mU-fC-mA-fA-mA-fU-mU-fC-mU-fA-mC-mC 32 mU-s-fA-s-mG-fA-mA-fU-mU-fU-mG-fA-mA-mG-mA-fA-mG-fA-mA-fG-mC-s-mU-s-mG YJV-001-4377 m2 23 fG-s-mG-s-fA-mC-fU-mA-fU-fA-fA-mU-fG-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 33 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mC-fA-mU-mU-mA-fU-mA-fG-mU-fC-mC-s-mU-s-mA YJV-001-4378 m2 24 fG-s-mA-s-fC-mU-fA-mU-fA-fA-fU-mG-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 34 mU-s-fU-s-mU-fU-mU-fU-fU-mU-fC-mA-mU-mU-fA-mU-fA-mG-fU-mC-s-mC-s-mU YJV-001-5818 m2 25 fG-s-mG-s-fC-mA-fA-mU-fA-fU-fG-mU-fU-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 35 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mA-fA-mC-mA-mU-fA-mU-fU-mG-fC-mC-s-mA-s-mG YJV-001-5819 m2 26 fG-s-mC-s-fA-mA-fU-mA-fU-fG-fU-mU-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 36 mU-s-fU-s-mU-fU-mU-fU-fU-mU-fA-mA-mC-mA-fU-mA-fU-mU-fG-mC-s-mC-s-mA YJV-001-6624 m2 27 fG-s-mG-s-fG-mA-fG-mU-fG-fA-fU-mA-fU-mA-fA-mA-fA-mU-fC-mA-fA-mG-mG 37 mU-s-fU-s-mG-fA-mU-fU-mU-fU-mA-fU-mA-mU-mC-fA-mC-fU-mC-fC-mC-s-mC-s-mG YJV-001-6699 m2 28 fG-s-mG-s-fA-mG-fA-mC-fC-fA-fA-mU-fG-mG-fA-mA-fA-mU-fU-mU-fA-mU-mG 38 mU-s-fA-s-mA-fA-mU-fU-mU-fC-mC-fA-mU-mU-mG-fG-mU-fC-mU-fC-mC-s-mA-s-mA YJV-001-6840 m2 29 fG-s-mG-s-fA-mA-fC-mU-fA-fA-fG-mU-fG-mU-fC-mA-fG-mA-fU-mA-fA-mC-mC 39 mU-s-fU-s-mA-fU-mC-fU-mG-fA-mC-fA-mC-mU-mU-fA-mG-fU-mU-fC-mC-s-mA-s-mU YJV-001-7500 m2 30 fG-s-mC-s-fA-mA-fA-mA-fU-fA-fA-mA-fA-mC-fU-mA-fA-mA-fA-mA-fA-mU-mA 40 mU-s-fU-s-mU-fU-mU-fU-mA-fG-mU-fU-mU-mU-mA-fU-mU-fU-fU-fG-mC-s-mA-s-mA

[0077] Table 3

[0078] name SEQ ID NO: siXDH positive strand sequence (5'-3') SEQ ID NO: siXDH antisense strand sequence (5'-3') YJV-001-1842m2-L96 41 fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU-L96 31 mU-s-fU-s-mG-fA-mA-fG-mA-fA-mG-fA-mA-mG-mC-fU-mG-fA-mG-fG-mG-s-mU-s-mG YJV-001-1850m2-L96 42 fG-s-mC-s-fU-mU-fC-mU-fU-fC-fU-mU-fC-mA-fA-mA-fU-mU-fC-mU-fA-mC-mC-L96 32 mU-s-fA-s-mG-fA-mA-fU-mU-fU-mG-fA-mA-mG-mA-fA-mG-fA-mA-fG-mC-s-mU-s-mG YJV-001-4377m2-L96 43 fG-s-mG-s-fA-mC-fU-mA-fU-fA-fA-mU-fG-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 33 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mC-fA-mU-mU-mA-fU-mA-fG-mU-fC-mC-s-mU-s-mA YJV-001-4378m2-L96 44 fG-s-mA-s-fC-mU-fA-mU-fA-fA-fU-mG-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 34 mU-s-fU-s-mU-fU-mU-fU-fU-mU-fC-mA-mU-mU-fA-mU-fA-mG-fU-mC-s-mC-s-mU YJV-001-5818m2-L96 45 fG-s-mG-s-fC-mA-fA-mU-fA-fU-fG-mU-fU-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 35 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mA-fA-mC-mA-mU-fA-mU-fU-mG-fC-mC-s-mA-s-mG YJV-001-5819m2-L96 46 fG-s-mC-s-fA-mA-fU-mA-fU-fG-fU-mU-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 36 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mU-fA-mA-mC-mA-fU-mA-fU-mU-fG-mC-s-mC-s-mA YJV-001-6624m2-L96 47 fG-s-mG-s-fG-mA-fG-mU-fG-fA-fU-mA-fU-mA-fA-mA-fA-mU-fC-mA-fA-mG-mG-L96 37 mU-s-fU-s-mG-fA-mU-fU-mU-fU-mA-fU-mA-mU-mC-fA-mC-fU-mC-fC-mC-s-mC-s-mG YJV-001-6699m2-L96 48 fG-s-mG-s-fA-mG-fA-mC-fC-fA-fA-mU-fG-mG-fA-mA-fA-mU-fU-mU-fA-mU-mG-L96 38 mU-s-fA-s-mA-fA-mU-fU-mU-fC-mC-fA-mU-mU-mG-fG-mU-fC-mU-fC-mC-s-mA-s-mA YJV-001-6840m2-L96 49 fG-s-mG-s-fA-mA-fC-mU-fA-fA-fG-mU-fG-mU-fC-mA-fG-mA-fU-mA-fA-mC-mC-L96 39 mU-s-fU-s-mA-fU-mC-fU-mG-fA-mC-fA-mC-mU-mU-fA-mG-fU-mU-fC-mC-s-mA-s-mU YJV-001-7500m2-L96 50 fG-s-mC-s-fA-mA-fA-mA-fU-fA-fA-mA-fA-mC-fU-mA-fA-mA-fA-mA-fA-mU-mA-L96 40 mU-s-fU-s-mU-fU-mU-fU-mA-fG-mU-fU-mU-mU-mA-fU-mU-fU-mU-fG-mC-s-mA-s-mA

[0079] The abbreviations of nucleotide monomers in Tables 2 and 3 are shown in Table 4:

[0080] Table 4

[0081] Compact copy nuclear acid A 3'-3'-acid fA 2'-Kishiroadenin-3'-Ikashi acid mA 2'-O-Carrobase-3'-isoic acid s-mA 2'-O-Sulfuric acid s-fA 2'-Sulfuric acid C Sporax-3'-sho acid fC 2'-Kishirosorawaki-3'-Issho acid mC 2'-O-3-3'-acid s-mC 2'-O-methylcytidine-3'-phosphorothioate fC 2'-Fluorocytidine-3'-phosphorothioate G Guanosine 3'-phosphate f 2'-Fluoroguanosine-3'-phosphate mxD 2'-O-methylguanosine-3'-phosphate s-mG 2'-O-methylguanosine-3'-phosphorothioate s-fG 2'-Fluoroguanosine-3'-phosphorothioate U Uridine-3'-phosphate f 2'-Fluorouridine-3'-phosphate mxD 2'-O-methyluridine-3'-phosphate sU 2'-O-methyluridine-3'-phosphorothioate sfU 2'-Fluorouridine-3'-phosphorothioate

[0082] Example 2: Preparation of siRNA

[0083] All siRNA sequences used in Example 1 were commissioned to be synthesized by Suzhou Ouli Biopharmaceutical Technology Co., Ltd.

[0084] Example 3: Sequence knockdown effect screening

[0085] 1) The pharmacodynamic activities of the GalNAc-conjugated siRNAs targeting XDH in Table 3 were analyzed in goslings (1 week old) after intramuscular injection of siRNA:

[0086] Each GalNAc-coupled siRNA was set at one dose concentration (3 mg / kg), and each animal was given a single intramuscular injection. Goose liver samples were collected on the 7th day after administration, and the XDH mRNA levels in all samples were analyzed by RT-qPCR. The goose liver tissue was lysed using a lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After oscillation and mixing, it was allowed to stand at room temperature for 2-3 minutes, centrifuged, and the supernatant after stratification was transferred to a well plate and combined with the binding buffer. The total RNA was extracted using an automated nucleic acid extractor.

[0087] 2) Prepare the qPCR system on ice. Add 1μL One SteP SYBR Green Mix, 10μL 2*One SteP SYBR Green Mix, 0.4μL gYJV-001 3P F, and 0.4μL gYJV-001 3P R to each well. Dilute the total RNA of liver tissue in 8.2μL RNase deionized water and add it to the wells. Mix well and place in the qPCR instrument for reaction.

[0088] qPCR reaction conditions: 50°C, 15 min pre-denaturation; 95°C, 1 min, 95°C annealing for 15 s, 60°C extension for 1 min, for 39 cycles.

[0089] PCR Primers:

[0090] Target name Sequence (5'-3') XD gYJV-001 3P F GCCTACAACCCTCCAGGAAC (SEQ ID NO:91) XD gYJV-001 3P R TTTCAGCGATCCATGCTGGT (SEQ ID NO:92)

[0091] The screening results are shown in Table 5:

[0092] Table 5

[0093] sequence name Inhibition rate (%) STDEV YJV-001-1842 m2-L96 92.2 39.4 YJV-001-1850 m2-L96 84.6 2.0 YJV-001-4377 m2-L96 60.3 13.7 YJV-001-4378 m2-L96 45.4 3.1 YJV-001-5818 m2-L96 67.0 72.6 YJV-001-5819 m2-L96 73.3 1.0 YJV-001-6624 m2-L96 23.9 6.0 YJV-001-6699 m2-L96 16.4 19.7 YJV-001-6840 m2-L96 40.5 15.3 YJV-001-7500 m2-L96 55.5 62.8

[0094] As shown in Table 5 , among the 10 pairs of siRNA conjugates conjugated to L96, 6 pairs of sequences had an inhibition rate of more than half, among which YJV-001-1842 m2-L96 had the highest inhibition rate of 92%, and was therefore used in subsequent experiments.

[0095] Example 4: Effect of siRNA on lowering blood uric acid

[0096] 1) The effects of GalNAc-conjugated siRNA targeting XDH (YJV-001-1842 m2-L96) on serum uric acid levels were analyzed in goslings after subcutaneous injection of siRNA.

[0097] 2) Twenty one-week-old goslings were enrolled, and 10 of them were randomly selected for a single intramuscular injection (0.1 mg / goose). The blood uric acid levels of the geese were tested 7 days after the administration.

[0098] The results are as follows Figure 1 As shown, the blood uric acid concentration of geese in the control group was 62.48 μg / mL, and the blood uric acid concentration of geese in the drug-treated group was 48.45 μg / mL, indicating that the siRNA conjugate can significantly reduce the blood uric acid level of geese.

[0099] Example 5: Therapeutic effect on the incidence of gout in geese

[0100] 1) The inhibitory effect of GalNAc-conjugated siRNA (YJV-001-1842 m2-L96) targeting XDH on the incidence of gout in geese was analyzed in goslings after subcutaneous injection of siRNA.

[0101] 2) Randomly select 1000 goslings out of 2000 goslings that are just one day old and give them medication (0.1 mg / gosling). Then place them together with the rest of the goslings and count the number of goslings that develop gout within three weeks and calculate the incidence of gout.

[0102] The results are as follows Figure 2 As shown, the morbidity rate of the geese in the control group was 21.6%, while that of the geese in the drug-treated group was only 4.5%, indicating that the XDH siRNA can significantly reduce the number of geese that get sick.

[0103] In addition, some diseased geese and geese that did not develop the disease after treatment were selected for autopsy. Figure 3 As shown, obvious white urate deposits appeared outside the cardiac capsule of the diseased goose ( Figure 3 Left), while the internal organs of the unaffected geese after treatment were normal ( Figure 3 Right), indicating that gout in geese can be effectively treated after administration.

[0104] The series of detailed descriptions listed above are only specific descriptions of feasible implementation methods of the present invention. They are not intended to limit the scope of protection of the present invention. Those skilled in the art can design many other modifications and implementation methods, which will fall within the scope and spirit of the principles disclosed in this application. More specifically, within the scope of the disclosure, drawings and claims of this application, various modifications and improvements can be made to the components and / or layout of the subject combination layout. In addition to the modifications and improvements made to the components and / or layout, other uses will also be obvious to those skilled in the art.

Claims

1. A siRNA for inhibiting XDH gene expression, characterized in that: The siRNA comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially reverse-complementary to form a double-stranded region, and the siRNA is used as a drug for treating gout, and the siRNA is any one of the following (1) to (10), (1) The sense strand is CCCUCAGCUUCUUCUUCAANn (SEQ ID NO: 51), and the antisense strand is UUGAAGAAGAAGCUGAGGGNn (SEQ ID NO: 61); (2) The sense strand is GCUUCUUCUUCAAAUUCUANn (SEQ ID NO: 52), and the antisense strand is UAGAAUUUGAAGAAGAAGCNn (SEQ ID NO: 62); (3) The sense strand is GGACUAUAAUGAAAAAAAANn (SEQ ID NO: 53), and the antisense strand is UUUUUUUUUCAUUAUAGUCCNn (SEQ ID NO: 63); (4) The sense strand is GACUAUAAUGAAAAAAAAANn (SEQ ID NO: 54), and the antisense strand is UUUUUUUUUUCAUUAUAGUCNn (SEQ ID NO: 64); (5) The sense strand is GGCAAUAUGUUAAAAAAAANn (SEQ ID NO: 55), and the antisense strand is UUUUUUUUAACAUAUUGCCNn (SEQ ID NO: 65); (6) The sense strand is GCAAUAUGUUAAAAAAAAANn (SEQ ID NO: 56), and the antisense strand is UUUUUUUUUAACAUAUUGCNn (SEQ ID NO: 66); (7) The sense strand is GGGAGUGAUAUAAAAUCAANn (SEQ ID NO: 57), and the antisense strand is UUGAUUUUAUAUCACUCCCNn (SEQ ID NO: 67); (8) The sense strand is GGAGACCAAUGGAAAUUUANn (SEQ ID NO: 58), and the antisense strand is UAAAUUUCCAUUGGUCUCCNn (SEQ ID NO: 68); (9) The sense strand is GGAACUAAGUGUCAGAUAANn (SEQ ID NO: 59), and the antisense strand is UUAUCUGACACUUAGUUCCNn (SEQ ID NO: 69); (10) The sense strand is GCAAAAUAAAACUAAAAAANn (SEQ ID NO: 60), and the antisense strand is UUUUUUAGUUUUUAUUUUGCNn (SEQ ID NO: 70); Wherein N is any one of G, U, A, C, T, dG, dU, dA, dC, and dT; n is the number of N, and n is an integer from 0 to 3.

2. The siRNA according to claim 1, wherein The N is any one of G, U, A, and C, and the n is 2.

3. The siRNA according to claim 1, wherein The n is 0.

4. The siRNA according to claim 2, characterized in that Combinations of 2 Ns include GU, UG, UA, AU, CC, CU, AA, AG, CA, GG, and CG.

5. The siRNA according to claim 4, characterized in that The siRNA is selected from YJV-001-1842, YJV-001-1850, YJV-001-4377, YJV-001-5818, YJV-001-5819, and YJV-001-7500.

6. The siRNA according to claim 5, characterized in that At least one nucleotide in the siRNA is modified; the modified nucleotide is selected from one or more of a sugar moiety modified at the 2' position, or at least one phosphate group is a phosphate group containing a modified group, or a nucleotide analog.

7. The siRNA according to claim 6, characterized in that The nucleotides modified with the sugar moiety at the 2' position include 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethoxyethyl (2'-O-DMAEOE) or 2'-ON-methylacetamido (2'-O-NMA) modified nucleotides.

8. The siRNA according to claim 6, characterized in that The phosphate group containing a modified group is specifically a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond with a sulfur atom.

9. The siRNA according to claim 6, characterized in that The nucleotide analogue is selected from one of an isonucleotide, LNA, ENA, cEtBNA, UNA or GNA.

10. The siRNA according to any one of claims 1 to 9, characterized in that The structures of the sense strands of the modified siRNA molecules are shown in SEQ ID NOs: 21-30; the structures of the antisense strands of the modified siRNA molecules are shown in SEQ ID NOs: 31-40.

11. A siRNA conjugate, characterized in that The siRNA conjugate contains the siRNA according to any one of claims 1 to 10 and a ligand conjugated to the siRNA, wherein the ligand includes GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, and N-acetylglucosamine derivatives or analogs.

12. A biological material, which is any of the following: 1) A vector containing the siRNA according to any one of claims 1 to 9 or the siRNA conjugate according to claim 11; 2) A reagent or a kit comprising the siRNA according to any one of claims 1 to 9 or the siRNA conjugate according to claim 11 or the vector according to 1); 3) A pharmaceutical composition, consisting of the siRNA molecule according to any one of claims 1 to 9 or the siRNA conjugate according to claim 11 and other pharmaceutically acceptable components.

Images