Application of lemon CiKNOX I gene in regulation and control of fruit ripening

Abstract

The invention provides a lemon CiKNOX I gene and application of the lemon CiKNOX I gene in regulation and control of tomato and citrus fruit maturity, the lemon CiKNOX I gene belongs to a member of KNOX family Class 1 (KNOX I), the CDS sequence of the lemon CiKNOX I gene is shown as SED ID NO.1, and the amino acid coded by the lemon CiKNOX I gene is shown as SED ID NO.2. Through construction of an over-expression vector or a silence vector of the gene, tomato and citrus are transfected by means of an agrobacterium tumefaciens-mediated genetic transformation system, and phenotype observation and analysis verification results show that the CiKNOX I gene has the function of remarkably regulating the fruit ripening process; the invention provides a new gene resource for designing and breeding according to the fruit maturity process.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to lemon CiKNOX Ⅰ Application of genes in regulating fruit ripening. Background Art

[0002] Citrus is the world's largest fruit and a perennial woody fruit tree. It plays an indispensable and key role in my country's horticultural economic system. In my country's citrus product consumption structure, fresh consumption occupies a dominant position. At present, the time period for the maturity of citrus in my country is mainly concentrated in the period from November to February of the following year. However, the number of high-quality citrus varieties that are early-maturing and late-maturing is still relatively scarce. This situation has led to a significant gap in the time dimension of my country's fresh fruit supply from achieving the ideal goal of year-round balanced supply. This unbalanced market supply pattern cannot fully meet consumers' continuous demand for fresh citrus fruits, which in turn has an extremely adverse impact on the economic benefits of the citrus planting industry.

[0003] Similarly, tomatoes, as a widely grown and popular fruit and vegetable category in the world, occupy a pivotal position in the vegetable industry. Tomatoes are consumed in a variety of ways. However, the current ripening and picking period of land-grown tomatoes in my country is mainly concentrated in the summer from June to August. Early-maturing and late-maturing high-quality tomato varieties are relatively scarce, which makes it difficult to fully meet the diversified needs of the market at different times. This unbalanced supply pattern is not only not conducive to maintaining the stability of market prices, but also has a negative impact on the overall economic benefits of the tomato industry.

[0004] Based on this, systematic analysis of the regulatory mechanism in the process of crop fruit ripening and in-depth exploration of the key genes involved in maturity regulation will undoubtedly have important economic value for promoting the scientific breeding of new varieties of crops with different maturity periods and promoting the optimization and improvement of the industry's maturity structure. Summary of the invention

[0005] In view of this, the present invention provides lemon CiKNOX Ⅰ The application of genes in regulating fruit ripening can lay the foundation for systematic analysis of the regulatory mechanisms in the process of crop fruit ripening.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: One of the objects of the present invention is to provide a lemon CiKNOX Ⅰ Application of genes in regulating fruit ripening, the CiKNOX Ⅰ The CDS sequence of the gene is shown in SED ID NO.1.

[0007] The second object of the present invention is to provide the above-mentioned lemon CiKNOX ⅠThe protein encoded by the gene, the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0008] Furthermore, the above application is specifically embodied as follows: When overexpression CiKNOX Ⅰ When the gene is expressed, the fruit matures earlier than the wild type; when CiKNOX Ⅰ When the gene is suppressed, the fruit matures later than the wild type; The fruits include tomatoes and citrus fruits.

[0009] The third object of the present invention is to provide the above-mentioned lemon CiKNOX Ⅰ Recombinant gene expression vector.

[0010] In some specific embodiments, preferably, when the recombinant expression vector is an overexpression vector, pBI121 is used as the expression vector, and homologous recombination is used to fuse the target gene fragment with the vector for construction; When the recombinant expression vector is a silencing vector, pTRV2 is used as the expression vector and homologous recombination is used to fuse the target gene fragment with the vector for construction.

[0011] In some specific embodiments, preferably, when constructing a recombinant expression vector, CiKNOX Ⅰ The forward primer sequence used for gene cloning is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4.

[0012] In some specific embodiments, preferably, the forward primer sequence used for amplification when constructing the overexpression vector is as shown in SEQ ID NO.5, and the reverse primer sequence is as shown in SEQ ID NO.6; The forward primer sequence used for amplification when constructing the silencing vector is shown in SEQ ID NO.7, and the reverse primer sequence is shown in SEQ ID NO.8.

[0013] A fourth object of the present invention is to provide an engineered bacterium containing the above-mentioned recombinant expression vector.

[0014] A fifth object of the present invention is to provide a method for regulating the fruit ripening cycle process, comprising the following steps: By infecting plants or fruits with the above-mentioned engineered bacteria and identifying the transgenic positives, the fruit ripening cycle can be regulated.

[0015] Furthermore, when the above-mentioned engineered bacteria contain an overexpression vector, the fruit can be ripened early; when the above-mentioned engineered bacteria contain a silencing vector, the fruit can be ripened delayed.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses gene cloning technology to separate and clone the lemon fruit ripening gene from lemon CiKNOX Ⅰ By constructing overexpression vectors and silencing vectors, the gene was further transformed into orange and tomato using the Agrobacterium-mediated genetic transformation system, and it was found that it has the function of regulating the fruit ripening process. CiKNOX Ⅰ The gene causes tomato fruit to break color significantly earlier than the wild type; it is overexpressed in Sijiju CiKNOX Ⅰ The gene also causes the fruit to change color earlier than the wild type; it is silent in the four-season orange CiKNOX Ⅰ The gene causes the fruit to change color later than the wild type. This research discovery provides excellent genetic resources for the subsequent breeding of crops with controllable maturity time. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 for CiKNOX Ⅰ Diagram of the genetic transformation process of TS-82 tomato and gel image of DNA positive identification of transgenic positive seedlings.

[0018] Figure 2 For overexpression CiKNOX Ⅰ Actual photos of the fruits of the genetically modified tomatoes and the control group (AC) and the statistical results of the fruit color change days (D), firmness (E), soluble solids (F), and fruit shape index (G).

[0019] Figure 3 for CiKNOX Ⅰ Phenotypic observation after transient overexpression of the gene in Citrus grandis.

[0020] Figure 4 The results of the transient transformation of the four-season orange with the engineering bacteria containing the overexpression vector and the control group are shown in the figure, including the fruit color index (A), soluble solids content (B), titratable acid content (C), solid-acid ratio (D), lutein content (E), chlorophyll content (FG), and gene expression level (H).

[0021] Figure 5 for CiKNOX Ⅰ Phenotypic observation after transient silencing of the gene in Citrus grandis.

[0022] Figure 6 The results of the transient transformation of Siji tangerine with the engineered bacteria containing the silencing vector and the control group are shown in the graph of fruit color index (A), soluble solids (B), titratable acid (C), solid-acid ratio (D), lutein (E), chlorophyll content (FG), and gene expression (H). DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0024] Sources and physical and chemical parameters of key test materials: Example 1 This embodiment provides fruit ripening regulation CiKNOX Ⅰ A method for cloning a gene belonging to KNOX Family Class 1 ( KNOX Ⅰ ) members, the specific steps are as follows: (1) RNA extraction from lemon leaves Take fresh plant tissue (lemon leaves) and grind them thoroughly in liquid nitrogen or cut the plant tissue into pieces and grind them quickly in TRIpure. Add 1 mL TRIpure to every 50-100 mg of plant tissue, mix well, and keep it on ice throughout the operation. Add 0.2 ml of pre-cooled chloroform to every 1 mL of TRIpure. Cover the tube tightly, shake vigorously for 15 seconds and leave it for 2-3 minutes. Centrifuge at 4℃ and 12000rpm for 15 minutes. Take the supernatant (about 500μL) and transfer it to a clean 1.5 mL RNAasefree centrifuge tube, add an equal volume of pre-cooled isopropanol, mix well by inversion, and place it in a -20℃ refrigerator for 30 minutes. Centrifuge at 4℃ and 12000rpm for 10 minutes and discard the supernatant. Add 1 mL of pre-cooled 75% ethanol to wash the precipitate, centrifuge at 4℃ and 12000rpm for 5 minutes, and discard the supernatant. The remaining small amount of liquid can be centrifuged briefly and then aspirated with a pipette tip. Be careful not to aspirate the precipitate. Place on ice for 2-3 minutes and air dry. Add 30 μL RNase free water to fully dissolve the RNA. Take 3 μL RNA solution for electrophoresis to check the extraction quality. The remaining RNA can be directly used for reverse transcription or stored at -80°C to prevent degradation.

[0025] (2) Reverse transcription The reverse transcription kit HiScript was used from Nanjing Novozyme Biotechnology Co., Ltd. ® II Q RT SuperMixfor qPCR (+gDNA wiper) for reverse transcription reaction. All operations were carried out in a clean bench, and the reaction steps were as follows: a. Genomic DNA removal Prepare the following mixture in an RNase-free centrifuge tube:

[0026] Use a pipette to mix gently and incubate at 42°C for 2 min.

[0027] b. Prepare the reverse transcription reaction system Add 5×HiScript II qRT SuperMix II to the reaction tube in step a:

[0028] Mix by gently pipetting.

[0029] c. The reverse transcription reaction procedure is:

[0030] After the reaction is completed, store it at 4°C for future use and store it in a -80°C refrigerator for a long time.

[0031] (3) CiKNOX Ⅰ Gene CDS region cloning The total cDNA obtained by reverse transcription of lemon leaf tissue RNA was used as a template and the high-fidelity DNA polymerase Phanta ® PCR amplification was performed using the Max Super-Fidelity DNA Polymerase Kit.

[0032] Among them, the forward primer was 5′-ATGGAGGGTTACAACAGTCT-3′ (SEQ ID NO. 3); The reverse primer was 5'-TCATGGTCCCAAACGGTATG-3' (SEQ ID NO. 4).

[0033] All operations were performed on ice. After thawing, each group was fully mixed and stored at -20°C immediately after use. The amplification reaction system was as follows:

[0034] The PCR amplification procedure is as follows:

[0035] After the PCR amplification reaction is completed, the product is taken out, and after gel electrophoresis detection, it is placed in a 4°C refrigerator for short-term storage, and the target fragment is subsequently recovered.

[0036] Example 2 This example provides overexpression vector construction and Agrobacterium transformation, as follows: The overexpression vector was constructed by using pBI121 as the expression vector and homologous recombination to construct the fusion of the target gene fragment and the vector. The reagents used were ClonExpress from Nanjing Novozyme Biotechnology Co., Ltd. ® IIOne StepCloning Kit, the specific experimental steps are as follows: 1) Use restriction endonucleases XbaⅠ and XhoⅠ to double-digest the pBI121 vector plasmid. After digestion at 37℃ for 1 hour, the linearized vector was recovered.

[0037] 2) Design recombination primers and use CiKNOX Ⅰ The cloned product of the gene CDS region was used as a template for PCR amplification. The recombination forward primer was: 5′-AGAACACGGGGGACTCTAGAGAGGGTTACAACAGTCT-3′ (SEQ ID NO. 5); The recombination reverse primer is: 5'-GGGATCCGCGGCCGCTCGAGTCATGGTCCCAAACGGT-3' (SEQ ID NO. 6).

[0038] 3) Amplification reaction system and CiKNOX Ⅰ The gene CDS region amplification system is consistent, and the recombinant amplification product is recovered.

[0039] 4) After the linearized vector and target gene fragment are prepared, the recovery concentration is measured, the ratio between the two is adjusted, and the ligation reaction is carried out at 37°C. The specific recombination ligation reaction system is as follows:

[0040] 5 minutes before the end of the connection, take out the competent DH5α from the -80℃ refrigerator and thaw it on ice. Add all the ligation products to the DH5α competent cells and mix them with a pipette. After ice bathing for 30 minutes, heat shock them at 42℃ in a mixer for 90 seconds, and then place them on ice for 1 minute. Add 400μL of blank LB liquid culture medium and incubate them at 220r / min on a 37℃ shaker for 1 hour. Centrifuge at 12000rpm for 1 minute, aspirate the supernatant, keep 100μL of the supernatant, mix them by aspiration, and apply them to the LB solid culture dish with kanamycin, and invert and culture them in a 37℃ incubator overnight.

[0041] 5) Pick monoclonal plaques for PCR detection, send the positive bacterial solution to the company for sequencing, and then perform sequence comparison analysis to finally determine that the vector construction is successful.

[0042] 6) Extract the plasmid from the correctly sequenced E. coli solution. Refer to the instructions of the E. coli plasmid extraction kit of Adelaide Biotechnology Company for the extraction method of the plasmid. Transfer the extracted plasmid into Agrobacterium competent GV3101. The specific operation steps are as follows: Take the competent Agrobacterium GV3101 out of the -80℃ freezer and freeze-thaw on ice, add 0.1~1μg plasmid, place on ice for 5min, freeze in liquid nitrogen for 5min, quickly take out and warm in a 37℃ thermostat for 5min, and place on ice for 5min. Add 800μL blank liquid LB medium to the competent cells and activate at 220r / min on a 28℃ shaker for 3h. Centrifuge at 12000rpm for 1min, discard the supernatant, keep 100μL bacterial solution, mix by pipetting, and apply to LB solid culture dish with kanamycin and rifampicin, and invert and culture in a 28℃ constant temperature incubator for 2~3 days.

[0043] 7) Pick out single clone plaques for PCR detection, mix the positive clone bacterial solution with 50% glycerol in a 1:1 ratio and store in a -80℃ refrigerator for later use. It can be used for plant transformation after activation.

[0044] Example 3 In this example, genetic transformation of tomatoes was performed using the positive clone solution obtained in Example 2. The specific steps are as follows: 3.1 Tomato inoculation The specific preparation steps are as follows: soak the required seeds in water for 15 minutes, stir and wash with 75% alcohol for 1-2 minutes, wash the seeds with 50% sodium hypochlorite solution for 15 minutes, wash the seeds with sterilized water 4-5 times, use sterile filter paper to absorb the moisture on the surface of the seeds, inoculate them on 1 / 2MS culture medium, and culture them under 16h light and 25℃ conditions for one week until the two cotyledons unfold.

[0045] 3.2 Preparation of Agrobacterium transformation infection medium Before genetic transformation of tomatoes, Agrobacterium needs to be activated to keep the bacteria in a good active state for the preparation of transformation infection solution. The specific steps are as follows: Strain activation: connect the pBI121 overexpression vector CiKNOX Ⅰ The Agrobacterium tumefaciens culture liquid was inoculated into a solid LB medium supplemented with kanamycin and rifampicin, and incubated upside down in a constant temperature incubator at 28°C for 2 days, i.e., the first activation was performed.

[0046] Colony propagation: Pick Agrobacterium monoclonal test to confirm positive bacteria, shake them, shake and mix them, re-inoculate them into solid LB medium with kanamycin and rifampicin, and culture them upside down in a constant temperature incubator at 28℃ for 2 days, that is, perform the second activation.

[0047] Prepare infection solution: scrape all bacteria into MS suspension medium, place in a constant temperature shaker at 220r / min and 28℃ for 1 hour to completely disperse the bacteria. Use UV spectrophotometer to measure the concentration of the suspension and adjust OD 600When the value is between 0.4 and 0.6, add acetosyringone (AS, 50 mg / L) and place in a constant temperature incubator at 28°C for later use.

[0048] 3.3 Infection and co-cultivation process The tomato cotyledons are co-cultured with the prepared infection solution. The specific steps of the process are as follows: a) Infection process: In a clean bench, use a sterile scalpel to cut off the tip and the intersection of the leaf blade and petiole of a tomato cotyledon that has been cultured for one week on sterile filter paper. The cut should be a trapezoidal shape of about 0.5 cm in length. The cut should be as inclined as possible to increase the cut area to promote transformation. The cut should be immediately placed in MS suspension culture medium to keep the cut moist to prevent the explant cut from drying out and losing water, which would affect the transformation efficiency. Soak all the cut explants in the prepared Agrobacterium infection solution, seal the mouth of the triangular flask with a sealing film, and place it in a constant temperature shaker at 220 r / min and 28°C for 20 minutes.

[0049] b) Co-cultivation process: In a clean bench, pour off the bacterial solution, use sterile filter paper to absorb the Agrobacterium infection solution remaining on the surface of the explant, keep the cotyledon with the back facing up, and place it in the co-cultivation medium (MS+AS, 50 mg / L) covered with a layer of sterile filter paper, and co-cultivate in a 21°C incubator under dark conditions for 2 days.

[0050] 3.4 Screening and culture The cotyledons were cultured for 48 hours and screened for two weeks using a screening medium containing kanamycin (MS+IAA 1mg / L+ZR 1mg / L+Tim 300mg / L +Km50mg / L+Agar 8g / L). During the screening culture, the cotyledons faced upward.

[0051] 3.5 Subculture After culturing for 2 weeks, transfer the explants with good growth to the subculture medium (MS+ZR 1mg / L+Tim 300mg / L+Km 50mg / L+Agar 8g / L) and subculture for about two weeks. Keep the callus tissue and adventitious buds with good growth and continue to culture for about two weeks.

[0052] 3.6 Rooting culture When the adventitious buds grow to 2-3 cm, they are cut off from the roots and transferred to rooting medium (MS+IBA 1mg / L+Agar 8g / L) to induce rooting.

[0053] Example 4 This example performs positive identification on the transfected plants obtained in Example 3, and finally determines the positive transgenic material. The specific steps are as follows: DNA was extracted from the obtained tomato materials, and PCR amplification was used to identify the positive situation, that is, to determine that the target gene fragment was successfully transferred into the plant material.

[0054] 4.1 DNA extraction from tomato leaves Pick an appropriate amount of fresh plant leaves and put them into a 2.0mL centrifuge tube filled with small steel balls. Mark them and quickly put them into liquid nitrogen for quick freezing. Pre-cool the adapter in the sample grinder with liquid nitrogen, place the 2.0mL centrifuge tubes containing samples and small steel balls symmetrically in the adapter, cover the lid, set the frequency to 40Hz, the time to 30sec, and grind the sample twice.

[0055] After the sample is ground, check whether the sample is completely ground (no complete tissue, just uniform crumbs), open the lid of the centrifuge tube in time, immediately add 1mL of DNA extraction solution (100mL CTAB + 2% β-mercaptoethanol), cover the lid, mix by inverting 7-8 times, and bathe in a 65℃ water bath for 30 minutes, mixing by inverting 7-8 times every 10 minutes.

[0056] After the water bath, the sample was temporarily stored in a fume hood and cooled to room temperature. The lid was opened and 800 μL of chloroform was added. The sample was mixed by inverting 7-8 times. The sample was centrifuged at 12,000 r / min for 15 min. About 800 μL of the supernatant was pipetted into a new 1.5 mL centrifuge tube.

[0057] Add an equal volume of pre-cooled isopropanol to the centrifuge tube, mix thoroughly by inversion, and precipitate in a -20°C refrigerator for 40 minutes (or overnight).

[0058] Take out from -20℃ refrigerator, centrifuge at 12,000r / min for 15min in a centrifuge precooled at 4℃, discard the supernatant, and wash twice with 75% ethanol.

[0059] Centrifuge at 12,000 r / min for 2 min in a 4°C precooled centrifuge, discard the residual liquid with a pipette, dry in a fume hood for 2-3 min, add 40 μL ddH2O, and store at -20°C until the DNA is completely dissolved.

[0060] 4.2 DNA positive identification Positive plants were identified using gene forward and reverse primers. Among the selected transgenic lines, if any transgenic lines could amplify fragments of the expected size, it indicated that they were positive transgenic lines. Ultimately, 11 positive plants were verified.

[0061] Example 5 This example further performs phenotypic observation and detection analysis on the positive plants obtained in Example 4, as follows: (1) Fruit shape index: Use a vernier caliper to measure the horizontal and vertical diameters. Fruit shape index = vertical diameter / horizontal diameter, and calculate the average value. The unit of measurement is mm.

[0062] (2) Fruit hardness measurement: Use the GY-3 fruit hardness tester to measure. Randomly select four points at the top, equator and bottom of the fruit and peel off the peel at the corresponding points. Hold the fruit tightly with one hand and slowly insert the hardness tester plug vertically into the fruit with the other hand. Stop inserting when the plug reaches the scale line and record the data (unit: kg / cm 2 or N).

[0063] (3) Peel color measurement: Use a desktop spectrophotometer. Clean the peel surface and randomly select four points at the top, equator and bottom of the fruit for measurement. The lighting geometry is 0 / d, the standard lighting body is D65, and the field of view is 10°. Record , , value. It is a brightness variable, and the larger the value, the brighter the surface of the sample being measured; is the red-green color, positive values ​​are red and negative values ​​are green; It is the yellow-blue degree, positive value is yellow degree, negative value is blue degree.

[0064] (4) Determination of soluble solids: The soluble solids content was determined using a PAL-1 handheld refractometer (Atago, Japan). Representative ripe fresh fruits were randomly divided into three groups. Four fruits in each group were cut longitudinally and half of the pulp was taken. The juice was filtered and the mixed filtrate was taken for determination. The sugar meter was zeroed with distilled water before each use of the instrument. Before measuring the sample, it was necessary to mix it evenly and rinse it with the liquid to be tested. The measurement was performed at least three times until the reading was stable, and the data was recorded.

[0065] (5) Titratable acid content determination: The total organic acid content was determined using a GMK-835F fruit acidometer (G-WON, South Korea). The specific method is as follows: Representative fruits were divided into three groups on average, 3-5 parts were taken from different parts of the fruit, the peel was peeled, the pulp was squeezed into juice using a juicer, and filtered with a gauze filter. The juice cup should be cleaned in time between each repeated juicing process to obtain freshly squeezed juice samples for later use. When measuring, the juice was first diluted, 30 mL of distilled water was poured into a small bottle, 0.306 mL of juice was drawn in, mixed and then measured, and the values ​​were measured 3 times, the average reading was taken as the standard, and the data was recorded.

[0066] (6) Chlorophyll and lutein extraction method: The extraction adopts acetone grinding method. Weigh 0.25g peel powder into a 10mL centrifuge tube, add 5mL acetone, shake well, seal with sealing film, extract in a dark environment of 4℃ refrigerator for 12h, centrifuge at 3500r for 10min, collect the supernatant, extract the residue once with 2mL acetone, combine the supernatant, transfer to a separatory funnel, first add 5mL ether to the separatory funnel, shake gently, then slowly add 10mL ultrapure water, shake gently, let stand for a while, let the liquid separate, filter out the lower aqueous phase, filter the upper dark green ether phase with 10mL ultrapure water, take the upper dark green ether extract, blow nitrogen and concentrate to 2mL. Take 1mL ether extract and pass it through a membrane (0.22μm), transfer it to a brown injection bottle, seal it with sealing film, and test it on the machine.

[0067] Chlorophyll and lutein analysis method: The chromatographic column is a ZORBAX SB-C18 reverse phase column (4.6mm×150mm, 5.0μm, Agilent). The injection volume is 10μL, the detection wavelength is 450nm, and the column temperature is set to 35℃; the mobile phase A is methanol and ultrapure water in a ratio of 3:1, and the mobile phase B is ethyl acetate, and the flow rate is set to 1mL / min; the linear elution gradient is as follows: 0-10min, 20%-30%B; 10-30min, 30%-80%B; 30-35min, 80%B; 35-40min, 80%-20%B. The qualitative pigment components are compared by the external standard method, and then the concentration of each component (mg / mL) is calculated according to the standard curve. The calculation formula for the chlorophyll component content is as follows: Pigment content (g / g DW) = (y×L1) / M×100 Where: L1 is the total volume of the extract (mL); M is the sample mass (g); y is the pigment concentration calculated from the standard curve.

[0068] Fruit skin color change indicates the beginning of ripening and is often used to determine the onset of fruit ripening. CiKNOX Ⅰ Phenotypic observations were conducted on tomatoes, and statistical analysis was performed on the time required for the material to start coloring from full bloom to the fruit starting to color, i.e., the number of days to color. CiKNOX Ⅰ The fruit of the overexpression strain breaks color earlier than the wild type (WT). Figure 2 , the wild type fruits start to color around 55 days, CiKNOX Ⅰ The fruits of the overexpression strain began to color around 44 days. CiKNOX Ⅰ The days for tomato fruits with the gene to break color are about 11 days earlier than those of the wild type (WT).

[0069] Example 6 This embodiment is established for four seasons orange CiKNOX ⅠGene overexpression plants and silenced plants were grown, and the ripening process of the four-season orange fruit was observed, as follows: 1. Construction of VIGS silencing vector Based on the above constructed CiKNOX Ⅰ The overexpression vector plasmid was used as a template and amplified using VIGS recombination primers. CiKNOX Ⅰ The specific fragment of 500bp was used Bam HⅠ enzyme and Sma Ⅰ enzyme was connected to the pTRV2 vector to obtain CiKNOX Ⅰ -pTRV2 vector plasmid. After the vector construction is completed, the plasmid is extracted and transformed into Agrobacterium competent GV3101.

[0070] The recombination forward primer is: 5'-GAAGGCCTCCATGGGGATCCGCTATTAAAGCCAAGATCATC-3' (SEQ ID NO. 7); The recombination reverse primer is: 5'-GTCTTCGGGACATGCCCGGGGGACAGTTCTTGTTTGAGGCT-3' (SEQ ID NO. 8).

[0071] 2. Instant transformation into four-season orange The overexpression vector pBI121- CiKNOX Ⅰ The Agrobacterium culture liquid containing no pBI121 was activated in LB solid medium for 2 days; the silencing vector pTRV2- CiKNOX Ⅰ The Agrobacterium culture liquid containing no pTRV1 or pTRV2 was activated in LB (Kana) fixed medium for 2 days, and then reactivated for 1 day for subsequent genetic transformation. The detailed steps of Agrobacterium-mediated transient transformation of Citrus aurantium are as follows: Pick pBI121, pBI121- CiKNOX Ⅰ , pTRV1, pTRV2 and pTRV2- CiKNOX Ⅰ Agrobacterium monoclones were activated in 2 mL of LB liquid medium containing the corresponding antibiotics in a shaker at 28°C, 220 r / min overnight (50 mg / L Kan, 25 mg / L Rif). The activated Agrobacterium liquid was inoculated into fresh LB medium containing antibiotics and cultured at 28°C overnight. The cells were collected by centrifugation at 6000×g, and the infection buffer (10 mmol / L MES, 10 mmol / L MgCl2, 20 mg / LAS, pH 5.6-5.7) was added to suspend the cells and adjust the OD 600 to 0.8-1.0. Mix pTRV1, pTRV2 and pTRV2- CiKNOX Ⅰ The bacterial resuspension can be used for infection after culturing in the dark at 28℃ for 2-3 hours.

[0072] Cut off part of the syringe needle, leaving about 0.1-0.3cm in length, and inject 100µL of infection solution into each fruit. The injection process needs to be advanced slowly and evenly, and the part where the infection solution reaches the subcutaneous layer of the fruit can be seen with the naked eye. 20 days after infection, take photos of the fruit maturity phenotype and measure indicators such as soluble solids, titratable acid, lutein, and chlorophyll.

[0073] 3. Identification of genes in transformed fruit of Siji tangerine by qRT-PCR CiKNOX Ⅰ The expression of The RNA of the successfully injected mandarin orange was extracted and reverse transcribed to synthesize cDNA (the RNA extraction method was the same as in Example 1), and the cDNA obtained by reverse transcription was diluted 2 times with ddH2O as a template. CiKNOX Ⅰ The quantitative primers for the genes are: CiACTIN-qPCR-F:CCGACCGTATGAGCAAGGAAA (SEQ ID NO.9); CiACTIN-qPCR-R:TTCCTGTGGACAATGGATGGA (SEQ ID NO. 10); CiKNOX Ⅰ -qPCR-F:AGCCTACGTGGATTGCCAAA (SEQ ID NO.11); CiKNOX Ⅰ -qPCR-R: GCCTTGTTAGCTCTTCCCGA (SEQ ID NO. 12).

[0074] Identification of genes using qRT-PCR CiKNOX Ⅰ The expression level can be judged CiKNOX Ⅰ The expression level of the gene in the transformed fruit of Mandarin orange.

[0075] 4. Observation of transgenic citrus fruit phenotype The empty control group and the CiKNOX Ⅰ The fruit color changes of gene overexpression strains and silenced strains were shown in (see Figure 3 , 5 ) The color change time of the overexpression strain fruit was earlier than that of the wild type, and the color change speed of the silent strain fruit was slower than that of the wild type. After calculating the lutein and chlorophyll contents (see Figure 4 , 6 ), and found that the lutein of the silenced strain was significantly lower than that of the control, while the opposite was true for chlorophyll; the lutein of the overexpression strain was significantly higher than that of the control, while the opposite was true for chlorophyll.

[0076] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0077] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Lemon CiKNOX Ⅰ The application of the gene in regulating fruit ripening is characterized in that: Said CiKNOX Ⅰ The CDS sequence of the gene is shown in SED ID NO.

1.

2. The lemon according to claim 1 CiKNOX Ⅰ The protein encoded by the gene is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The application is specifically embodied as follows: When overexpression CiKNOX Ⅰ When the gene is expressed, the fruit matures earlier than the wild type; when CiKNOX Ⅰ When the gene is suppressed, the fruit matures later than the wild type; The fruits include tomatoes and citrus fruits.

4. A kind of lemon containing the lemon of claim 1 CiKNOX Ⅰ Recombinant gene expression vector.

5. The recombinant expression vector according to claim 4, characterized in that When the recombinant expression vector is an overexpression vector, pBI121 is used as the expression vector and homologous recombination is used to fuse the target gene fragment with the vector for construction; When the recombinant expression vector is a silencing vector, pTRV2 is used as the expression vector and homologous recombination is used to fuse the target gene fragment with the vector for construction.

6. The recombinant expression vector according to claim 4, characterized in that: When constructing a recombinant expression vector CiKNOX Ⅰ The forward primer sequence used for gene cloning is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.

4.

7. The recombinant expression vector according to claim 5, characterized in that The forward primer sequence used for amplification when constructing the overexpression vector is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.6; The forward primer sequence used for amplification when constructing the silencing vector is shown in SEQ ID NO.7, and the reverse primer sequence is shown in SEQ ID NO.

8.

8. An engineered bacterium containing the recombinant expression vector according to claim 4.

9. A method for regulating the progress of a fruit ripening cycle, characterized in that: The following steps are involved: The fruit ripening cycle can be regulated by infecting plants or fruits with the engineered bacteria described in claim 8 and identifying the transgenic positive.

10. The method according to claim 1, characterized in that: When the engineered bacteria described in claim 8 contain an overexpression vector, early ripening of the fruit can be achieved; When the engineered bacteria described in claim 8 contain a silencing vector, delayed ripening of fruits can be achieved.

Images