Product, use and method

Abstract

The present invention relates to products, uses and methods. The present invention relates to the production and use of Cas coding sequences and vectors comprising them. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas coding sequences in bacterial or archaeological cells.

Description

This application is a divisional application. The application date of the original application is October 14, 2019, the application number is 201980082699.1 (PCT / EP2019 / 077760), and the name of the invention is “Products, Uses and Methods”. Technical Field

[0001] The present invention relates to the production and use of Cas encoding sequences and vectors comprising them. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas encoding sequences in bacterial or archaeal cells. background The prior art describes vectors employing the CRISPR / Cas system and their uses. For example, see WO2017 / 118598, US20180140698, US20170246221, US20180273940, US20160115488, US20180179547, US20170175142, US20160024510, US20150064138, US20170022499, US20160345578, US20180155729, US20180200342, WO2017112620, WO2018081502, PCT / EP2018 / 066954, PCT / EP2018 / 066980, PCT / EP2018 / 071454, and USSN 15 / 985,658, and equivalent publications in the United States Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference. Summary of the invention

[0003] The present invention provides the following configurations.

[0004] In the first configuration A nucleic acid vector for introduction into a host cell, the vector comprising a first nucleotide sequence encoding type I Cas3 and a second nucleotide sequence encoding one or more Cascade proteins, wherein the first and second sequences are under the control of one or more promoters, and the promoter is used to express the protein in the cell.

[0005] In one example, the vector comprises an operon for expressing Cas3 and Cascade proteins from a Cas module in a cell, the module comprising nucleotide sequences encoding Cas3 and Cascade proteins, and the operon comprises the Cas module under the control of a promoter, the promoter being used to control the expression of Cas3 and Cascade proteins.

[0006] The present invention also provides a delivery vehicle comprising the vector, and a pharmaceutical composition comprising the vector or vehicle and a pharmaceutically acceptable diluent, excipient or carrier.

[0007] The present invention also provides a method of treating a disease or disorder or reducing the risk of a disease or disorder in a human or animal subject, the method comprising: administering a vector, vehicle or composition to the subject, and introducing the vector into a target host bacterial or archaeal cell in the subject (e.g., in the intestinal microbiota, lungs, eyes or blood of the subject), wherein the Cas cleaves (or otherwise modifies) one or more target sequences in the target cell and the cell is killed or the growth or proliferation of the cell is reduced.

[0008] In the second configuration A method for amplifying copies of DNA encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell, the method comprising (a) providing a production strain cell, each cell comprising a copy of the DNA, wherein each DNA comprises a nucleotide sequence encoding the Cas, wherein the nucleotide sequence is under the control of a promoter, the promoter is used to control the expression of Cas in the production strain cell, and the DNA comprises an operable origin of replication in the cell for replicating the DNA; (b) culturing the cell to allow replication of the DNA, thereby amplifying the DNA; and (c) optionally isolating copies of said DNA, Optionally wherein the promoter is an attenuated constitutive promoter.

[0009] In the third configuration In a method for amplifying copies of DNA in a population of bacterial or archaeal production strain cells, the use of an attenuated promoter in a DNA construct for increasing the yield of amplified DNA produced by a production host cell, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0010] In the fourth configuration In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, the use of an attenuated promoter in a DNA construct to reduce the toxicity of Cas in the production strain, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0011] In the fifth configuration In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, the use of an attenuated promoter in a DNA construct to reduce mutations in the DNA (optionally a Cas encoding sequence) in the production strain, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0012] In the sixth configuration In a method for amplifying copies of DNA in a population of bacterial or archaeal production strain cells, the use of an attenuated promoter in a DNA construct for promoting viability of production cells during DNA amplification, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0013] In the seventh configuration In a method for amplifying copies of DNA in a population of bacterial or archaeal production strain cells, an attenuated promoter in a DNA construct is used to reduce the occurrence of Cas cleavage of DNA, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0014] In the eighth configuration A method for increasing the yield of amplified copies of a DNA construct in a population of bacterial or archaeal production strain cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.

[0015] In the ninth configuration A method for reducing the toxicity of a functional Cas protein (optionally a Cas nuclease) in a population of bacterial or archaeal production strain cells during the process of amplifying copies of a DNA construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.

[0016] In the tenth configuration A method for reducing mutations in a DNA construct encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell population during amplification of copies of the construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.

[0017] In the eleventh configuration A method for promoting the viability of a population of bacterial or archaeal production strain cells during the amplification of copies of a DNA construct contained by the cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.

[0018] In the twelfth configuration A method for reducing the occurrence of Cas nuclease cleavage in a DNA construct in a population of bacterial or archaeal production strain cells during amplification of copies of the construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1. Type I CRISPR-Cas system targeting Clostridium difficile (C. difficile) of E. coli MG1655. (A) CRISPR Guided Vector TM ,CGV TM Design. Plasmid 1: pSC101 ori, pBAD promoter (induced by arabinose), cas3 and cascade genes. Plasmid 2: pCloDF13 ori, pTac promoter (induced by IPTG), CRISPR array. (B) Dilution series (10 1 -10 6 ). (C) CRISPR induction kills 99.9% of the population (grey bars). Growth in the absence of induction is shown in black. CGV TMCRISPR Guided Vector TM , which is a nucleic acid vector comprising a nucleotide sequence encoding a CRISPR / Cas component.

[0020] Figure 2. Type I CRISPR-Cas system of Clostridium difficile targeting Escherichia coli MG1655. (A) CRISPR Guided Vector TM ,CGV TM Design of pSC101 ori, pTac promoter (induced by IPTG), CRISPR array, pBAD promoter (induced by arabinose), cas3 and cascade genes. (B) Dilution series (10 1 -10 6 ). (C) CRISPR induction kills 99% of the population (grey bars). Growth in the absence of induction is shown in black. CGV TM Represents CRISPR Guided Vector TM , which is a nucleic acid vector comprising a nucleotide sequence encoding a CRISPR / Cas component.

[0021] Figure 3. Time-kill curves of E. coli MG1655 carrying CGV. (A) CRISPR induction killed 99% of the population in 60 minutes (dashed line). Growth in the absence of induction is shown with a black line. CRISPR / Cas was induced at time point 0 and monitored until 120 minutes. (B) Dilution series (10 1 -10 6 ).

[0022] Figure 4. Specific killing of E. coli MG1655 using the type IB CRISPR-Cas system of Clostridium difficile in a synthetic microbial consortium. (A) Bacterial counts of a synthetic population consisting of three different strains. CRISPR was induced at time point 0 and monitored for 60 minutes. Growth in the absence of induction is shown in black. CRISPR induction promoted a 1-log increase in viable cells of the target strain E. coli MG1655. 10 coli Top10 and Lactococcus lactis NZ9000 populations remained intact (dark grey bars). (B) Dilution series (10 1 -10 6). E. coli MG1655 selectively grows on BHI+streptomycin, E. coli Top10 selectively grows on ampicillin, and Lactococcus lactis NZ9000 selectively grows on chloramphenicol.

[0023] FIG5. Killing of E. coli MG1655 by the type IB CRISPR-Cas system of C. difficile in a synthetic microbial consortium compared to a pure culture of E. coli MG1655. (A) CRISPR induction produced a 4-log increase in viable cells of the target strain E. coli MG1655 in pure culture and in a mixture of consortia. 10 (B) Dilution series of pure culture of E. coli MG1655 and mixture of bacterial colonies on streptomycin plates with and without inducer. Detailed Description The present invention relates to the production and use of Cas encoding sequences and vectors comprising them. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas encoding sequences in bacterial or archaeal cells.

[0025] One aspect of the invention provides for the control of expression of Cas and optionally also Cascade proteins from a single vector, such as through regulated use of the Cas modules in an operon and / or use of an attenuated promoter.

[0026] concept: One aspect of the present invention provides a nucleic acid vector, which can be used to introduce into any eukaryotic or prokaryotic species target host cell (e.g., in vitro or in vitro), for expressing type I Cas and optionally other components of type I CRISPR / Cas system. Usefully, the vector can therefore provide a single vector tool in some instances, which is used to introduce a complete exogenous type I CRISPR / Cas system into a target cell to modify (e.g., by Cas3 cutting) the DNA in the target cell. In one example, the chromosome target sequence (i.e., the protospacer sequence homologous to Cas3) is modified. In another example, an additional DNA sequence is modified, such as a plasmid sequence or DNA introduced into a cell. The latter can be used in the recombineering method of the present invention, wherein the exogenous DNA in the target cell is cut by Cas3, and optionally this produces one or more recombinantly produced ends for the recombinant DNA and other target DNAs produced by cutting, thereby producing a recombinant product in the cell. For example, in such a recombineering method, the target cell is a recombinantly produced Escherichia coli cell, for example, comprising a red / ET system. In another example, the target cell is an undesirable cell (e.g., a cell of a pathogenic species or strain of a human or animal, such as a species or strain that causes a bacterial disease) and the cell is killed by cleavage of Cas3. This can be used to treat or prevent infection in a human or animal carrying the target cell. The provision of a single vector tool that minimally expresses a Cas endonuclease (e.g., Cas3), a homologous auxiliary protein (e.g., a Cascade protein), and at least one CRISPR array (or a nucleotide sequence encoding a guide RNA (e.g., a single guide RNA)) is more convenient, wherein the Cas, auxiliary protein, and array (or nucleotide sequence) comprise a functional CRISPR / Cas system, and the inventors believe that it is more effectively introduced into the target cell and CRISPR / Cas modification of the target sequence is achieved therein compared to the use of 2 or 3 or more separate vectors (e.g., a vector encoding a Cas nuclease and a different vector encoding an auxiliary protein, and possibly another vector comprising an array (or a nucleotide sequence encoding a gRNA), all of which require transformation of the target cell to enable the system to function). This may provide one or more benefits, therefore, such as simplifying delivery (and therefore simplifying the design of delivery vehicles), simplifying the construction of vectors and vehicles, and / or providing better cutting or killing efficiency. Conveniently, therefore, an example of the present invention uses an operon for the coordinated expression of Cas and auxiliary proteins (and optionally also arrays or gRNA encoding sequences) in target cells. Although not wishing to be bound by any particular theory, the introduction of a single vector according to the present invention (e.g., using an operon) can advantageously coordinate the expression of Cas and auxiliary proteins (and optionally the production of cRNA or gRNA), so that these can be used to operate together without undue delays in target cells.This may be important to tip the balance between, on the one hand, target cells using their endogenous anti-restriction mechanisms, endogenous Cas mechanisms, or other endogenous mechanisms to ferret out and degrade invading phage and DNA, and, on the other hand, efficient cell killing or inactivation of such mechanisms by the invading CRISPR components of the vectors of the invention. In such an arms race, coordination and early manipulation of CRISPR components in cells may be important to gain advantage and achieve cell killing. The present invention provides tools to assist in this.

[0027] As an example, the present invention therefore provides the following concepts: -1. A nucleic acid vector for introduction into a host cell, the vector comprising a first nucleotide sequence encoding a type I Cas3 and a second nucleotide sequence encoding one or more Cascade proteins, wherein the first and second sequences are under the control of one or more promoters, and the promoter is used to express the protein in the cell. The vector comprises.

[0028] 2. The vector of concept 1, wherein the vector comprises an operon for expressing Cas3 and Cascade proteins from a Cas module in a cell, the module comprising nucleotide sequences encoding Cas3 and Cascade proteins, and the operon comprises the Cas module under the control of a promoter, the promoter being used to control the expression of Cas3 and Cascade proteins.

[0029] 3. The carrier of concept 2, where (a) the first sequence is between the promoter and the second sequence in the operon; (b) the operon does not comprise a nucleotide sequence encoding Cas between the promoter and the first nucleotide sequence; and / or (c) the operon comprises (in 5' to 3' direction) the promoter, the first sequence and the second sequence.

[0030] 4. A vector according to any preceding concept, wherein each promoter is a constitutive promoter.

[0031] 5. The vector of any one of concepts 1-3, wherein the promoter is repressible (optionally repressible by tetracycline repressor or lac repressor).

[0032] 6. The vector of any one of concepts 1-3, wherein the promoter is inducible.

[0033] 7. A vector according to any preceding concept, wherein the first sequence is under the control of a medium strength promoter.

[0034] 8. The vector of any preceding concept, wherein the first sequence is under the control of a promoter having an Anderson score (AS) of 0.5>AS>0.1.

[0035] 9. A vector of any preceding concept, wherein the first sequence (and optionally the second sequence) is under the control of a promoter and translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells, with a fluorescence that is 0.5-4 times that produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator and a downstream insulator.

[0036] 10. The vector of concept 9, wherein the fluorescence using the first EOU is 0.5-2 times the fluorescence using the second EOU.

[0037] 11. A vector according to any preceding concept, wherein the vector comprises an origin of replication operable in a host cell.

[0038] 12. A vector of any preceding concept, wherein the vector comprises an origin of replication operable in a bacterial cell of a vector production strain, wherein the Cas3 is inoperable in the production strain cell to target and cleave its chromosomal sequence.

[0039] 13. The vector of concept 12, wherein the first sequence is under the control of a promoter capable of controlling the expression of Cas3 at a level that is non-toxic to the cells of the production strain.

[0040] 14. A vector according to any preceding concept, wherein the vector is a high copy number vector.

[0041] 15. The vector of any preceding concept, wherein the first nucleotide sequence or the operon is comprised by a mobile genetic element.

[0042] 16. A vector according to any preceding concept, wherein the vector lacks a Cas adaptation module.

[0043] 17. A vector of any preceding concept, wherein the vector lacks a nucleotide sequence encoding one, more or all of Cas1, Cas2, Cas4, Cas6, Cas7 and Cas 8.

[0044] 18. A vector of any preceding concept, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas11, Cas7 and Cas8a1.

[0045] 19. The vector of concept 18, wherein the vector comprises a nucleotide sequence encoding Cas3' and / or Cas3".

[0046] 20. The vector of concept 19, wherein the nucleotide sequence encoding Cas3' and / or Cas3" is between the promoter and the sequence listed in concept 18.

[0047] 21. The vector of any one of concepts 18-20, wherein the host cell comprises a type IA CRISPR array homologous to Cas3.

[0048] 22. The vector of any one of concepts 18-20, wherein the host cell comprises an endogenous IB, C, U, D, E or F type CRISPR / Cas system.

[0049] 23. The vector of any one of concepts 1-17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8b1, Cas7 and Cas5.

[0050] 24. The vector of concept 23, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in concept 23.

[0051] 25. The vector of concept 23 or 24, wherein the host cell comprises a type IB CRISPR array homologous to Cas3.

[0052] 26. The vector of concept 23 or 24, wherein the host cell comprises an endogenous type IA, C, U, D, E or F CRISPR / Cas system.

[0053] 27. The vector of any of concepts 1-17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas5, Cas8c and Cas7.

[0054] 28. The vector of concept 27, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in concept 27.

[0055] 29. The vector of concept 27 or 28, wherein the host cell comprises an IC-type CRISPR array homologous to Cas3.

[0056] 30. The vector of concept 27 or 28, wherein the host cell comprises an endogenous type IA, B, U, D, E or F CRISPR / Cas system.

[0057] 31. The vector of any one of concepts 1-17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8, Cas2, Cas7, Cas5 and Cas6.

[0058] 32. The vector of concept 31, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in concept 31.

[0059] 33. The vector of concept 31 or 32, wherein the host cell comprises an IU-type CRISPR array homologous to Cas3.

[0060] 34. The vector of concept 31 or 32, wherein the host cell comprises an endogenous type IA, B, C, D, E or F CRISPR / Cas system.

[0061] 35. The vector of any of concepts 1-17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas10d, Cas7 and Cas5.

[0062] 36. The vector of concept 35, wherein the vector comprises a nucleotide sequence encoding Cas3' and / or Cas3".

[0063] 37. The vector of concept 36, wherein the nucleotide sequence encoding Cas3' and / or Cas3" is between the promoter and the sequence listed in concept 35.

[0064] 38. The vector of any one of concepts 35-37, wherein the host cell comprises an ID-type CRISPR array homologous to Cas3.

[0065] 39. The vector of any one of concepts 35 to 37, wherein the host cell comprises an endogenous type IA, B, C, U, E or F CRISPR / Cas system.

[0066] 40. The vector of any of concepts 1-17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8e, Cas11, Cas7, Cas5 and Cas6.

[0067] 41. The vector of concept 40, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in concept 40.

[0068] 42. The vector of concept 40 or 41, wherein the host cell comprises a type IE CRISPR array homologous to Cas3.

[0069] 43. The vector of concept 40 or 41, wherein the host cell comprises an endogenous type IA, B, C, D, U or F CRISPR / Cas system.

[0070] 44. The vector of any of concepts 1-17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8f, Cas5, Cas7 and Cas6f.

[0071] 45. The vector of concept 44, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in concept 44, wherein the vector lacks a nucleotide sequence encoding other Cas between the promoter and the sequence encoding Cas3.

[0072] 46. ​​The vector of concept 44 or 45, wherein the host cell comprises an IF-type CRISPR array homologous to Cas3.

[0073] 47. The vector of concept 44 or 45, wherein the host cell comprises an endogenous type IA, B, C, D, U or E CRISPR / Cas system.

[0074] 48. The vector of any one of concepts 1-17, wherein the Cas and Cascade are (a) Type IA Cas and Cascade proteins; (b) Type IB Cas and Cascade proteins; (c) IC-type Cas and Cascade proteins; (d) ID-type Cas and Cascade proteins; (e) Type IE Cas and Cascade proteins; (f) IF-type Cas and Cascade proteins; or (g) IU-type Cas and Cascade proteins.

[0075] 49. A vector according to any preceding concept, wherein the Cas and Cascade are E. coli (optionally IE or IF type) Cas and Cascade proteins.

[0076] 50. The vector of concept 49, wherein the Escherichia coli is ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4.

[0077] 51. The vector of any preceding concept, wherein said Cas and Cascade are (a) Clostridium (e.g., Clostridium difficile) Cas and Cascade proteins, optionally Clostridium difficile resistant to one or more antibiotics selected from aminoglycosides, lincomycin, tetracyclines, erythromycin, clindamycin, penicillins, cephalosporins and fluoroquinolones; (b) Pseudomonas aeruginosa Cas and Cascade proteins, optionally Pseudomonas aeruginosa resistant to one or more antibiotics selected from the group consisting of carbapenems, aminoglycosides, cefepime, ceftazidime, fluoroquinolones, piperacillin and tazobactam; or (c) Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae) Cas and Cascade proteins.

[0078] 52. The vector of any preceding concept, wherein the Cas and Cascade are Escherichia coli, Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae, P furiosus or B halodurans Cas and Cascade proteins.

[0079] 53. A vector of any preceding concept, wherein the Cas3 is a Cas3 of a CRISPR / Cas locus of a first bacterial or archaeal species, wherein the distance between the Cas3 coding sequence of the locus and its cognate promoter is greater than the distance between the Cas3 coding sequence comprised by the vector and the corresponding promoter.

[0080] 54. A vector according to any preceding concept, wherein the distance between the promoter and the Cas3 encoding sequence and / or the Cascade protein encoding sequence is shorter than in the corresponding wild-type type I locus.

[0081] 55. A vector of any preceding concept, wherein the vector comprises (i) a CRISPR array for producing crRNA in a host cell, and / or (ii) one or more nucleotide sequences encoding one or more guide RNAs (gRNA or single gRNA), wherein the crRNA or gRNA is homologous to Cas3 (and optionally to the Cascade protein).

[0082] 56. The vector of concept 55 as dependent upon concept 2, wherein the array or gRNA encoding sequence is contained by the operator and is under the control of the promoter.

[0083] 57. The vector of concept 56, wherein the array or gRNA encoding sequence is under the control of a promoter that is different from the promoter that controls the expression of Cas3.

[0084] 58. The vector of concept 56 or 57, wherein one or more of the crRNA or gRNA comprises a spacer sequence capable of hybridizing with a target nucleotide sequence of a host cell, wherein the target sequence is adjacent to a PAM that is homologous to Cas3.

[0085] 59. The vector of concept 58, wherein the target sequence is a chromosomal sequence of a host cell.

[0086] 60. The vector of concept 58 or 59, wherein said Cas3 is operable to cleave said target sequence.

[0087] 61. A vector according to any preceding concept, wherein the vector is a plasmid or a phagemid.

[0088] 62. A delivery vehicle comprising a vector of any preceding concept, wherein the delivery vehicle is capable of delivering the vector into a host cell.

[0089] 63. The vector of concept 62, wherein the delivery vehicle is a bacteriophage, a non-replicating transduction particle, a nanoparticle carrier, a bacterium or a liposome.

[0090] 64. A vector or carrier of any preceding concept, wherein the host cell is a bacterial or archaeal cell, optionally, the host cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4), Helicobacter pylori (H pylori), Streptococcus pneumoniae (Spneumoniae) or Staphylococcus aureus (Saureus) cell.

[0091] 65. A vector or vehicle of any of the preceding concepts for administration to a human or animal subject to treat a disease or disorder or reduce the risk of a disease or disorder in said subject.

[0092] 66. The vector or vehicle of concept 65, wherein the disease or disorder is infection of the subject by a host cell (eg a bacterial cell), or wherein the disease or disorder is mediated by a host cell (eg a bacterial cell).

[0093] 67. A pharmaceutical composition comprising a carrier or vehicle of any of the aforementioned concepts and a pharmaceutically acceptable diluent, excipient or carrier.

[0094] 68. A method for treating a disease or disorder or reducing the risk of a disease or disorder in a human or animal subject, the method comprising: administering a vector, vehicle or composition of any preceding concept to the subject, and introducing the vector into a target host bacterial or archaeal cell in the subject (for example, in the intestinal microbiota, lungs, eyes or blood of the subject), wherein the Cas cuts (or otherwise modifies) one or more target sequences in the target cell and the cell is killed or the growth or proliferation of the cell is reduced.

[0095] 69. The method of concept 68, wherein the target cell is a cell of a disease pathogen species.

[0096] 70. The method of concept 68 or 69, wherein the target cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4), Helicobacter pylori, Streptococcus pneumoniae or Staphylococcus aureus cell.

[0097] Implementation plan: One aspect of the present invention provides an improved method for amplifying DNA constructs in bacterial and archaeal production strain cells. For example, the DNA can be a high copy number plasmid or phagemid comprising a constitutive promoter, and when the DNA has been introduced into the target host bacteria or host cells, the constitutive promoter controls the expression of one or more Cas proteins. According to one aspect of the present invention, it is desirable to consider weakening promoter activity during DNA amplification in the production strain. This is useful because the inventors have found that Cas expression in the production strain may be toxic to the production strain cells, thereby reducing the yield of amplified DNA. Toxicity can be due to, for example, off-target cleavage of the production strain chromosomal DNA when Cas is a nuclease (such as Cas9 or Cas3), and / or due to relatively high expression levels of Cas in cells. Additionally or alternatively, it is undesirable that Cas expression or activity may generate selection pressure, which is conducive to mutation and mutation of DNA construct (such as mutation in one, more than one or all of CRISPR / Cas operon, Cas encoding gene, Cascade encoding gene, CRISPR array and gRNa encoding sequence of DNA construct) amplification in production cells, thereby reducing the yield of the desired amplified construct and causing the following undesirable steps: separating the desired DNA construct from the mutated DNA construct for further preparation into a useful composition. Such a composition can be a pharmaceutical composition, a herbicide, a pesticide, an environmental remediation composition, etc. In one example, the promoter weakening in the production strain is achieved by controlling the nucleotide sequence encoding Cas of the DNA construct using a medium strength (non-high or low) promoter. Moderate levels of Cas expression are tolerable in production strains, and once DNA is subsequently introduced into the target host cell, Cas is expressed at a sufficiently high level to produce the desired activity to modify (e.g., cut) the target sequence in the target cell. In an alternative, the present invention uses a repressible promoter, wherein the promoter is inhibited in the production strain, but is not inhibited in the target host cell. For example, aspects of the invention utilize a tetracycline repressor (tetR) expressed in cells of a production strain to suppress a promoter.

[0098] Thus, the yield can be increased by one or more of the following: (a) reducing the toxicity of Cas in the production strain; (b) reducing mutations in DNA (optionally Cas encoding sequences) in the production strain; (c) promoting producer cell viability during DNA amplification; and (d) reducing the occurrence of Cas cleavage of DNA (optionally cleavage of production host cell chromosomal DNA or of said DNA construct).

[0099] To this end, the present invention provides the following embodiments: -1. A method for amplifying copies of DNA encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell, the method comprising (a) providing a production strain cell, each cell comprising a copy of the DNA, wherein each DNA comprises a nucleotide sequence encoding the Cas, wherein the nucleotide sequence is under the control of a promoter, the promoter is used to control the expression of Cas in the production strain cell, and the DNA comprises an operable origin of replication in the cell for replicating the DNA; (b) culturing the cell to allow replication of the DNA, thereby amplifying the DNA; and (c) optionally isolating copies of said DNA, wherein the promoter is an attenuated constitutive promoter.

[0100] In one example, the promoter is a medium strength promoter. In another example, the promoter is suppressed in the production strain cell. Therefore, the promoter in these examples is a weakened promoter.

[0101] 2. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, the use of an attenuated promoter in a DNA construct for increasing the yield of amplified DNA produced by a production host cell, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0102] 3. The use of paragraph 2, wherein the use is used to increase the yield by (a) reducing the toxicity of Cas in the production strain; (b) reducing mutations in DNA (optionally Cas encoding sequences) in the production strain; (c) promoting producer cell viability during DNA amplification; and / or (d) reducing the occurrence of Cas cleavage of DNA (optionally cleavage of production host cell chromosomal DNA or of said DNA construct).

[0103] 4. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a weakened promoter in a DNA construct is used to reduce the toxicity of Cas in the production strain, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0104] 5. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, the use of an attenuated promoter in a DNA construct to reduce mutations in the DNA (optionally a Cas coding sequence) in the production strain, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0105] 6. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a weakened promoter in a DNA construct is used to promote the viability of the production cells during DNA amplification, wherein the DNA construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, and the method comprises: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0106] 7. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a weakened promoter in a DNA construct is used to reduce the occurrence of Cas cleavage of DNA, wherein the DNA construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, and the method comprises: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0107] 8. A method for increasing the yield of amplified copies of a DNA construct in a population of bacterial or archaeal production strain cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a weakened promoter.

[0108] 9. A method for reducing the toxicity of a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell population during the process of amplifying copies of a DNA construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a weakened promoter.

[0109] 10. A method for reducing mutations in a DNA construct encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell population during the process of amplifying copies of the construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a weakened promoter.

[0110] 11. A method for promoting the viability of a bacterial or archaeal production strain cell population during the process of amplifying copies of a DNA construct contained by the cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a weakened promoter.

[0111] 12. A method for reducing the occurrence of Cas nuclease cleavage in a DNA construct in a bacterial or archaeal production strain cell population during the process of amplifying copies of the construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a weakened promoter.

[0112] 13. The use of paragraph 5 or 7, or the method of paragraph 10 or 12, wherein the mutation or cleavage is a mutation or cleavage of the host cell chromosomal DNA or the construct DNA.

[0113] 14. The method or use of any one of paragraphs 2-13, wherein the promoter is a constitutive promoter.

[0114] 15. The method or use of any preceding paragraph, wherein the promoter is repressed in the production strain cell (optionally by a tetracycline repressor or a lac repressor).

[0115] 16. The method or use of paragraph 15, wherein the promoter is P LtetO-1 , PLlacO-1 or its inhibitory homologue.

[0116] Other examples of suitable repressible promoters are Ptac (inhibited by lacI) and the Leftward promoter (pL) of bacteriophage λ (which is inhibited by λcI repressor). In one example, the promoter comprises a repressible operator (e.g., tetO or lacO) fused to the promoter sequence. The corresponding repressor is encoded by a nucleic acid (e.g., a chromosomal integration sequence or a sequence contained by an episome) in the production strain, and the repressor is expressed in the DNA or vector amplification method of the present invention, thereby controlling the promoter of Cas expression to be suppressed. In the delivery vehicle subsequently produced from the amplified DNA / vector separated, the vector lacks an expressible nucleotide sequence encoding the repressor, thereby the promoter is functional when the DNA / vector is introduced into the target host cell. For example, in the absence of a repressor, the promoter is constitutively turned on (ON) for the expression of Cas. Therefore, once the DNA / vector is introduced into the host cell, the system is started to work, and the effect can be further enhanced by using a high copy number DNA / vector contained in an operable replication origin in the host cell. High copy number vectors or DNA are also desirable in production strain cells to increase the yield of DNA / vector, and by using attenuated promoters as described herein (e.g., medium strength promoters and / or repressed promoters in production strain cells), Cas toxicity can be minimized during culture to maximize amplification of DNA / vector and thus maximize yield.

[0117] 17. The method or use of any preceding paragraph, wherein the promoter is a medium strength promoter.

[0118] 18. The method or use of any preceding paragraph, wherein the promoter has an Anderson score (AS) of 0.5>AS>0.1.

[0119] 19. The method or use of any preceding paragraph, wherein the nucleotide sequence encoding the Cas is under the control of a promoter and a translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells, the fluorescence of which is 0.5-4 times the fluorescence produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in the 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator, and a downstream insulator.

[0120] 20. The method or use of paragraph 19, wherein the fluorescence using the first EOU is 0.5-2 times the fluorescence using the second EOU.

[0121] 21. The method or use of any preceding paragraph, wherein the nuclease is Cas3, and optionally the DNA or cell encodes a homologous Cascade protein.

[0122] 22. The method or use of any one of paragraphs 1-20, wherein the Cas is Cas9.

[0123] 23. The method or use of any preceding paragraph, wherein the production strain cell comprises a helper phage genome that can be induced in the cell to produce phage coat protein, wherein the method further comprises inducing the production of phage protein and causing the amplified DNA to be packaged into phage particles or non-self-replicating transduction particles, and further isolating the phage or transduction particles and optionally formulating the particles into a pharmaceutical composition for administration to a human or animal subject to treat a disease or condition or reduce the risk of a disease or condition in the subject.

[0124] 24. The method or use of paragraph 23, wherein the particle is capable of infecting a target host cell in the subject and transducing the cell with the DNA, wherein the Cas and crRNA (or guide RNA, gRNA) encoded by the DNA are expressed in the cell, and the crRNA or (gRNA) is operable to guide Cas to a target nucleotide sequence (optionally a chromosomal sequence) contained by the cell, wherein the Cas cuts the target sequence in the cell, thereby killing the host cell and treating the disease or disorder or reducing the risk of the disease or disorder.

[0125] 25. The method or use of paragraph 24, wherein the host cell is a bacterial or archaeal cell, optionally, the host cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4), Helicobacter pylori, Streptococcus pneumoniae or Staphylococcus aureus cell.

[0126] 26. The method or use of any preceding paragraph, wherein each DNA is comprised by a high copy number plasmid or phagemid.

[0127] 27. The method or use of any preceding paragraph, wherein the DNA construct comprises one or more nucleotide sequences for producing a crRNA or gRNA operable for Cas nuclease targeting in a target host cell.

[0128] Paragraph and general application features: The present invention provides the following paragraphs, which are supported by the following examples. Any feature of the concept can be combined with any feature of the embodiment. Any feature of the concept can be combined with any feature of the embodiment. Any feature of the paragraph can be combined with any feature of the embodiment.

[0129] Any cell herein (e.g., a production strain cell or a target host cell) can be a bacterial cell, an archaeal cell, an algal cell, a fungal cell, a protozoan cell, an invertebrate cell, a vertebrate cell, a fish cell, a bird cell, a mammalian cell, a companion animal cell, a dog cell, a cat cell, a horse cell, a mouse cell, a rat cell, a rabbit cell, a eukaryotic cell, a prokaryotic cell, a human cell, an animal cell, a rodent cell, an insect cell, or a plant cell. Preferably, the cell is a bacterial cell. Alternatively, the cell is a human cell. Optionally, the production strain cell and the target host cell belong to the same phylum, order, family, genus, species, or strain.

[0130] In one example, the Cas is any Cas of a type I system (e.g., Cas2, 3, 4, 5, or 6). In this example, in one embodiment, the Cas can be fused or conjugated to a portion operable to increase or decrease transcription of a gene comprising a target sequence. For example, a nucleic acid encoding Cas can include a nucleotide sequence encoding the portion, wherein the Cas and portion are expressed as a fusion protein in a host cell. In one embodiment, the Cas is the N-terminus of the portion; in another embodiment, it is at the C-terminus of the portion.

[0131] 1. A nucleic acid vector for introduction into a host cell, the vector comprising a first nucleotide sequence encoding type I Cas3, wherein the sequence is under the control of a promoter, and the promoter is used to express Cas3 in the cell.

[0132] In one example, the vector is a DNA vector, for example, a ssDNA vector or a dsDNA vector.

[0133] 2. The vector of paragraph 1, wherein the vector comprises a second nucleotide sequence encoding one or more Cascade proteins, wherein the first and second sequences are under the control of one or more promoters, and the promoter is used to express the protein in the cell.

[0134] 3. The vector of paragraph 2, wherein the Cascade protein is homologous to Cas3.

[0135] In one example, the Cas3 is homologous to a Cascade protein encoded by the host cell and / or a Cascade protein encoded by a second operon. Optionally, the second operon is contained by the vector. Optionally, the second operon is contained by a second vector, which is capable of introducing the second operon into a host cell, whereby the Cas3 and Cascade proteins are expressed from the operon in the host cell and can operate with crRNA or gRNA to target Cas to a host cell target sequence, wherein the Cas3 is capable of modifying the target sequence.

[0136] 4. The vector of paragraph 2 or 3, wherein the vector comprises an operon for expressing Cas3 and Cascade proteins from a Cas module in a cell, the module comprising nucleotide sequences encoding Cas3 and Cascade proteins, and the operon comprises the Cas module under the control of a promoter for controlling the expression of Cas3 and Cascade proteins.

[0137] The term "operon" is known to the skilled person, such as to relate to a functional unit of DNA containing at least two expressible nucleotide sequences, each encoding an expression product (eg, a respective translatable mRNA), wherein the sequences are under the control of a common promoter.

[0138] 5. The vector of paragraph 4, wherein the first sequence is between the promoter and the second sequence in the operon.

[0139] 6. The vector of paragraph 4 or 5, wherein the operon does not comprise a nucleotide sequence encoding Cas between the promoter and the first nucleotide sequence.

[0140] Optionally, the Cas3 is a Cas3 encoded by a CRISPR / Cas locus of a first bacterial or archaeal species, wherein in the locus, the Cas3 coding sequence is 3' to the Cascade protein coding sequence (ie, the latter is between the Cas3 and the 5'-most promoter of the locus).

[0141] Optionally, the Cas3 is a ygcB protein (eg, wherein the production strain cell and / or host target cell is E. coli).

[0142] Optionally, the Cascade protein comprises or consists of cas5 (casD, csy2) cas6 (cas6f, cse3, casE) cas7 (csc2, csy3, cse4, casC) cas8 (casA, cas8a1, cas8b1, cas8c, cas10d, cas8e, cse1, cas8f, csy1).

[0143] Optionally herein, the promoter and the Cas3 coding sequence are separated by no more than 150, 100, 50, 40, 30, 20 or 10 bp, for example, by 30-45 or 30-40, or 39 or about 39 bp.

[0144] Optionally herein, the ribosome binding site and the Cas3 encoding sequence are separated by no more than 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 4 or 3 bp, for example, by 10-5, 6 or about 6 bp.

[0145] 7. The vector of any one of paragraphs 4-6, wherein the operon comprises (in 5' to 3' direction) the promoter, the first sequence and the second sequence.

[0146] 8. The vector of any preceding paragraph, wherein each promoter is a constitutive promoter.

[0147] 9. The vector of any one of paragraphs 1-7, wherein the promoter is repressible (optionally repressible by a tetracycline repressor or a lac repressor).

[0148] 10. The vector of any one of paragraphs 1-7, wherein the promoter is inducible.

[0149] 11. The vector of any preceding paragraph, wherein the first sequence is under the control of a weak promoter.

[0150] 12. The vector of any one of paragraphs 1-7, wherein the first sequence is under the control of a medium strength promoter.

[0151] 13. The vector of any one of paragraphs 1-7, wherein the first sequence is under the control of a strong promoter.

[0152] In one example, the promoter is combined with a Shine-Dalgarno sequence comprising the sequence 5'-aaagaggagaaa-3' (SEQ ID NO: 5) or a ribosome binding site homolog thereof.

[0153] 14. The vector of any one of paragraphs 1-7, wherein the first sequence is under the control of a promoter having an Anderson score (AS) of AS ≥ 0.5.

[0154] See Table 2 for more information on Anderson scores associated with promoters.

[0155] 15. The vector of any one of paragraphs 1-7, wherein the first sequence is under the control of a promoter having an Anderson score (AS) of 0.5>AS>0.1.

[0156] 16. The vector of any of paragraphs 1-7, wherein the first sequence is under the control of a promoter having an Anderson score (AS) of ≤0.1.

[0157] 17. The vector of any one of paragraphs 1-7, wherein the first sequence (and optionally the second sequence) is under the control of a promoter and translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells, with a fluorescence that is 0.5-4 times that produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in the 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator, and a downstream insulator.

[0158] 18. The vector of paragraph 17, wherein the fluorescence using the first EOU is 0.5-2 times the fluorescence using the second EOU.

[0159] For example, the fluorescence using the first EOU is 0.5 to X times the fluorescence using the second EOU, wherein X is 3.0-1.0, e.g., 3, 2.5, 2, 1.5 or 1, wherein the fluorescence is determined using excitation at 481 nm and emission at 507 nm. Optionally, an E. coli culture at an OD600 of 0.3-0.5 in exponential growth phase is used.

[0160] For example, the upstream insulator, nucleotide sequence encoding GFP, 3'UTR, transcription terminator and downstream insulator of each EOU are disclosed in Mutalik et al. (2013). For example, the upstream insulator, nucleotide sequence encoding GFP, 3'UTR, transcription terminator and downstream insulator of each EOU are the corresponding sequences of SEQ ID NO:4. For example, the E. coli is E. coli BW25113 grown in MOPS EZ Rich Medium (Teknova) supplemented with 50 μg / ml kanamycin (kan) at 37°C and shaking at 900 rpm. For example, each EOU is contained by a medium copy plasmid, such as a plasmid derived from pFAB217 containing a p15A replication origin and a kan resistance gene.

[0161] 19. The vector of any preceding paragraph, wherein the vector comprises an origin of replication operable in a host cell.

[0162] 20. The vector of any preceding paragraph, wherein the vector comprises an origin of replication operable in a bacterial cell of a vector production strain, wherein the Cas3 is not operable in the production strain cell to target and cleave a chromosomal sequence thereof.

[0163] An example of a production strain cell is an Escherichia coli cell. A production strain cell is a cell for amplifying the DNA encoding Cas (and optionally other components of the CRISPR / Cas system). Usefully, the strain can package the amplified DNA into transduction particles, which can be separated to produce a composition, which can be contacted with a population of target host cells (e.g., bacteria, archaea, prokaryotes, eukaryotes, humans, animals, mammals, rodents, mice, rats, rabbits, African toads, fish, birds, amphibians, insects, plants, amoebas or algae cells), wherein the DNA is introduced into cells to express Cas (and optionally other CRISPR / Cas system components), wherein the Cas is directed to the protospacer sequence target sequence in the host cell and modifies (e.g., cuts) the sequence. In another example, the amplified DNA is isolated from a population of producer strain cells and combined with a delivery vehicle (e.g., a carrier bacterium, nanoparticle, or liposome), wherein the delivery vehicle can be contacted with a population of target host cells (e.g., bacteria, archaea, prokaryotes, eukaryotes, humans, animals, mammals, rodents, mice, rats, rabbits, Xenopus, fish, birds, amphibians, insects, plants, amoebas, or algae cells), wherein the DNA is introduced into the cells to express Cas (and optionally other CRISPR / Cas system components), wherein the Cas is directed to a protospacer sequence target sequence in the host cell and modifies (e.g., cleaves) the sequence.

[0164] 21. The vector of paragraph 20, wherein the first sequence is under the control of a promoter capable of controlling the expression of Cas3 at a level that is non-toxic to the production strain cells.

[0165] In one example, substantially no cells of the production strain are killed when the Cas3 coding sequence is amplified therein. In another example, no more than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2% or 1% of the production strain cells are killed when the Cas3 coding sequence is amplified therein. For example, this is within a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12 or 24 hour period of culturing cells.

[0166] 22. The vector of paragraph 20, wherein the first sequence is under the control of a promoter that controls the expression of Cas3 in the production strain cells, such that the cells are able to grow and propagate sufficiently to produce at least 1000 copies of the vector.

[0167] For example this is within a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12 or 24 hours in the culture of the cells. 3 , 10 4 , 10 5, 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 101 4 , 10 15 , 10 16 , 10 17 Each producer strain produces at least 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 101 4 , 10 15 , 10 16 , 10 17 or 10 18 copies.

[0168] 23. The vector of any one of paragraphs 20-22, wherein the cell is capable of achieving at least 2 or 3 reproductive logs when the vector is contained therein.

[0169] For example, this is within a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12 or 24 hour period of culturing the cells.

[0170] 24. The vector of any preceding paragraph, wherein the vector is a high copy number vector.

[0171] 25. The vector of any preceding paragraph, wherein the first nucleotide sequence or the operon is comprised by a mobile genetic element.

[0172] Suitable mobile genetic elements, for example, transposons, are disclosed in WO2016177682 and US20170246221, the disclosures of which are expressly incorporated herein for possible application in the present invention and for providing one or more features for the claims herein.

[0173] 26. The vector of any preceding paragraph, wherein the vector lacks a Cas adaptation module.

[0174] For example, the vector lacks nucleotide sequences encoding Cas1, Cas2 and / or Cas4.

[0175] 27. The vector of any preceding paragraph, wherein the vector lacks nucleotide sequences encoding one, more or all of Cas1, Cas2, Cas4, Cas6 (optionally Cas6f), Cas7 and Cas 8 (optionally Cas8f).

[0176] 28. The vector of any preceding paragraph, wherein the vector lacks a sequence encoding Cas6 (optionally Cas6f).

[0177] 29. The vector of any of paragraphs 1-27, wherein the module encodes Cas6 (optionally Cas6f).

[0178] 30. The vector of any preceding paragraph, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas11, Cas7 and Cas8a1.

[0179] 31. The vector of paragraph 30, wherein the vector comprises a nucleotide sequence encoding Cas3' and / or Cas3" (optionally wherein the nucleotide sequence encoding Cas3' and / or Cas3" is between the promoter and the sequence listed in paragraph 30).

[0180] In one embodiment, the vector comprises nucleotide sequences encoding Cas3 (e.g., Cas3' and / or Cas3"), Cas11, Cas7, and Cas8a1 (in the 5' to 3' direction). Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas11 sequence. Optionally, the vector comprises a type IA CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell for producing guide RNA, the array is operable in the host cell, wherein the guide RNA can operate with Cas and Cascade proteins to target and modify (e.g., cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can, in one embodiment, operate with Cas and Cascade proteins to target and modify (e.g., cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[0181] 32. The vector of paragraph 30 or 31, wherein the host cell comprises a type IA CRISPR array homologous to Cas3.

[0182] 33. The vector of paragraph 30 or 31, wherein the host cell comprises an endogenous IB, C, U, D, E or F type CRISPR / Cas system.

[0183] 34. The vector of any of paragraphs 1-29, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8b1, Cas7 and Cas5.

[0184] 35. The vector of paragraph 34, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and the sequence listed in paragraph 34.

[0185] In one embodiment, the vector comprises nucleotide sequences encoding Cas3, Cas8b1, Cas7 and Cas5 (in the 5' to 3' direction). Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas8b1 sequence. Optionally, the vector comprises a type IB CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise repetitive sequences homologous to Cas3. Thus, when the vector has been introduced into a cell for producing guide RNA, the array is operable in a host cell, wherein the guide RNA can be operated with Cas and Cascade proteins to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can be operated with Cas and Cascade proteins in one embodiment to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[0186] 36. The vector of paragraph 34 or 35, wherein the host cell comprises a type IB CRISPR array homologous to Cas3.

[0187] 37. The vector of paragraph 34 or 35, wherein the host cell comprises an endogenous type IA, C, U, D, E or F CRISPR / Cas system.

[0188] 38. The vector of any of paragraphs 1-29, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas5, Cas8c and Cas7.

[0189] 39. The vector of paragraph 38, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and the sequence listed in paragraph 38.

[0190] In one embodiment, the vector comprises nucleotide sequences encoding Cas3, Cas5, Cas8c and Cas7 (in the 5' to 3' direction). Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas5 sequence. Optionally, the vector comprises an IC type CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repetitive sequence homologous to Cas3. Thus, when the vector has been introduced into a cell for producing a guide RNA, the array is operable in a host cell, wherein the guide RNA can be operated with Cas and Cascade proteins to target and modify (e.g., cut) a target nucleotide sequence in a host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can be operated with Cas and Cascade proteins in one embodiment to target and modify (e.g., cut) a target nucleotide sequence in a host cell, optionally thereby killing the host cell.

[0191] 40. The vector of paragraph 38 or 39, wherein the host cell comprises a type IC CRISPR array homologous to Cas3.

[0192] 41. The vector of paragraph 38 or 39, wherein the host cell comprises an endogenous type IA, B, U, D, E or F CRISPR / Cas system.

[0193] 42. The vector of any one of paragraphs 1-29, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8, Cas2, Cas7, Cas5 and Cas6.

[0194] 43. The vector of paragraph 42, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and the sequence listed in paragraph 42.

[0195] In one embodiment, the vector comprises nucleotide sequences (in 5' to 3' direction) encoding Cas3, Cas8U2, Cas7, Cas5 and Cas6. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas8U2 sequence. Optionally, the vector comprises an IU type CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repetitive sequence homologous to Cas3. Thus, when the vector has been introduced into a cell for producing guide RNA, the array is operable in a host cell, wherein the guide RNA can be operated with Cas and Cascade proteins to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can be operated with Cas and Cascade proteins in one embodiment to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[0196] 44. The vector of paragraph 42 or 43, wherein the host cell comprises an IU-type CRISPR array homologous to Cas3.

[0197] 45. The vector of paragraph 42 or 43, wherein the host cell comprises an endogenous type IA, B, C, D, E or F CRISPR / Cas system.

[0198] 46. ​​The vector of any one of paragraphs 1-29, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas10d, Cas7 and Cas5.

[0199] 47. The vector of paragraph 46, wherein the vector comprises a nucleotide sequence encoding Cas3' and / or Cas3" (optionally wherein the nucleotide sequence encoding Cas3' and / or Cas3" is between the promoter and the sequence listed in paragraph 46).

[0200] In one embodiment, the vector comprises nucleotide sequences encoding Cas3, Cas10d, Cas7 and Cas5 (in the 5' to 3' direction). Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas10d sequence. Optionally, the vector comprises an ID type CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repetitive sequence homologous to Cas3. Thus, when the vector has been introduced into a cell for producing a guide RNA, the array is operable in a host cell, wherein the guide RNA can be operated with Cas and Cascade proteins to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can be operated with Cas and Cascade proteins in one embodiment to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[0201] 48. The vector of paragraph 46 or 47, wherein the host cell comprises an ID-type CRISPR array homologous to Cas3.

[0202] 49. The vector of paragraph 46 or 47, wherein the host cell comprises an endogenous type IA, B, C, U, E or F CRISPR / Cas system.

[0203] 50. The vector of any one of paragraphs 1-29, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8e, Cas11, Cas7, Cas5 and Cas6.

[0204] 51. The vector of paragraph 50, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and the sequence listed in paragraph 50.

[0205] In one embodiment, the vector comprises nucleotide sequences (in 5' to 3' direction) encoding Cas3, Cas8e, Cas11, Cas7, Cas5 and Cas6. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas11 sequence. Optionally, the vector comprises a IE type CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repetitive sequence homologous to Cas3. Thus, when the vector has been introduced into a cell for producing guide RNA, the array is operable in a host cell, wherein the guide RNA can be operated with Cas and Cascade proteins to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can be operated with Cas and Cascade proteins in one embodiment to target and modify (e.g., cut) the target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[0206] 52. The vector of paragraph 50 or 51, wherein the host cell comprises a type IE CRISPR array homologous to Cas3.

[0207] 53. The vector of paragraph 50 or 51, wherein the host cell comprises an endogenous type IA, B, C, D, U or F CRISPR / Cas system.

[0208] 54. The vector of any one of paragraphs 1-29, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8f, Cas5, Cas7 and Cas6f.

[0209] 55. The vector of paragraph 54, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and the sequence listed in paragraph 54, wherein the vector lacks a nucleotide sequence encoding other Cas between the promoter and the sequence encoding Cas3.

[0210] In one embodiment, the vector comprises nucleotide sequences encoding Cas3, Cas8f, Cas5, Cas7 and Cas6f (in the 5' to 3' direction). Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas8f sequence. Optionally, the vector comprises an IF type CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repetitive sequence homologous to Cas3. Thus, when the vector has been introduced into a cell for producing a guide RNA, the array is operable in a host cell, wherein the guide RNA can be operated with Cas and Cascade proteins to target and modify (e.g., cut) a target nucleotide sequence in a host cell, optionally thereby killing the host cell. Similarly, a single guide RNA encoded by the vector can be operated with Cas and Cascade proteins in one embodiment to target and modify (e.g., cut) a target nucleotide sequence in a host cell, optionally thereby killing the host cell.

[0211] 56. The vector of paragraph 54 or 55, wherein the host cell comprises an IF-type CRISPR array homologous to Cas3.

[0212] 57. The vector of paragraph 54 or 55, wherein the host cell comprises an endogenous type IA, B, C, D, U or E CRISPR / Cas system.

[0213] 58. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are type IA Cas and Cascade proteins.

[0214] 59. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are type IB Cas and Cascade proteins.

[0215] 60. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are type IC Cas and Cascade proteins.

[0216] 61. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are ID-type Cas and Cascade proteins.

[0217] 62. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are type IE Cas and Cascade proteins.

[0218] 63. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are IF-type Cas and Cascade proteins.

[0219] 64. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are IU-type Cas and Cascade proteins.

[0220] 65. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are E. coli (optionally type IE or IF) Cas and Cascade proteins, optionally wherein the E. coli is an ESBL-producing E. coli or E. coli ST131-025b:H4.

[0221] 66. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are Clostridium (e.g., Clostridium difficile) Cas and Cascade proteins, optionally Clostridium difficile resistant to one or more antibiotics selected from aminoglycosides, lincomycin, tetracyclines, erythromycin, clindamycin, penicillins, cephalosporins, and fluoroquinolones.

[0222] 67. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are Pseudomonas aeruginosa Cas and Cascade proteins, optionally Pseudomonas aeruginosa resistant to one or more antibiotics selected from carbapenems, aminoglycosides, cefepime, ceftazidime, fluoroquinolones, piperacillin and tazobactam.

[0223] 68. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are Klebsiella pneumoniae (eg, carbapenem-resistant Klebsiella pneumoniae or extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae) Cas and Cascade proteins.

[0224] 69. The vector of any one of paragraphs 1-29, wherein the Cas and Cascade are Escherichia coli, Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae, Pyrococcus furiosus, or Bacillus halodurans Cas and Cascade proteins.

[0225] 70. The vector of any preceding paragraph, wherein the Cas3 is a Cas3 of a CRISPR / Cas locus of a first bacterial or archaeal species, wherein the distance between the Cas3 coding sequence of the locus and its cognate promoter is greater than the distance between the Cas3 coding sequence comprised by the vector and the corresponding promoter.

[0226] The homologous promoter here is the promoter that controls the expression of Cas3 in the wild-type locus.

[0227] 71. The vector of any preceding paragraph, wherein the distance between the promoter and the Cas3 coding sequence and / or the Cascade protein coding sequence is shorter than the distance in the corresponding wild-type type I locus.

[0228] The corresponding locus is a wild-type locus of a bacterial or archaeal species or strain that contains an endogenous CRISPR / Cas system encoding a Cas3 and / or Cascade protein of the type also encoded by the vector. Thus, when the vector contains an operon, the operon may contain nucleotide sequences encoding Cas3 and Cascade that are not present in the natural configuration.

[0229] 72. The vector of any preceding paragraph, wherein the vector comprises (i) a CRISPR array for producing crRNA in a host cell, and / or (ii) one or more nucleotide sequences encoding one or more single guide RNAs (gRNAs), wherein the crRNA or gRNA is homologous to Cas3 (and optionally to a Cascade protein).

[0230] 73. The vector of paragraph 72 when dependent on paragraph 4, wherein the array or gRNA encoding sequence is contained by the operator and is under the control of the promoter.

[0231] 74. The vector of paragraph 72, wherein the array or gRNA encoding sequence is under the control of a promoter that is different from the promoter that controls the expression of Cas3.

[0232] 75. The vector of any one of paragraphs 72-74, wherein one or more of the crRNA or gRNA comprises a spacer sequence capable of hybridizing to a target nucleotide sequence of a host cell, wherein the target sequence is adjacent to a PAM that is homologous to Cas3.

[0233] Thus, the spacer hybridizes to the protospacer sequence to guide Cas3 to the protospacer sequence. Optionally, Cas3 cleaves the protospacer sequence, for example, using the exo- and / or endonuclease activity of Cas3. Optionally, Cas3 removes a plurality of (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9 or 10) nucleotides from the protospacer sequence.

[0234] 76. The vector of paragraph 75, wherein the target sequence is a chromosomal sequence of a host cell.

[0235] 77. The vector of paragraph 75 or 76, wherein the Cas3 is operable to cleave the target sequence.

[0236] 78. The vector of any preceding paragraph, wherein the vector is a plasmid or a phagemid.

[0237] 79. A delivery vehicle comprising the vector of any preceding paragraph, wherein the delivery vehicle is capable of delivering the vector into a host cell.

[0238] 80. The vector of paragraph 79, wherein the delivery vehicle is a bacteriophage, a non-replicating transduction particle, a nanoparticle carrier, a bacterium or a liposome.

[0239] The phage or particle comprises a phage coat protein that encapsidates DNA, wherein the DNA comprises a vector. Suitable examples of phage and particles are disclosed in USSN 15 / 985,658 (and USPTO equivalents thereof), the disclosure of which is incorporated herein by reference for possible use in the present invention and for providing one or more features that may be included in the claims herein. The phage or particle is capable of infecting a cell, thereby introducing the vector into the cell.

[0240] 81. The vector or carrier of any preceding paragraph, wherein the host cell is a bacterial or archaeal cell, optionally, the host cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing E. coli or E. coli ST131-025b:H4), Helicobacter pylori, Streptococcus pneumoniae, or Staphylococcus aureus cell.

[0241] 82. The vector or vehicle of any preceding paragraph for administration to a human or animal subject to treat or reduce the risk of a disease or disorder in said subject.

[0242] 83. The vector or vehicle of paragraph 82, wherein the disease or disorder is an infection of the subject by a host cell (eg, a bacterial cell), or wherein the disease or disorder is mediated by a host cell (eg, a bacterial cell).

[0243] 84. A pharmaceutical composition comprising the carrier or vehicle of any preceding paragraph and a pharmaceutically acceptable diluent, excipient or carrier.

[0244] 85. A method for amplifying copies of DNA encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell, the method comprising (a) providing a production strain cell, each cell comprising a copy of the DNA, wherein each DNA comprises a nucleotide sequence encoding the Cas, wherein the nucleotide sequence is under the control of a promoter, the promoter is used to control the expression of Cas in the production strain cell, and the DNA comprises an operable origin of replication in the cell for replicating the DNA; (b) culturing the cell to allow replication of the DNA, thereby amplifying the DNA; and (c) optionally isolating copies of said DNA, 86. The method of paragraph 85, wherein the promoter is a constitutive promoter.

[0245] 87. The method of paragraph 85, wherein the promoter is repressible (optionally repressible by a tetracycline repressor or a lac repressor).

[0246] 88. The method of paragraph 85, wherein the promoter is inducible.

[0247] 89. The method of any of paragraphs 85-88, wherein the promoter is a medium strength promoter.

[0248] 90. The method of any of paragraphs 85-89, wherein the promoter has an Anderson score (AS) of 0.5>AS>0.1.

[0249] 91. The method of any one of paragraphs 85-90, wherein the nucleotide sequence encoding the Cas is under the control of a promoter and a translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells, the fluorescence of which is 0.5-4 times the fluorescence produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in the 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator, and a downstream insulator.

[0250] 92. The method of paragraph 91, wherein the fluorescence using the first EOU is 0.5-2 times the fluorescence using the second EOU.

[0251] 93. The method of any of paragraphs 85-92, wherein the nuclease is Cas3, and optionally the DNA or cell encodes a homologous Cascade protein and / or one or more crRNAs operable for Cas nuclease targeting.

[0252] For example, the targeting is to target Cas to a protospacer sequence contained by a host cell chromosome or its episome. In another example, the targeting is in a recombineering method and the Cas is targeted to a protospacer sequence of a DNA that has been introduced into a host cell or amplified in a host cell. In an example of such recombineering, the host cell is an E. coli cell.

[0253] 94. The method of any of paragraphs 85-92, wherein the Cas is Cas9.

[0254] 95. The method of any one of paragraphs 85-92, wherein the Cas is a type IIIA csm protein or a type IIIB cmr protein.

[0255] 96. The method of any of paragraphs 85-92, wherein the Cas is Csf1.

[0256] 97. The method of any of paragraphs 85-92, wherein the Cas is Cpf1.

[0257] 98. The method of any one of paragraphs 85-92, wherein the Cas is Cas13 (optionally Cas13a or Cas13b).

[0258] 99. The method of any one of paragraphs 85-92, wherein the Cas is selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, Cas13a, Cas13b and Cas13c.

[0259] 100. The method of any of paragraphs 85-99, wherein the production strain cell comprises a helper phage genome that can be induced in the cell to produce phage coat protein, wherein the method further comprises inducing the production of phage protein and causing the amplified DNA to be packaged into phage particles or non-self-replicating transduction particles, and further isolating the phage or transduction particles and optionally formulating the particles into a pharmaceutical composition for administration to a human or animal subject to treat a disease or condition or reduce the risk of a disease or condition in the subject.

[0260] 101. The method of paragraph 100, wherein the particle is capable of infecting a target host cell in the subject and transducing the cell with the DNA, wherein Cas and crRNA (or gRNA) encoded by the DNA are expressed in the cell, and the crRNA or (gRNA) is operable to guide Cas to a target nucleotide sequence (optionally a chromosomal sequence) contained in the cell, wherein the Cas cuts the target sequence in the cell, thereby killing the host cell and treating the disease or disorder or reducing the risk of the disease or disorder.

[0261] 102. The method of paragraph 101, wherein the host cell is a bacterial or archaeal cell, optionally, the host cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4), Helicobacter pylori, Streptococcus pneumoniae or Staphylococcus aureus cell.

[0262] 103. The method of any of paragraphs 85-102, wherein each DNA is comprised by a high copy number vector, optionally a high copy number plasmid (optionally the promoter is a constitutive promoter).

[0263] 104. The method of any of paragraphs 85-103, wherein each DNA is comprised by a vector or vehicle according to any of paragraphs 1-83.

[0264] 105. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a reduced strength promoter in a DNA construct is used to increase the yield of amplified DNA produced by a production host cell, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0265] Thus, the increase can be relative to the yield produced using a strong promoter, for example, a strong constitutive promoter (e.g., a promoter with an Anderson score (AS) of AS ≥ 0.5). In another example, the strong promoter is a promoter comprised of a promoter and a translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells with a fluorescence greater than 4 times that produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in the 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator, and a downstream insulator.

[0266] 106. The use of paragraph 105, wherein the use is for increasing the yield by (d) reducing the toxicity of Cas in the production strain; (e) reducing mutations in the DNA (optionally Cas encoding sequences) in the production strain; (f) promoting producer cell viability during DNA amplification; and / or (g) reducing the occurrence of Cas cleavage of DNA (optionally cleavage of production host cell chromosomal DNA or of said DNA construct).

[0267] 107. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a reduced strength promoter in a DNA construct is used to reduce the toxicity of Cas in the production strain, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0268] 108. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a reduced strength promoter in a DNA construct is used to reduce mutations in the DNA (optionally a Cas coding sequence) in the production strain, the DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0269] 109. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a reduced strength promoter in a DNA construct is used to promote the viability of the production cells during DNA amplification, wherein the DNA construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, and the method comprises: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0270] 110. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, a reduced strength promoter in a DNA construct is used to reduce the occurrence of Cas cleavage of DNA, wherein the DNA construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of the promoter, and the method comprises: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells.

[0271] 111. A method for increasing the yield of amplified copies of a DNA construct in a population of bacterial or archaeal production strain cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a reduced strength promoter.

[0272] 112. A method for reducing the toxicity of a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell population during the process of amplifying copies of a DNA construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a reduced strength promoter.

[0273] 113. A method for reducing mutations in a DNA construct encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain cell population during the process of amplifying copies of the construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a reduced strength promoter.

[0274] 114. A method for promoting the viability of a population of producing cells of a bacterial or archaeal production strain cell during the process of amplifying copies of a DNA construct contained by the cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a reduced strength promoter.

[0275] 115. A method for reducing the occurrence of Cas nuclease cleavage in a DNA construct in a bacterial or archaeal production strain cell population during the process of amplifying copies of the construct, wherein the construct comprises a nucleotide sequence encoding Cas and the sequence is under the control of a promoter, the method comprising: culturing the cells to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is a reduced strength promoter.

[0276] 116. The use of paragraph 108 or 110, or the method of paragraph 113 or 115, wherein the mutation or cleavage is a mutation or cleavage of the host cell chromosomal DNA or the construct DNA.

[0277] 117. The use or method of any one of paragraphs 105-116, wherein the promoter is a constitutive promoter.

[0278] 118. The use or method of any one of paragraphs 105-117, wherein the promoter is repressible (optionally repressible by a tetracycline repressor or a lac repressor).

[0279] In one example, the promoter is a constitutive promoter and optionally the DNA is contained by a high copy number plasmid or phagemid.

[0280] 119. The use or method of any one of paragraphs 105-118, wherein the promoter is P LtetO-1 , P LlacO-1 or its inhibitory homologue.

[0281] P LlacO-1 Inhibited by lac repressor (LacR). LtetO-1 Inhibited by the tet repressor (TetR).

[0282] 120. The use or method of any one of paragraphs 105-119, wherein the promoter is a medium strength promoter.

[0283] 121. The use or method of any of paragraphs 105-120, wherein the promoter has an Anderson score (AS) of 0.5>AS>0.1.

[0284] 122. The use or method of any one of paragraphs 105-121, wherein the nucleotide sequence encoding the Cas is under the control of a promoter and a translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells, the fluorescence of which is 0.5-4 times the fluorescence produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in the 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator, and a downstream insulator.

[0285] 123. The use or method of paragraph 122, wherein the fluorescence using the first EOU is 0.5-2 times the fluorescence using the second EOU.

[0286] 124. The use or method of any one of paragraphs 105-123, wherein the nuclease is Cas3 and optionally the DNA construct encodes a homologous Cascade protein.

[0287] 125. The use or method of any one of paragraphs 105-123, wherein the Cas is Cas9.

[0288] 126. The use or method of any one of paragraphs 105-123, wherein the Cas is a type IIIA csm protein or a type IIIB cmr protein.

[0289] 127. The use or method of any one of paragraphs 105-123, wherein the Cas is Csf1.

[0290] 128. The use or method of any one of paragraphs 105-123, wherein the Cas is Cpf1.

[0291] 129. The use or method of any one of paragraphs 105-123, wherein the Cas is Cas13 (optionally Cas13a or Cas13b).

[0292] 130. The use or method of any one of paragraphs 105-123, wherein the Cas is selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, Cas13a, Cas13b and Cas13c.

[0293] 131. The use or method of any one of paragraphs 105-130, wherein the DNA construct comprises one or more nucleotide sequences for producing a crRNA or gRNA operable for Cas nuclease targeting.

[0294] 132. The use or method of any one of paragraphs 105-131, wherein the production strain cell comprises a helper phage genome that can be induced in the cell to produce phage coat protein, wherein the method further comprises inducing the production of phage protein and causing the amplified DNA to be packaged into phage particles or non-self-replicating transduction particles, and further isolating the phage or transduction particles and optionally formulating the particles into a pharmaceutical composition for administration to a human or animal subject to treat a disease or condition or reduce the risk of a disease or condition in the subject.

[0295] 133. The method of paragraph 132, wherein the particle is capable of infecting a target host cell in the subject and transducing the cell with the DNA, wherein Cas and crRNA (or gRNA) encoded by the DNA are expressed in the cell, and the crRNA or (gRNA) is operable to guide Cas to a target nucleotide sequence (optionally a chromosomal sequence) contained in the cell, wherein the Cas cuts the target sequence in the cell, thereby killing the host cell and treating the disease or disorder or reducing the risk of the disease or disorder.

[0296] 134. The method of paragraph 133, wherein the host cell is a bacterial or archaeal cell, optionally, the host cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4), Helicobacter pylori, Streptococcus pneumoniae or Staphylococcus aureus cell.

[0297] 135. The use or method of any one of paragraphs 105-134, wherein each DNA is comprised by a high copy number vector, optionally a high copy number plasmid (optionally the promoter is a constitutive promoter).

[0298] 136. The use or method of any of paragraphs 105-135, wherein each DNA is comprised by a vector according to any of paragraphs 1-78 and 81-83.

[0299] The following terms are also provided:- Terms: 1. A nucleic acid vector for introduction into a host cell, the vector comprising a first nucleotide sequence encoding a type I Cas3 and a second nucleotide sequence encoding one or more Cascade proteins, wherein the first and second sequences are under the control of one or more promoters, and the promoter is used to express the protein in the cell. The vector comprises.

[0300] 2. The vector of clause 1, wherein the vector comprises an operon for expressing Cas3 and Cascade proteins from a Cas module in a cell, the module comprising nucleotide sequences encoding Cas3 and Cascade proteins, and the operon comprises the Cas module under the control of a promoter, the promoter being used to control the expression of Cas3 and Cascade proteins.

[0301] 3. The carrier of clause 2, wherein (a) the first sequence is between the promoter and the second sequence in the operon; (b) the operon does not comprise a nucleotide sequence encoding Cas between the promoter and the first nucleotide sequence; and / or (c) the operon comprises (in 5' to 3' direction) the promoter, the first sequence and the second sequence.

[0302] 4. The vector of any preceding clause, wherein each promoter is a constitutive promoter.

[0303] 5. The vector of any one of clauses 1 to 3, wherein the promoter is repressible (optionally repressible by the tetracycline repressor or the lac repressor).

[0304] 6. The vector of any one of clauses 1 to 3, wherein the promoter is inducible.

[0305] 7. The vector of any preceding clause, wherein the first sequence is under the control of a medium strength promoter.

[0306] 8. The vector of any preceding clause, wherein the first sequence is under the control of a promoter having an Anderson score (AS) of 0.5>AS>0.1.

[0307] 9. The vector of any preceding clause, wherein the first sequence (and optionally the second sequence) is under the control of a promoter and translation initiation site (TIS) combination capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in Escherichia coli strain BW25113 cells, the fluorescence of which is 0.5-4 times the fluorescence produced in Escherichia coli strain BW25113 cells using a second EOU comprising the P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combination, wherein each EOU comprises (in the 5' to 3' direction) an upstream initiator, a respective promoter, a respective TIS, a nucleotide sequence encoding GFP, a 3'UTR, a transcription terminator, and a downstream insulator.

[0308] 10. The vector of clause 9, wherein the fluorescence using the first EOU is 0.5-2 times the fluorescence using the second EOU.

[0309] 11. The vector of any preceding clause, wherein the vector comprises an origin of replication operable in a host cell.

[0310] 12. The vector of any preceding clause, wherein the vector comprises an origin of replication operable in a bacterial cell of a vector production strain, wherein the Cas3 is not operable in the production strain cell to target and cleave its chromosomal sequence.

[0311] 13. The vector of clause 12, wherein the first sequence is under the control of a promoter capable of controlling the expression of Cas3 at a level that is non-toxic to cells of the production strain.

[0312] 14. The vector of any preceding clause, wherein the vector is a high copy number vector.

[0313] 15. The vector of any preceding clause, wherein the first nucleotide sequence or the operon is comprised by a mobile genetic element.

[0314] 16. The vector of any preceding clause, wherein the vector lacks a Cas adaptation module.

[0315] 17. The vector of any preceding clause, wherein the vector lacks a nucleotide sequence encoding one, more or all of Cas1, Cas2, Cas4, Cas6, Cas7 and Cas 8.

[0316] 18. The vector of any preceding clause, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas11, Cas7 and Cas8a1.

[0317] 19. The vector of clause 18, wherein the vector comprises a nucleotide sequence encoding Cas3' and / or Cas3".

[0318] 20. The vector of clause 19, wherein the nucleotide sequence encoding Cas3′ and / or Cas3″ is between the promoter and the sequence listed in clause 18.

[0319] 21. The vector of any one of clauses 18-20, wherein the host cell comprises a Type IA CRISPR array homologous to Cas3.

[0320] 22. The vector of any one of clauses 18-20, wherein the host cell comprises an endogenous IB, C, U, D, E or F type CRISPR / Cas system.

[0321] 23. The vector of any one of clauses 1 to 17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8b1, Cas7 and Cas5.

[0322] 24. The vector of clause 23, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in clause 23.

[0323] 25. The vector of clause 23 or 24, wherein the host cell comprises a type IB CRISPR array homologous to Cas3.

[0324] 26. The vector of clause 23 or 24, wherein the host cell comprises an endogenous type IA, C, U, D, E or F CRISPR / Cas system.

[0325] 27. The vector of any one of clauses 1 to 17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas5, Cas8c and Cas7.

[0326] 28. The vector of clause 27, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in clause 27.

[0327] 29. The vector of clause 27 or 28, wherein the host cell comprises a type 1C CRISPR array homologous to Cas3.

[0328] 30. The vector of clause 27 or 28, wherein the host cell comprises an endogenous type IA, B, U, D, E or F CRISPR / Cas system.

[0329] 31. The vector of any one of clauses 1 to 17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8, Cas2, Cas7, Cas5 and Cas6.

[0330] 32. The vector of clause 31, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in clause 31.

[0331] 33. The vector of clause 31 or 32, wherein the host cell comprises an IU-type CRISPR array homologous to Cas3.

[0332] 34. The vector of clause 31 or 32, wherein the host cell comprises an endogenous type IA, B, C, D, E or F CRISPR / Cas system.

[0333] 35. The vector of any one of clauses 1 to 17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas10d, Cas7 and Cas5.

[0334] 36. The vector of clause 35, wherein the vector comprises a nucleotide sequence encoding Cas3' and / or Cas3".

[0335] 37. The vector of clause 36, wherein the nucleotide sequence encoding Cas3' and / or Cas3" is between the promoter and the sequence listed in clause 35.

[0336] 38. The vector of any one of clauses 35-37, wherein the host cell comprises an ID-type CRISPR array homologous to Cas3.

[0337] 39. The vector of any one of clauses 35 to 37, wherein the host cell comprises an endogenous type IA, B, C, U, E or F CRISPR / Cas system.

[0338] 40. The vector of any one of clauses 1 to 17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8e, Cas11, Cas7, Cas5 and Cas6.

[0339] 41. The vector of clause 40, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in clause 40.

[0340] 42. The vector of clause 40 or 41, wherein the host cell comprises a type IE CRISPR array homologous to Cas3.

[0341] 43. The vector of clause 40 or 41, wherein the host cell comprises an endogenous type IA, B, C, D, U or F CRISPR / Cas system.

[0342] 44. The vector of any one of clauses 1 to 17, wherein the vector comprises (optionally in the 5' to 3' direction) a nucleotide sequence encoding one, more or all of Cas8f, Cas5, Cas7 and Cas6f.

[0343] 45. The vector of clause 44, wherein the vector comprises a nucleotide sequence encoding Cas3 between a promoter and a sequence listed in clause 44, wherein the vector lacks a nucleotide sequence encoding other Cas between the promoter and the sequence encoding Cas3.

[0344] 46. ​​The vector of clause 44 or 45, wherein the host cell comprises an IF-type CRISPR array homologous to Cas3.

[0345] 47. The vector of clause 44 or 45, wherein the host cell comprises an endogenous type IA, B, C, D, U or E CRISPR / Cas system.

[0346] 48. The vector of any one of clauses 1-17, wherein the Cas and Cascade are (a) Type IA Cas and Cascade proteins; (b) Type IB Cas and Cascade proteins; (c) IC-type Cas and Cascade proteins; (d) ID-type Cas and Cascade proteins; (e) Type IE Cas and Cascade proteins; (f) IF-type Cas and Cascade proteins; or (g) IU-type Cas and Cascade proteins.

[0347] 49. The vector of any preceding clause, wherein the Cas and Cascade are E. coli (optionally type IE or IF) Cas and Cascade proteins.

[0348] 50. The vector of clause 49, wherein the Escherichia coli is an ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4.

[0349] 51. The vector of any preceding clause, wherein said Cas and Cascade are (a) Clostridium (e.g., Clostridium difficile) Cas and Cascade proteins, optionally Clostridium difficile that is resistant to one or more antibiotics selected from aminoglycosides, lincomycin, tetracyclines, erythromycin, clindamycin, penicillins, cephalosporins, and fluoroquinolones; (b) Pseudomonas aeruginosa Cas and Cascade proteins, optionally Pseudomonas aeruginosa that is resistant to one or more antibiotics selected from the group consisting of carbapenems, aminoglycosides, cefepime, ceftazidime, fluoroquinolones, piperacillin and tazobactam; or (c) Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae) Cas and Cascade proteins.

[0350] 52. The vector of any preceding clause, wherein the Cas and Cascade are Escherichia coli, Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae, Pyrococcus furiosus or Bacillus halodurans Cas and Cascade proteins.

[0351] 53. The vector of any preceding clause, wherein the Cas3 is a Cas3 of a CRISPR / Cas locus of a first bacterial or archaeal species, wherein the distance between the Cas3 coding sequence of the locus and its cognate promoter is greater than the distance between the Cas3 coding sequence comprised by the vector and the corresponding promoter.

[0352] 54. The vector of any preceding clause, wherein the distance between the promoter and the Cas3 encoding sequence and / or the Cascade protein encoding sequence is shorter than in the corresponding wild-type type I locus.

[0353] 55. The vector of any preceding clause, wherein the vector comprises (i) a CRISPR array for producing crRNA in a host cell, and / or (ii) one or more nucleotide sequences encoding one or more guide RNAs (gRNA or single gRNA), wherein the crRNA or gRNA is homologous to Cas3 (and optionally to a Cascade protein).

[0354] 56. The vector of clause 55 when dependent on clause 2, wherein the array or gRNA encoding sequence is contained by the operator and is under the control of the promoter.

[0355] 57. The vector of clause 56, wherein the array or gRNA encoding sequence is under the control of a promoter that is different from the promoter that controls the expression of Cas3.

[0356] 58. The vector of clause 56 or 57, wherein one or more of the crRNA or gRNA comprises a spacer sequence capable of hybridizing to a target nucleotide sequence of a host cell, wherein the target sequence is adjacent to a PAM that is homologous to Cas3.

[0357] 59. The vector of clause 58, wherein the target sequence is a chromosomal sequence of a host cell.

[0358] 60. The vector of clause 58 or 59, wherein the Cas3 is operable to cleave the target sequence.

[0359] 61. The vector of any preceding clause, wherein the vector is a plasmid or a phagemid.

[0360] 62. A delivery vehicle comprising the vector of any preceding clause, wherein the delivery vehicle is capable of delivering the vector into a host cell.

[0361] 63. The vector of clause 62, wherein the delivery vehicle is a bacteriophage, a non-replicating transduction particle, a nanoparticle carrier, a bacterium, or a liposome.

[0362] 64. The vector or carrier of any preceding clause, wherein the host cell is a bacterial or archaeal cell, optionally, the host cell is a Clostridium difficile, Pseudomonas aeruginosa, Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae or Klebsiella pneumoniae producing extended-spectrum β-lactamase (ESBL)), Escherichia coli (e.g., ESBL-producing Escherichia coli or Escherichia coli ST131-025b:H4), Helicobacter pylori, Streptococcus pneumoniae or Staphylococcus aureus cell.

[0363] 65. The vector or vehicle of any preceding clause for administration to a human or animal subject to treat or reduce the risk of a disease or disorder in said subject.

[0364] 66. The vector or vehicle of clause 65, wherein the disease or disorder is infection of the subject by a host cell (eg, a bacterial cell), or wherein the disease or disorder is mediated by a host cell (eg, a bacterial cell).

[0365] 67. A pharmaceutical composition comprising a carrier or vehicle as defined in any preceding clause and a pharmaceutically acceptable diluent, excipient or carrier.

[0366] It should be understood that the specific embodiments described herein are shown by way of illustration and are not intended to be limiting of the present invention. The main features of the present invention may be employed in different embodiments without departing from the scope of the present invention. Using no more than routine research, those skilled in the art will recognize or be able to determine numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of the present invention and are covered by the claims. All publications and patent applications mentioned in the specification indicate the technical level of those skilled in the art to which the present invention belongs. All publications and patent applications and all U.S. equivalent patent applications and patents are incorporated herein by reference to the extent that each individual publication or patent application is incorporated by reference as if explicitly and individually indicating. References: WO2017 / 118598, US20180140698, US20170246221, US20180273940, US20160115488, US20180179547, US20170175142, US20160024510, US20150064138, US20170022499, US20160345578, US20180155729, US20180200342, WO2017112620, WO2018081502, PCT / EP2018 / 066954, PCT / EP2018 / 066980, PCT / EP2018 / 071454, and USSN 15 / 985,658 and equivalent publications of the United States Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference for providing disclosure that may be used in the present invention and / or for providing one or more features (e.g., features of the carrier) that may be included in one or more claims herein.

[0367] The use of the word "a" or "an" when used with the term "comprising" in the claims and / or specification can mean "one", but it is also consistent with the meaning of "one or more", "at least one", and "one or more than one". Unless explicitly indicated to indicate only alternatives or the alternatives are mutually exclusive, the term "or" used in the claims is used to mean "and / or", although the present disclosure supports definitions indicating only alternatives and "and / or". Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, method used to determine the value, or the variation that exists between the subjects of study.

[0368] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "includes" and "containing"), "having" (and any form of having, such as "having" and "having"), "including" (and any form of including, such as "including" and "including"), or "containing" (and any form of containing, such as "containing" and "containing") are inclusive or open-ended and do not exclude additional unrecited elements or method steps.

[0369] As used herein, the term "or combinations thereof" or the like means all permutations and combinations of the items listed before the term. For example, "A, B, C, or combinations thereof" is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and if order is important in a particular case, BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, combinations containing repetitions of one or more items or terms are expressly included, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and the like. The skilled artisan will appreciate that there is generally no limit on the number of items or terms in any combination unless otherwise apparent from the context.

[0370] Any part of this disclosure may be read in combination with any other part of this disclosure unless otherwise apparent from the context.

[0371] In light of the present disclosure, all compositions and / or methods disclosed and claimed herein can be prepared and performed without undue experimentation. Although the compositions and methods of the present invention have been described in the form of preferred embodiments, it will be apparent to those skilled in the art that variations may be applied to the compositions and / or methods and to the steps or sequence of steps of the methods described herein without departing from the concept, spirit and scope of the present invention. All such similar substitutions and modifications apparent to those skilled in the art are considered to fall within the spirit, scope and concept of the present invention as defined by the appended claims.

[0372] The invention is described in more detail in the following non-limiting examples. Example

[0373] The examples illustrate rapid and precise killing of E. coli strains. As a model programmable nuclease system, we used a CRISPR-guided vector (CGV TM ) specifically targets Escherichia coli MG1655.

[0374] Example 1. Single vector Cas3 and Cascade: Type I CRISPR-Cas system targeting Escherichia coli. Constructing a plasmid (also called CRISPR Guided Vector TM ,CGV TM ), which contains an operon with nucleotide sequences encoding type I Cas3 and Cascade proteins under the control of a common promoter. Clostridium difficile type IB Cas3 and Cascade were used. A homologous CRISPR array containing Clostridium difficile repeat sequences and spacer sequences for targeting the Escherichia coli host cell chromosome was also introduced into the target cell. The adaptation module containing Cas1, Cas2 and Cas4 was omitted in the vector (see Figure 1A ). In the wild-type C. difficile type IB CRISPR / Cas locus, the cas3 gene is 3' to the Cascade genes (cas8b1, cas7, and cas5) and is thus separated from the promoter upstream of the Cascade genes. When we tried this arrangement, we found that the E. coli cells were killed, but surprisingly, when we changed to a synthetic operon arrangement of promoter, cas3, cas8b1, cas7, and cas5 (in a 5' to 3' orientation), we saw significantly higher killing of target E. coli cells.

[0375] The results of using this synthetic operon arrangement are shown in Figure 1. Figure 1B In the figure, a dilution series (10 1 -10 6 ). CRISPR / Cas induces a surprising 99.9% killing of the population ( Figure 1C , gray bars). Growth in the absence of induction is shown in black. CGV TM CRISPR Guided Vector TM , which is a nucleic acid vector comprising a nucleotide sequence encoding a CRISPR / Cas component.

[0376] We also managed to achieve the desired targeted killing of E. coli cells using a similar setup (except using E. coli type IE Cas and Cascade) and a homologous array targeting the host cell E. coli chromosomal DNA (data not shown). In this case, the vector used contained (in the 5' to 3' direction) a promoter that controls the expression of Cas3, Cas8e, Cas11, Cas7, Cas5, and Cas6 in an operon.

[0377] Materials and methods E. coli MG1655 was grown in lysogenic liquid medium (LB) with shaking (250 rpm) at 37° C. Cultures were supplemented with tetracycline (10 μg / mL) and spectinomycin (400 μg / mL) when necessary.

[0378] To construct a plasmid containing the C. difficile CRISPR system under the arabinose-inducible pBAD promoter, the cas3, cas6, cas8b, cas7, and cas5 genes from C. difficile were amplified and cloned into a low copy number plasmid (pSC101 ori). Cas3 was located at the beginning of the operon, followed by cas6, cas8b, cas7, and cas5. The adaptation module (composed of cas1, cas2, and cas4) was omitted in the vector ( Figure 1A A second plasmid was constructed containing an IPTG-inducible single-spacer array targeting a chromosomal intergenic region in E. coli MG1655 ( Figure 1A The spacer was cloned into the CloDF13 ori backbone under the control of the IPTG-inducible Ptrc promoter. It contains 37 nucleotides (ctttgccgcgcgcttcgtcacgtaattctcgtcgcaa) (SEQ ID NO: 26) from the genome of E. coli MG1655. In addition, a 3′-CCT protospacer adjacent motif (PAM) is located near the selected target sequence in the genome of E. coli MG1655 ( Figure 1A ).

[0379] In order to carry out killing determination, two plasmids were transformed into E. coli MG1655 by electroporation. Transformants were grown to mid-logarithmic phase in liquid LB containing antibiotics, and killing efficiency was determined by serial dilution and spot plating on LB and LB+ inducer (0.5mM IPTG and 1% arabinose). Viability was calculated by counting the colony forming units (CFU) on the plate, and the data were calculated as viable cell concentration (CFU / ml).

[0380] Example 2. Single vector Cas3-Cascade and array: Type I CRISPR-Cas system targeting Escherichia coli. Construction of plasmid (which we also refer to as CRISPR Guided Vector TM ,CGV TM), which contains an operon with nucleotide sequences encoding type I Cas3 and Cascade proteins under the control of a common promoter. Clostridium difficile type IB Cas3 and Cascade were used. The adaptation module containing Cas1, Cas2 and Cas4 was omitted in the vector. Also included in the vector is a homologous CRISPR array containing Clostridium difficile repeat sequences and spacer sequences for targeting the Escherichia coli host cell chromosome (see Figure 2A ).

[0381] CGV was transformed into E. coli MG1655. The results of using this synthetic operon arrangement are shown in Figure 2. Figure 2B In the figure, a dilution series (10 1 -10 5 ). CRISPR / Cas induces a 2-log reduction in viable cells of E. coli MG1655 10 reduce( Figure 2C , gray bars). Growth in the absence of induction is shown in black.

[0382] The survival of E. coli MG1655 after induction was followed over time by plating the culture in serial dilutions every 60 minutes for 2 hours (Figure 3). The killing curve revealed that CRISPR / Cas induction mediated rapid killing of E. coli MG1655, resulting in a 2-log 10 reduce. Figure 3B Dilution series (10 1 -10 6 ).

[0383] Materials and methods E. coli MG1655 was grown in synthetic medium (SM) at 37° C. with shaking (250 rpm). Cultures were supplemented with 10 μg / mL tetracycline when required.

[0384] To construct a plasmid containing the C. difficile CRISPR system under the arabinose-inducible pBAD promoter, the cas3, cas6, cas8b, cas7, and cas5 genes from C. difficile were amplified and cloned into a low copy number plasmid (pSC101 ori). Cas3 is located at the beginning of the operon, followed by cas6, cas8b, cas7, and cas5. In addition, an IPTG-inducible single spacer array targeting the chromosomal intergenic region in E. coli MG1655 was included in the vector under the control of the IPTG-inducible Ptrc promoter. Figure 2A ). It contains 37 nucleotides from a PKS gene (previously integrated into the genome of E. coli MG1655) (gtttggcgatggcgcgggtgtggttgtgcttcggcgt) (SEQ ID NO: 27). In addition, a 3′-CCT protospacer adjacent motif (PAM) is located near the selected target sequence in the genome of E. coli MG1655.

[0385] CGV was transformed into E. coli MG1655 by electroporation. Transformants were grown to mid-logarithmic phase in liquid SM containing antibiotics and the killing efficiency was determined by serial dilution and spot plating on LB and LB + inducer (0.5 mM IPTG and 1% arabinose). Viability was calculated by counting colony forming units (CFU) on the plates and the data were calculated as viable cell concentration (CFU / ml).

[0386] To perform a killing curve, E. coli MG1655 carrying CGV was grown to mid-log phase in liquid SM containing antibiotics. The culture was split into two tubes and either inducer (0.5 mM IPTG and 1% arabinose) or PBS was added. Serial dilutions (10 1 -10 6 ) were plated on SM plates containing antibiotics for 2 hours, and the survival of the strains was tracked over time. The survival frequency was calculated by counting the colony forming units (CFU) on the plates, and the data were calculated as viable cell concentrations (CFU / ml).

[0387] Example 3. Precise killing of target strain Escherichia coli MG1655 in the microbiome. Artificial microbial consortia were constructed to study the efficiency of CGV carrying the CRISPR-Cas system of C. difficile to specifically target E. coli MG1655 in the presence of other microorganisms, thereby mimicking the human microbiome.

[0388] The synthetic consortium consisted of three strains (two different species) with different antibiotic resistance profiles: streptomycin-resistant Escherichia coli MG1655 (target strain), ampicillin-resistant Escherichia coli Top10, and chloramphenicol-resistant Lactococcus lactis NZ9000. To establish the consortium, bacterial cultures were grown to mid-log phase separately in brain heart infusion broth (BHI, the optimal growth medium for Lactococcus lactis) and mixed in fresh BHI broth with and without inducers. After induction at 30°C for 1 hour, the composition of the consortium was determined by counting viable colonies on selective plates. Induction of the CRISPR system in the mixed community resulted in >10-fold killing of the target E. coli MG1655, while leaving the E. coli Top10 and L. lactis NZ9000 cell populations unharmed ( Figure 4A ).exist Figure 4B In the figure, a dilution series (10 1 -10 5 ).

[0389] Additionally, CRISPR killing of the target strain E. coli MG1655 in the synthetic microbial consortium was compared to pure culture (i.e., target strain E. coli MG1655 not mixed with another strain or species). Unexpectedly, under both conditions, 4 log killing was achieved when plated on BHI agar plates containing inducers ( Figure 5A ). Thus, surprisingly, killing in a microbiome environment was as effective as killing in pure culture. Figure 5B In the figure, a dilution series (10 1 -10 5 ).

[0390] Materials and methods E. coli MG1655, E. coli Top10 and L. lactis NZ9000 were grown in BHI liquid medium at 30° C. with shaking (250 rpm). The cultures were supplemented with 1000 μg / mL streptomycin, 100 μg / mL ampicillin or 10 μg / mL chloramphenicol, respectively.

[0391] To establish a consortium, bacterial cultures were grown to mid-log phase in BHI containing appropriate antibiotics. The cultures were washed twice in PBS to remove antibiotics and mixed in fresh BHI liquid medium. The mixed cultures were spotted on BHI plates containing streptomycin, ampicillin or chloramphenicol to quantify the initial concentrations of Escherichia coli MG1655, Escherichia coli Top10 and Lactococcus lactis NZ9000, respectively. The mixed culture was divided into two test tubes and inducers (0.5 mM IPTG and 1% arabinose) or PBS were added. After induction at 30°C for 1 hour, the composition of the consortium was calculated by counting colony forming units (CFU) on selective plates, and the data were calculated as viable cell concentrations (CFU / ml).

[0392] Example 4. Application of promoter suppression in vector amplification strains We engineered a population of E. coli Top10 production strain cells containing plasmid CGV DNA and an expressible sequence encoding the Tet repressor (TetR). The DNA contains a nucleotide sequence encoding Cas9 under the control of the Tet promoter (pLtetO-1 promoter). The promoter is usually constitutively turned on, but is inhibited by TetR in our cells. Thus, in this way, we can successfully culture cells and amplify CGV without observing adverse toxicity caused by Cas9 expression.

[0393] In experiments without inhibition, we did not observe any colonies of the production strain bacteria, and we speculate that this is due to Cas9 toxicity. We believe that in addition to providing a method to increase CGV yield (e.g., for subsequent packaging into phage or non-self-replicating transduction particles), our method of using inhibition can also minimize the selection of mutations in DNA that would otherwise be forced by higher Cas9 expression and cleavage (e.g., due to CGV cleavage).

[0394] References Mutalik et al., Nat Methods. 2013 Apr;10(4):354-60. doi:10.1038 / nmeth.2404. Epub 2013 Mar 10, “Precise and reliable gene expression via standard transcription and translation initiation elements”.

[0395] Table 1: Example bacteria Optionally, the target host cell is a cell of a genus or species selected from this table, and / or the producer strain cell is a cell of a genus or species selected from this table.

[0396] Table 2: Sequence Nucleic acid sequences herein are written in 5' to 3' direction; amino acid sequences are written in N-terminal to C-terminal direction.

[0397] SEQ ID NO: 1 (P10) TTCAATTTAATCATCCGGCTCGTATAATGTGTGGA SEQ ID NO: 2 (BCD14) GGGCCCAAGTTCACTTAAAAAGGAGATCAACAATGAAAGCAATTTTCGTACTGAAACAT CTTAATCATGCGGTGGAGGGTTTCTAATG SEQ ID NO: 3 (gfp) ATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTC SEQ ID NO: 4 (Example EOU) SEQ ID NO: 4 gaattcaaaa gatcttaagt aagtaagagt atacgtatat cggctaataa cgtattaaggcgcttcggcg ccttttttta tgggggtatt ttcatcccaa tccacacgtc caacgcacag caaacaccacgtcgacccta tcagctgcgt gctttctatg agtcgttgct gcataacttg acaattaatc atccggctcgtataatgtgt ggaa-BCD-GOI-ggat ccaaactcga gtaaggatct ccaggcatca aataaaacgaaaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc tactagagtcacactggctc accttcgggt gggcctttct gcgtttata SEQ ID NO: 5 (Example Shine Dalgarno sequence) Aaagaggagaaa SEQ ID NO: 26 (spacer sequence) ctttgccgcgcgcttcgtcacgtaattctcgtcgcaa SEQ ID NO: 27 (spacer sequence) gtttggcgatggcgcgggtgtggttgtgcttcggcgt Table 3: Anderson promoter collection a: Also shown in the Anderson catalog, see http: / / parts.igem.org / Promoters / Catalog / Anderson b: Intensity is the Anderson score (AS), e.g., an intensity of 1 is an AS of 1. The reported promoter activity is given as the relative fluorescence of the plasmid in strain TG1 grown to saturation in LB medium. A suitable plasmid is EX-Ptet-S-rbsRFP-P "RFP reporter", as described in http: / / parts.igem.org / Part:BBa_J61002; insertion of the promoter element between the XbaI and SpeI sites generates the RFP reporter.

Claims

1. A method for promoting the viability of production cells during amplification of a DNA construct and increasing the yield of amplified copies of the DNA construct in a bacterial or archaeal production strain cell population, wherein the construct comprises a nucleotide sequence encoding a Cas nuclease under the control of a promoter, the method comprising: The cells are cultured to allow replication of the DNA, thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.

2. In a method for amplifying copies of DNA in a bacterial or archaeal production strain cell population, the use of an attenuated promoter in a DNA construct for promoting production cell viability during amplification of the DNA construct and increasing the yield of amplified DNA produced by the production host cell, the DNA construct comprising a nucleotide sequence encoding a Cas nuclease under the control of the promoter, the method comprising: The cells are cultured to allow replication of the DNA, thereby amplifying the DNA in the cells.

3. The method of claim 1 or the use of claim 2, wherein increasing the yield is carried out by: (a) reducing the toxicity of Cas in the production strain; (b) reducing mutations in the DNA, optionally in Cas coding sequences, in the production strain; and / or (c) reducing the occurrence of Cas cleavage of DNA, optionally producing the occurrence of cleavage of host cell chromosomal DNA or of said DNA construct.

4. The method or use of claim 3, wherein the yield is increased by step (b) and / or step (c), wherein the mutation or cleavage is a mutation or cleavage of the host cell chromosomal DNA or the construct DNA.

5. The method or use of any preceding claim, wherein the production strain cell comprises a helper phage genome that can be induced in the cell to produce phage coat protein, wherein the method further comprises inducing the production of phage protein and causing the amplified DNA to be packaged into phage particles or non-self-replicating transduction particles, and further isolating the phage or transduction particles.

6. The method or use of any preceding claim, wherein the promoter is repressed in the production strain cell.

7. The method or use of claim 6, wherein the repressor is encoded by a nucleic acid in the production strain, optionally encoded by a chromosomally integrated sequence or a sequence contained by an episome, and the repressor is expressed during the DNA amplification method, whereby the promoter controlling Cas expression is suppressed.

8. The method or use of claim 6 or 7, wherein the phage or particle lacks an expressible nucleotide sequence encoding a repressor, whereby the promoter is functional when the DNA is introduced into a target host cell.

9. A method for reducing the occurrence of Cas cleavage of a DNA construct and increasing the yield of amplified copies of the DNA construct in a population of bacterial or archaeal cells, wherein the construct comprises a nucleotide sequence encoding a Cas nuclease under the control of a promoter, the method comprising: culturing the cell to allow replication of the DNA, thereby amplifying the DNA in the cell, wherein the promoter is an attenuated promoter, in: (a) the bacterial or archaeal cell comprises a helper phage genome that can be induced in the cell to produce phage coat protein, wherein the method further comprises inducing the production of phage protein and causing the amplified DNA to be packaged into phage particles or non-self-replicating transduction particles, and further isolating the phage or transduction particles; (b) the promoter is repressed by a repressor in the bacterial or archaeal cell; (c) the repressor is encoded by a chromosomally integrated nucleic acid in the bacterial or archaeal cell; and (d) the phage or particle lacks an expressible nucleotide sequence encoding a repressor, whereby the promoter is functional when the DNA is introduced into a target host cell.

10. Use of an attenuated promoter in a DNA construct for reducing the occurrence of Cas cleavage of the DNA construct and increasing the yield of amplified DNA produced by the host cell in a method for amplifying copies of DNA in a population of bacterial or archaeal cells, the DNA construct comprising a nucleotide sequence encoding a Cas nuclease under the control of the promoter, the method comprising: culturing the cell to allow replication of the DNA, thereby amplifying the DNA in the cell, in: (a) the bacterial or archaeal cell comprises a helper phage genome that can be induced in the cell to produce phage coat protein, wherein the method further comprises inducing the production of phage protein and causing the amplified DNA to be packaged into phage particles or non-self-replicating transduction particles, and further isolating the phage or transduction particles; (b) the promoter is repressed by a repressor in the bacterial or archaeal cell; (c) the repressor is encoded by a chromosomally integrated nucleic acid in the bacterial or archaeal cell; and (d) the phage or particle lacks an expressible nucleotide sequence encoding a repressor, whereby the promoter is functional when the DNA is introduced into a target host cell.

Images