Rice lodging-resistant and yield-related protein STRONG1 as well as coding gene and application thereof

Abstract

The invention discloses a rice lodging resistance and yield related protein STRONG1 as well as a coding gene and application thereof, belongs to the technical field of biology, and particularly discloses application of any one of a protein, a substance for regulating and controlling the expression of the coding gene of the protein or a substance for regulating and controlling the activity or content of the protein. A1) application in improving the lodging resistance of the gramineous plants and / or application in preparing products for improving the lodging resistance of the gramineous plants; a2) application to increase the yield of the gramineous plants and / or application to increase the yield of the gramineous plants.

Description

Technical Field

[0001] The invention relates to a rice lodging resistance and yield-related protein STRONG1 and a coding gene and application thereof in the field of biotechnology. Background Art

[0002] As one of the most important food crops in the world, rice has an annual output that is close to 50% of my country's total grain output and feeds about half of the world's population. However, in recent decades, rice production has faced a huge threat from the reduction of cultivated land and population growth, so it is very urgent to increase rice yield per unit area.

[0003] There are many factors that affect rice yield, among which the three most important factors are the number of panicles, the number of effective panicles and the thousand-grain weight. In the 1960s, dwarf breeding played an important role in solving the problem of rice lodging. However, in recent years, dwarf rice breeding has reached a bottleneck, and it is difficult to significantly increase rice yield. Studies have shown that rice yield will increase with the increase of plant height, but it cannot increase indefinitely, because the increase in plant height will bring serious lodging. Lodging is a common and complex phenomenon in rice production. Rice yield is reduced by up to 10% to 30% each year due to lodging problems, and sometimes even up to 50% in severe cases. Lodging has become one of the important factors restricting rice production. It mainly occurs in the late stage of grain filling, which not only affects mechanized harvesting, but also accelerates rice aging, reduces yield, affects grain quality, etc. It is a stumbling block to light and simple cultivation. Therefore, studying the problem of rice lodging is of great guiding significance for increasing rice yield and promoting light and simple cultivation. Summary of the invention

[0004] The technical problem solved by the invention is to improve the lodging resistance and yield of plants, especially rice.

[0005] In order to solve the above problems, the present invention provides a method for improving plant lodging resistance and yield.

[0006] The method comprises knocking out or reducing or decreasing the expression of a gene encoding a protein in a plant, and / or the activity and / or content of the protein to improve the lodging resistance and yield of the plant;

[0007] The protein is any of the following proteins:

[0008] B1) a protein with an amino acid sequence as shown in SEQ ID NO: 2;

[0009] B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues of the protein shown in B1);

[0010] B3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

[0011] In the present application, the plant may be rice.

[0012] In order to solve the above problems, the present invention also provides a method for cultivating high lodging resistance and high yield.

[0013] The method comprises knocking out or lowering or reducing the expression amount of the coding gene of the above-mentioned protein in the target plant, and / or the activity and / or content of the protein to obtain a plant with high lodging resistance and high yield, wherein the lodging resistance and / or yield of the plant with high lodging resistance and high yield are higher than those of the target plant.

[0014] In the above method, knocking out or reducing or decreasing the expression of the gene encoding the above protein in the plant comprises introducing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3) into the target plant.

[0015] In the above, the nucleic acid molecule may be the nucleic acid molecule described in SEQ ID NO:1.

[0016] In order to solve the above problems, the present invention also provides the following application.

[0017] Use of a protein, a substance that regulates the expression of a gene encoding the protein, or a substance that regulates the activity or content of the protein in any of the following;

[0018] A1) application in improving lodging resistance of gramineous plants and / or application in preparing products for improving lodging resistance of gramineous plants;

[0019] A2) application in increasing the yield of gramineous plants and / or application in preparing the application in increasing the yield of gramineous plants;

[0020] The protein is any of the following proteins:

[0021] F1) The amino acid sequence is the protein shown in SEQ ID NO: 2;

[0022] F2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in F1) and having more than 80% identity with the protein described in F1) and having the same function;

[0023] F3) connecting the N-terminus or / and C-terminus of F1) or F2) to a protein tag to obtain a fusion protein;

[0024] The substance that regulates the expression of the gene encoding the protein or the substance that regulates the activity or content of the protein is any one of the following:

[0025] B1), a nucleic acid molecule encoding the above protein;

[0026] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0027] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0028] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0029] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0030] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0031] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0032] B8), a nucleic acid molecule that inhibits, reduces or down-regulates the expression of the gene encoding the above protein or inhibits, reduces or down-regulates the activity or content of the protein;

[0033] B9), expressing the coding gene of the nucleic acid molecule described in B8);

[0034] B10), an expression cassette containing the coding gene described in B9);

[0035] B11), a recombinant vector containing the coding gene described in B9), or a recombinant vector containing the expression cassette described in B10);

[0036] B12), a recombinant microorganism containing the coding gene described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B11);

[0037] B13), a transgenic plant cell line containing the gene described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11);

[0038] B14), transgenic plant tissue containing the coding gene described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11);

[0039] B15), a transgenic plant organ containing the coding gene described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

[0040] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0041] In the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0042] In the above proteins, the above 80% identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0043] Among the above proteins, SEQ ID No: 2 consists of 608 amino acid residues and is named as STRONG1 protein, and its encoding gene is STRONG1 gene.

[0044] In the present application, the regulation may be overexpression, upregulation, enhancement, or increase, and / or knockout, reduction, or decrease.

[0045] In the present application, the knockout or reduction or decrease of the substance expressed by the gene encoding the protein or the activity or content of the protein can improve the lodging resistance of Gramineae plants and / or high Gramineae plant yield. Overexpression, upregulation, enhancement or increase of the substance expressed by the gene encoding the protein or the activity or content of the protein can reduce the lodging resistance of Gramineae plants and / or high Gramineae plant yield.

[0046] In the above application, the protein is derived from rice.

[0047] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0048] In the nucleic acid molecules described in B1) or B8), a person skilled in the art can easily mutate the nucleotide sequence encoding the protein STRONG1 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 80% or more identity with the nucleotide sequence of the protein STRONG1 isolated from the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein STRONG1 and have the function of the protein STRONG1.

[0049] The above 80% or more identity may be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0050] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Perresidue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0051] Herein, the vector is well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be pROKII vector;

[0052] In the above biological materials, the expression cassette described in B2) or B9) refers to a DNA capable of expressing the gene in a host cell, and the DNA may include not only a promoter for initiating gene transcription, but also a terminator for terminating gene transcription. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoter from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both can be induced by methyl jasmonate); heat shock promoter (U.S. Pat. No. 5,187,267); tetracycline-inducible promoter (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters.All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0053] In the above B3) or B11), the recombinant vector may be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector may be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85 or pCAMBIA1391-Xb. When MOG1 is used to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. As a specific embodiment, the present application uses the pCM1307 vector as an expression vector. As a specific embodiment, the present application uses the pHUE411 vector as a gene knockout vector.

[0054] As a specific embodiment, the microbial strain in the recombinant microorganism may be Agrobacterium EHA105.

[0055] In the above application, the nucleic acid molecule described in B1) is a DNA molecule having a nucleotide sequence as shown in SEQ ID NO:1.

[0056] In the above application, the nucleic acid molecule B8) is a gRNA targeting the above protein encoding gene, and the target sequence of the gRNA is shown in SEQ ID NO:4.

[0057] In order to solve the above problems, the present invention provides a method for cultivating plants with low lodging resistance and yield.

[0058] The method comprises up-regulating or enhancing or increasing the expression amount of the gene encoding the above protein in the target plant, and / or the activity and / or content of the protein to obtain a plant with low lodging resistance and yield, wherein the lodging resistance and / or yield of the low lodging resistance plant are lower than those of the target plant.

[0059] In any of the above methods or any of the above applications, the plant is any of the following:

[0060] J1) Gramineae;

[0061] J2) Oryza plants;

[0062] J3) Rice.

[0063] The above protein or the above nucleic acid molecule.

[0064] The present invention discovered a gene associated with lodging resistance and yield, named STRONG1. The gene can be used to improve the lodging resistance and yield of rice, which is of great significance for breeding new rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0066] Figure 1 The phenotypes and differential loci of the two parents;

[0067] Figure 2 Cloning of the STRONG1 gene;

[0068] Figure 3 Detection of expression level of STRONG1 overexpressed plants and statistics of mutation types of knockout plants; where: a shows the expression level of STRONG1 overexpressed plants; b shows the mutation type information of STRONG1 knockout plants;

[0069] Figure 4 The lodging resistance phenotype and statistical graph of STRONG1 overexpression and knockout plants; among which: a shows the stem phenotype of STRONG1 overexpression and knockout plants at maturity; b shows the statistics of stem thickness of STRONG1 overexpression and knockout plants; c shows the statistics of cavity wall thickness of STRONG1 overexpression and knockout plants; d shows the statistics of section modulus of STRONG1 overexpression and knockout plants; e shows the statistics of bending resistance of STRONG1 overexpression and knockout plants; f shows the statistics of thrust resistance of STRONG1 overexpression and knockout plants;

[0070] Figure 5 Yield phenotypes and statistical graphs of STRONG1 overexpression and knockout plants; wherein: a shows the ear morphology phenotype of STRONG1 overexpression plants; b shows the ear morphology phenotype of STRONG1 knockout plants; c shows the primary branch number statistics of STRONG1 overexpression and knockout plants; d shows the secondary branch number statistics of STRONG1 overexpression and knockout plants; e shows the grain number statistics of STRONG1 overexpression and knockout plants; f shows the single plant yield statistics of STRONG1 overexpression and knockout plants;

[0071] Figure 6 Grain phenotypes and statistical graphs of STRONG1 overexpression and knockout plants; among them: a shows the grain phenotype graph of STRONG1 overexpression plants; b shows the grain phenotype graph of STRONG1 knockout plants; c shows the grain length statistics of STRONG1 overexpression and knockout plants; d shows the grain width statistics of STRONG1 overexpression and knockout plants; e shows the grain thickness statistics of STRONG1 overexpression and knockout plants; f shows the thousand-grain weight statistics of STRONG1 overexpression and knockout plants;

[0072] Figure 7 The expression and subcellular localization of STRONG1 in various tissues of the two rice parents; Root is root, Leaf is leaf, Sheath is leaf sheath, Panicle is panicle, Stem-A is the first node under the panicle, Stem-B is the second node under the panicle, Stem-C is the third node under the panicle, and Stem-D is the fourth node under the panicle; among them: a shows the expression level of STRONG1 in various tissues of the two rice parents; b shows the subcellular localization of STRONG1 in tobacco;

[0073] In each figure, * indicates P < 0.05; ** indicates P < 0.01. DETAILED DESCRIPTION

[0074] The invention discloses rice lodging resistance and yield-related protein STRONG1 and its encoding gene and application.

[0075] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0076] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0077] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0078] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0079] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0080] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0081] YEP medium: weigh 10 g yeast extract, 5 g NaCl, 10 g tryptone, dissolve in distilled water to 1 L, add 15 g agar powder (solid culture medium), and sterilize at 121°C for 15 min.

[0082] YEB liquid medium: Dissolve 10 g of peptone, 10 g of yeast extract, 5 g of NaCl and 15 g of agar powder in 1 L of deionized water, then adjust the pH to 7.0 and sterilize at high temperature and high pressure for 20 min.

[0083] AAM liquid medium:

[0084] AAM bulk (20×): Weigh 6.645 g CaCl2, 58.8 g KCl, 3.4 g KH2PO4, 7.4 g MgSO4·7H2O, and dilute to 1 L with distilled water.

[0085] MS trace (200×): Weigh 166 mg KI, 3.38 g MnSO4·H2O, 1.24 g H3BO3, 50 mg Na2MoO4·2H2O, 1.72 g ZnSO4·7H2O, 5 g CoCl2·6H2O, and 5 g CuSO4·5H2O, and make up to 1 L with distilled water.

[0086] AAM organic (100×): Weigh 50 mg vitamin B1, 50 mg vitamin B5, and 10 mg vitamin B6, and dilute to 1 L with distilled water.

[0087] Iron salt (100×): Weigh 3.73 g Na2EDTA·2H2O and 2.78 g FeSO4·7H2O, and dilute to 1 L with distilled water.

[0088] Measure 50 mL of AAM macro, 5 mL of MS micro, 10 mL of AAM organic, 10 mL of iron salt, 500 mg of hydrolyzed casein, 68.5 g of sucrose, 36 g of glucose, 75 mg of glycine, 877 mg of glutamine, 266 mg of aspartic acid, and 228 mg of arginine, dissolve in 1 L of deionized water, adjust the pH to 5.5, and sterilize at 115 ° C for 15 min. After sterilization, add 1 mL of 20 mg / mL acetosyringone.

[0089] NB solid culture medium: Dissolve 20 mL of 50×N6 macromolecular solution, 10 mL of 100×B5 micromolecular solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose and 3 g of plant gel in 1 L of distilled water, then adjust the pH to 5.8 and sterilize under high temperature and high pressure for 20 min.

[0090] Co-culture medium: dissolve 20 mL of 50×N6 macro-mother liquor, 10 mL of 100×B5 micro-mother liquor, 1 mL of 1000×B5 organic mother liquor, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gelatin and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.4, sterilize at 121°C for 15 min, and add 10 g of 0.22 μM filtered sterilized glucose and 20 mg of acetosyringone when cooled to 50-60°C.

[0091] Delayed screening medium: Dissolve 20 mL of 50×N6 macromolecular solution, 10 mL of 100×B5 micromolecular solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gelatin and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 500 mg of cephalosporin sterilized by 0.22 μM filtration when cooled to 50-60°C.

[0092] The first round of screening culture medium: dissolve 20 mL of 50×N6 macromolecular liquor, 10 mL of 100×B5 micromolecular liquor, 1 mL of 1000×B5 organic mother liquor, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gelatin and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 500 mg of cephalosporin and 50 mg of hygromycin sterilized by 0.22 μM filtration when cooled to 50-60°C.

[0093] Second round screening culture medium: dissolve 20 mL of 50×N6 macromolecular liquor, 10 mL of 100×B5 micromolecular liquor, 1 mL of 1000×B5 organic mother liquor, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 50 mg of 0.22 μM filtered sterilized hygromycin when cooled to 50-60°C.

[0094] Predifferentiation medium: dissolve 20 mL of 50×N6 macromolecular solution, 10 mL of 100×B5 micromolecular solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of phytogels, 1 mg of 6-BA, 2 mg of NAA and 5 mg of ABA in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 50 mg of 0.22 μM filtered sterilized hygromycin when cooled to 50-60°C.

[0095] Differentiation medium: Dissolve 20 mL of 50×N6 macro-mother solution, 10 mL of 100×B5 micro-mother solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of phytogels, 2 mg of 6-BA, 1 mg of NAA and 1 mg of KT in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 50 mg of 0.22 μM filtered sterilized hygromycin when cooled to 50-60°C.

[0096] Seedling culture medium: Dissolve 25 mL of 20×MS macro-mother solution, 2.5 mL of 200×MS micro-mother solution, 2.5 mL of 200×MS iron salt mother solution, 2.5 mL of 200×MS organic mother solution, 3 g of plant gel, 0.5 mg of NAA and 0.25 mg of paclobutrazol in 1 L of distilled water, adjust the pH to 5.8, and sterilize at 121°C for 15 min.

[0097] The solutes and their concentrations of 20×MS bulk mother liquor are: 38.00 g / L KNO3, 8.80 g / L CaCl2·2H2O, 7.40 g / LMgSO4·7H2O, 3.40 g / L KH2PO4, 33.00 g / L NH4NO3, the solvent is water, and the pH is natural.

[0098] The solutes and their concentrations of 200×MS trace mother solution are: 4.46g / L MnSO4·4H2O, 0.166g / L KI, 1.24g / L H3BO3, 1.72g / L ZnSO4·7H2O, 0.050g / L Na2MoO4·2H2O, 0.005g / L CuSO4·5H2O, 0.005g / L CoCl2·6H2O, the solvent is water, and the pH is natural.

[0099] The solutes and concentrations of 200×MS iron salt mother solution are: 5.56 g / L FeSO4·7H2O, 7.46 g / L Na2·EDTA·2H2O, the solvent is water, and the pH is natural.

[0100] The solutes and their concentrations of the 200×MS organic mother solution are: 20 g / L inositol, 100 mg / L nicotinic acid, 100 mg / L pyridoxine hydrochloride, 100 mg / L thiamine hydrochloride, 400 mg / L glycine, the solvent is water, and the pH is natural.

[0101] The solutes and their concentrations of 50×N6 bulk mother liquor are: 141.50 g / L KNO3, 20 g / L KH2PO4, 23.15 g / L (NH4)2SO4, 9.25 g / L MgSO4·7H2O, 8.30 g / L CaCl2·2H2O, the solvent is water, and the pH is natural.

[0102] The solutes and their concentrations of 100×B5 trace mother liquor are: 0.3g / L H3BO3, 1g / L MnSO4·4H2O, 0.0025g / LCoCl2·6H2O, 0.0025g / L CuSO4·5H2O, 0.2g / L ZnSO4·7H2O, 0.025g / LNa2MoO4·2H2O, 0.075g / L KI, the solvent is water, and the pH is natural.

[0103] The solutes and their concentrations of 1000×B5 organic mother liquor are: 2 g / L glycine, 100 g / L inositol, 1 g / L nicotinic acid, 1 g / L pyridoxine hydrochloride, 10 g / L thiamine hydrochloride, the solvent is water, and the pH is natural.

[0104] The rice variety Nipponbare is hereinafter named wild-type rice or WT.

[0105] Alternating light culture means alternating light culture and dark culture, and the conditions are: 28°C; 14 hours of light culture / 10 hours of dark culture; the light intensity during light culture is 90μE / m2 / s.

[0106] In Examples 1 to 3 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0107] The present invention will be further described below in conjunction with embodiments:

[0108] Example 1. Acquisition of STRONG1 gene

[0109] The present invention uses the germplasm materials of MYDN with thick stems identified in the early stage to cross and backcross with Nipponbare (NIP) with thin stems to create a positioning population ( Figure 1 ). Based on the stem thickness phenotype, the target gene was located in the 6.68kb segment between markers MM996 and MM998 on chromosome 6. According to the annotation information of the RGAP (http: / / rice.plantbiology.msu.edu / ) database, it was found that there was only one ORF in the location interval, encoding a microtubule-binding protein, and this ORF was named STRONG1 (ST1). The results of MYDN and NIP sequencing showed that there were 5 variant sites in the genomic interval between the two parents, including 1 SNP in the exon, which was a synonymous mutation, and 4 variant sites in the promoter, including 1 SNP and 3 InDels. These results show that this ORF may be the candidate gene ( Figure 2 ).

[0110] The STRONG1 gene was amplified by PCR using the cDNA of the rice variety Nipponbare as a template and 5'-ATGGCCGACGGGGTGGAGGA' and 5'-TCATTGGTAGTTGCGAGTAA' as primers.

[0111] After sequencing, the CDS sequence of the STRONG1 gene was SEQ ID No: 1, the nucleotide sequence was SEQ ID No: 3, and the amino acid sequence of the encoded protein was SEQ ID No: 2, which was named STRONG1 protein.

[0112] SEQ ID No: 1 (sequence 1) is as follows:

[0113]

[0114] SEQ ID No: 2

[0115] *。

[0116] SEQ ID No: 3

[0117]

[0118] Example 2: Functional verification of STRONG1

[0119] 1. Construction of overexpression vector

[0120] The nucleotide sequence of the STRONG1 gene was amplified with primers ST1-OE-F / R to obtain a PCR product of 1806 bp, which was connected to the plant expression vector pCM1307 (available from China Agricultural University, Rice SPL10 positively regulates trichome development through expression of HL6 and auxin-related genes. Journal of Integrative Plant Biology, 2021, 63: 1521-1536) by homologous recombination. The primers used are as follows:

[0121] ST1-OE-F:

[0122] ATCGATACCGTCGACGAGCTCTCTAGA ACTAGT ATGGCCGACGGGGTGGAGGAGG (the underline is the recognition site of restriction endonuclease SpeI) (SEQ ID No: 6)

[0123] STI-OE-R:

[0124] AGACTGGTGATTTTTGCGGAGTACCCG GGTACC TCATTGGTAGTTGCGAGTAAGCC (underlined is the recognition site of restriction endonuclease KpnI) (SEQ ID No: 7)

[0125] The recombinant plasmid with correct sequencing was named ST1-OE.

[0126] 2. Construction of knockout vector

[0127] (1) Log in to the website http: / / crispor.tefor.net / and screen the target sites. The two target site sequences designed in this experiment are: 5'-GATACGCGCGCTACGGCTGTCGG-3' (SEQ ID No: 5) and 5'-TTGCAGCAGAAGCGACTTTGCGG-3' (SEQ ID No: 4).

[0128] (2) The primer sequences are as follows:

[0129] ST1-MT1-BsF:

[0130] 5'-ATATATGGTCTCTGGCGATACGCGCGCTACGGCTGTGTT-3'(SEQ ID No:8)

[0131] ST1-MT1-F0:

[0132] 5'-TGATACGCGCGCTACGGCTGTGTTTTAGAGCTAGAAATAGC-3'(SEQ ID No:9)

[0133] ST1-MT2-R0:

[0134] 5'-AACCAAAGTCGCTTCTGCTGCACGCTTCTTGGTGCC-3'(SEQ ID No:10)

[0135] ST1-MT2-BsR:

[0136] 5'-ATTATTGGTCTCTAAACCAAAGTCGCTTCTGCTGCAC-3'(SEQ ID No:11)

[0137] (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-MT1T2 (available from China Agricultural University, ACRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14: 327.) as a template. -BsF / -BsR was 10 μM; -F0 / -R0 was 0.5 μM.

[0138] (4) Purify and recover the PCR product and establish the following enzyme digestion-ligation system.

[0139] Table 1

[0140]

[0141] Note: pHUE411 is publicly available from China Agricultural University, A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14: 327.

[0142] (5) The ligation product was transformed into competent E. coli. The vector with correct sequencing was named ST1-CR.

[0143] 3. Obtaining genetically modified rice

[0144] (1) Recombinant bacteria

[0145] The two correctly prepared overexpression vectors ST1-OE and knockout vectors ST1-CR were transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method to obtain recombinant bacteria, which were used to infect callus of transgenic recipient variety (Nipponbare).

[0146] (2) Transgenic rice

[0147] The classic Agrobacterium-mediated callus infection method is adopted, and the specific steps are as follows:

[0148] a. Obtaining embryonic callus: After removing the shell of mature Nipponbare seeds, disinfect them with alcohol, disinfect them twice with sodium hypochlorite, rinse them once with sterile water, and air-dry them on a clean bench. Inoculate the obtained sterile Nipponbare seeds into NB medium, culture them in the dark at 28°C for 2 weeks, peel off the embryonic callus, subculture them to new NB medium, and subculture them for 2 weeks (subculture twice).

[0149] b. Preparation of infection solution: Pipette the preserved Agrobacterium solution and spread it on the solid culture medium containing rifampicin and kanamycin. Incubate it in the dark at 28℃ for 2 days. Scrape a small amount of Agrobacterium into AAM liquid culture medium. The concentration of the bacterial solution OD600 is about 0.3.

[0150] c. Co-cultivation: Select naturally dispersed, bright yellow granular callus tissue with a diameter of about 3 to 5 mm and put it into a conical flask. Add the prepared infection solution and infect for 10 minutes. Use sterile filter paper to absorb the excess infection solution and place it on the co-cultivation medium covered with a layer of filter paper. Co-cultivate at 20°C for 2 to 3 days.

[0151] d. Screening of resistant callus: Take out the callus after co-cultivation, wash it 5-6 times with sterile water by rapid shaking, then wash it with sterile water containing cephalosporin and carbenicillin for 20 minutes, and finally place it on sterile filter paper to drain for 3 hours. Then move it to the delayed screening medium. After one week, move it to the first round screening medium, and after two weeks, move it to the second round screening medium and continue to culture for two weeks.

[0152] e. Differentiation: The resistant callus obtained by screening was inoculated into a pre-differentiation medium and cultured in the dark at 28°C for 2 weeks, then transferred to a differentiation medium and cultured in light for 2 to 3 weeks to obtain transgenic seedlings.

[0153] f. Strong seedlings: Move the transgenic seedlings to the strong seedling culture medium. After the seedlings take root and grow, remove them from the culture bottle, wash the culture medium on the roots, harden the seedlings for 1 to 2 weeks, and move them to the field for planting until they mature to obtain T0 generation transgenic plants.

[0154] (3) Identification of transgenic positive seedlings: The obtained T0 generation transgenic seedlings are identified and positive transgenic plants are screened, followed by continuous self-pollination to eventually obtain T3 generation homozygous transgenic plants.

[0155] Identification of overexpression transgenic plants: Genomic DNA of rice seedlings was extracted and used as a template. PCR amplification was performed using a primer pair consisting of hyg(280)-F: 5'ACGGTGTCGTCCATCACAGTTTGCC'3 (SEQ ID No: 12) and hyg(280)-R: 5'TTCCGGAAGTGCTTGACATTGGGGA'3 (SEQ ID No: 13) to obtain PCR amplification products. The following judgment was then made: if a PCR amplification product contained a DNA fragment of about 280 bp, the rice seedling corresponding to the PCR amplification product was a positive seedling.

[0156] The leaves of the positive plants were taken and stored in liquid nitrogen to obtain the corresponding samples to be tested. The total RNA of the samples to be tested was extracted by Trizo1 method, and then the first-strand cDNA was reverse transcribed using a reverse transcription kit (a product of TransGen). The cDNA was diluted 50 times with sterile water as a template, and the relative expression level of the STRONG1 gene was detected by real-time fluorescence quantitative PCR (Ubq gene Os03g0234200 was an internal reference gene).

[0157] The primers for detecting the STRONG1 gene were ST1-RT-F: 5'-TGCTCAGTTTGCAGCAGAA-3' (SEQ ID No: 14) and ST1-RT-R: 5'-TCAAGCGGTGCGAGAATG-3' (SEQ ID No: 15).

[0158] The primers for detecting the Ubq gene were Ubq-F: 5'-ACCAGCTGAGGCCCAAGA-3' (SEQ ID No: 16) and Ubq-R: 5'-ACGATTGATTTAACCAGTCCATGA-3' (SEQ ID No: 17).

[0159] Real-time fluorescence quantitative PCR was performed on an Applied Biosystems 7500 Real Time PCR system (ABI, USA), with three replicates per parallel experiment. -ΔΔCT Calculate the relative expression.

[0160] ΔΔCT=(CT.Target-CT.Ubiquitin)Time x-(CT.Target-CT.Ubiquitin)Time 0

[0161] Time x represents any time point, and Time 0 represents 1-fold target gene expression after Ubiquitin correction.

[0162] Some test results can be found in Figure 3 The results showed that the relative expression levels of the STRONG1 gene in each T3 generation homozygous transgenic rice were significantly increased compared with Nipponbare. Three of the T3 generation homozygous transgenic rice lines were named OE-1, OE-2, and OE-3.

[0163] Identification of knockout transgenic plants: Genomic DNA from leaves of T0 generation plants was used as templates, and primer pairs consisting of primers T1F: 5'-ATCTGCTCCTGCTGTTCGT' (SEQ ID No: 18) and primer T1R: 5'-CCAATCCATTCACCCA CT-3' (SEQID No: 19) were used for PCR amplification to obtain the corresponding PCR amplification products. The PCR amplification products were subjected to Sanger sequencing. The sequencing results were compared with the Cas9 target sequence of the STRONG1 gene (shown in SEQ ID No: 4), and the mutation types were counted.

[0164] Test results see Figure 3 . Three STRONG1 homozygous mutant plants were obtained and named st1-1, st1-2 and st1-3. The STRONG1 genes on the two homologous chromosomes of st1-1 underwent the same mutation, specifically, a deletion of 4 nucleotides (CGGC) occurred on both homologous chromosomes, which caused a frameshift and led to the premature termination of protein translation. The STRONG1 genes on the two homologous chromosomes of st1-2 underwent the same mutation, specifically, a deletion of 5 nucleotides (CGGCT) occurred on both homologous chromosomes, which caused a frameshift and led to the premature termination of protein translation. The STRONG1 genes on the two homologous chromosomes of st1-3 underwent the same mutation, specifically, a deletion of 1 nucleotide (T) occurred on both homologous chromosomes, which caused a frameshift and led to the premature termination of protein translation.

[0165] 4. Identification of relevant traits of transgenic rice

[0166] The traits of each transgenic rice positive line obtained in step three and its corresponding recipient variety (Nipponbare) were manually investigated, including stem diameter, cavity wall thickness, section modulus, bending resistance, thrust resistance, number of stalks, number of grains per panicle, yield per plant and grain shape.

[0167] Figure 4 The lodging resistance phenotype and statistical graph of STRONG1 overexpression and knockout plants. Compared with the wild type (NIP), the stem diameter, cavity wall thickness, section modulus, bending resistance and thrust resistance of the knockout plants were significantly increased; the stem diameter, cavity wall thickness, section modulus, bending resistance and thrust resistance of the overexpression plants were significantly reduced.

[0168] Figure 5 Yield phenotypes and statistical graphs of STRONG1 overexpression and knockout plants. Compared with the wild type, the number of primary branches, secondary branches, number of grains per ear and yield per plant of the knockout plants increased significantly; the number of secondary branches, number of grains per ear and yield per plant of the overexpression plants decreased significantly.

[0169] Figure 6 Grain phenotypes and statistical graphs of STRONG1 overexpression and knockout plants. Compared with the wild type, the overexpression plants had increased grain length, decreased grain width, decreased grain thickness, and decreased 1000-grain weight; the knockout plants had decreased grain length, increased grain width, increased grain thickness, and increased 1000-grain weight.

[0170] Example 3: Expression and subcellular localization analysis of STRONG1 in various rice tissues

[0171] 1. Real-time fluorescence quantitative PCR

[0172] Total RNA was extracted from various tissues of rice varieties Nipponbare and Ant Dannuo, and reverse transcriptase M-MLV was used to synthesize the first chain cDNA. The first chain cDNA was used as a template, and primers ST1-RT-F and ST1-RT-R were used to amplify the specific fragment of the STRONG1 gene. Primers Ubq-F and Ubq-R were used to amplify the specific fragment of the rice Ubq gene as an internal reference for real-time quantitative analysis.

[0173] The results are as follows Figure 7 As shown, the STRONG1 gene was expressed in all tissues of Nipponbare and Ant Dannuo.

[0174] 2. Subcellular localization of STRONG1

[0175] 1. Construction of STRONG1-GFP vector

[0176] To study the subcellular localization of STRONG1, this study constructed a STRONG1-GFP fusion protein vector, and connected the CDS of STRONG1 without a stop codon to the plant expression vector pSuper 1300-GFP (available from China Agricultural University, RGN1 controls grain number and shapes panicle architecture in rice. Plant Biotechnology Journal, 2021, 20(1): 158-167). After sequencing verification, it was named ST1-GFP. Using Nipponbare cDNA as a template, the primers used are as follows:

[0177] ST1-ps1300-F:

[0178] 5'CGATACACCAAATCGACTCTAGA AAGCTT ATGGCCGACGGGGTGGAGGAG-3' (SEQ ID No: 20) (the underline indicates the recognition site of restriction endonuclease Hind III)

[0179] ST1-ps1300-R:

[0180] 5'CAGCTCCTCGCCCTTGCTCACCAT GGTACC TTGGTAGTTGCGAGTAAGCCC-3' (SEQ ID No: 21) (underlined is the recognition site of restriction endonuclease and KpnI)

[0181] 2. Transient expression in tobacco leaves

[0182] (1) A single Agrobacterium clone containing the ST1-GFP plasmid activated on YEP solid medium was selected and cultured overnight in 3-5 mL YEP liquid medium containing the corresponding antibiotics at 28°C and 200 rpm.

[0183] (2) Inoculate the culture medium at a ratio of 1:100 into YEP medium containing the corresponding antibiotics. Incubate overnight at 28°C, 200 rpm until the OD600 is 1-2. Collect the cells by centrifugation at 5,000 rpm for 5 min.

[0184] (3) Resuspend the cells in a resuspension buffer (10 mM MgCl2, 10 mM MES, 150 μM acetosyringone) to an OD600 concentration of 1.0 and incubate at room temperature for 2-4 h.

[0185] (4) Select tobacco leaves that are about 4 weeks old and have good growth, use a sterile 1 mL medical syringe to absorb the bacterial solution, and slowly inject the bacterial solution into the tobacco leaves from the lower epidermis. After the tobacco leaves are injected with the bacterial solution, continue to culture at 22-24°C and observe directly under a laser confocal microscope after 2-3 days.

[0186] The results are as follows Figure 7 As shown, STRONG1 is a protein localized to microtubules.

[0187] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A method for improving plant lodging resistance and / or yield, characterized in that: Including improving plant lodging resistance and / or yield by knocking out or lowering or reducing the expression of a protein encoding gene in a plant, and / or the activity and / or content of the protein; The protein is any of the following proteins: B1) the amino acid sequence is the protein shown in SEQ ID NO: 2; B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues of the protein shown in B1); B3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

2. A method for cultivating lodging-resistant and / or high-yield plants, characterized in that: The method comprises knocking out or lowering or reducing the expression level of the gene encoding the protein described in claim 1 in the target plant, and / or the activity and / or content of the protein to obtain lodging-resistant and / or high-yield plants, wherein the lodging resistance and / or yield of the plants are higher than those of the target plants.

3. The method according to claim 1 or 2, characterized in that The knocking out or lowering or reducing the expression of the gene encoding the protein of claim 1 or 2 in the plant comprises introducing the nucleic acid molecule described in B1) of claim 4, the expression cassette described in B2) or the recombinant vector described in B3) into the target plant.

4. Use of a protein, a substance that regulates the expression of a gene encoding the protein, or a substance that regulates the activity or content of the protein in any of the following; A1) application in improving lodging resistance of gramineous plants and / or application in preparing products for improving lodging resistance of gramineous plants; A2) application in increasing the yield of gramineous plants and / or application in preparing products for increasing the yield of gramineous plants; The protein is any of the following proteins: F1) The amino acid sequence is the protein shown in SEQ ID NO: 2; F2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in F1) and having more than 80% identity with the protein described in F1) and having the same function; F3) connecting the N-terminus or / and C-terminus of F1) or F2) to a protein tag to obtain a fusion protein; The substance that regulates the expression of the gene encoding the protein or the substance that regulates the activity or content of the protein is any one of the following: B1), a nucleic acid molecule encoding the protein according to claim 1 or 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), a nucleic acid molecule that inhibits, reduces or down-regulates the expression of a gene encoding the protein of claim 1 or 2, or inhibits, reduces or down-regulates the activity or content of the protein; B9), expressing the coding gene of the nucleic acid molecule described in B8); B10), an expression cassette containing the coding gene described in B9); B11), a recombinant vector containing the coding gene described in B9), or a recombinant vector containing the expression cassette described in B10); B12), a recombinant microorganism containing the coding gene described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B11); B13), a transgenic plant cell line containing the coding gene described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11); B14), transgenic plant tissue containing the coding gene described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11); B15), a transgenic plant organ containing the coding gene described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

5. The use according to claim 4, characterized in that: The protein is derived from rice.

6. The use according to claim 4 or 5, characterized in that: B1) The nucleic acid molecule described is a DNA molecule with a nucleotide sequence as shown in SEQ ID NO:

1.

7. The use according to claim 4 or 5, characterized in that: B8) The nucleic acid molecule is a gRNA targeting the protein-coding gene of claim 1, and the target sequence of the gRNA is shown in SEQ ID NO:

4.

8. A method for cultivating crops prone to lodging and / or low yield, characterized in that: The method comprises up-regulating, enhancing or increasing the expression level of the gene encoding the protein of claim 1 in the target plant, and / or the activity and / or content of the protein to obtain a lodging-prone and / or low-yield plant, wherein the lodging resistance and / or yield of the plant are lower than those of the target plant.

9. The method according to any one of claims 1 to 3 or 8 or the use according to any one of claims 4 to 7, characterized in that: The plant is any of the following: J1) Gramineae; J2) Oryza plants; J3) Rice.

10. The protein or nucleic acid molecule of claim 4.

Images