Application of MTB03g gene or encoded protein thereof in regulation and control of plant growth or yield

Abstract

The invention discloses an application of an MTB03g gene or an encoded protein thereof in regulation and control of plant growth or yield. The MTB03g gene in rice is mutated to obtain the MTB03g gene mutant, and compared with wild rice, the MTB03g gene mutant shows phenotypes such as increased plant height, shortened tillering included angle, increased tillering number in the growth period, increased effective tillering number, increased hundred-grain weight and shortened spike length; it is proved that the MTB03g gene or the encoded protein thereof has the functions of regulating and controlling plant growth, plant types or yield and the like. The invention has application prospects in the aspects of regulating and controlling plant growth, increasing plant yield and the like.

Description

Technical Field

[0001] The present invention relates to a new use of genes isolated from Gramineae plants, in particular to a new use of genes isolated from rice ( Oryza sativa ) MTB03g Use of a gene or its encoded protein in regulating plant growth or yield, belonging to MTB03g New areas of use for genes or their encoded proteins. Background Art

[0002] Rice( Oryza sativa L. ) is one of the most important food crops in the world, and its output accounts for about 1 / 4 of the world's total food output. More than half of the world's population relies on rice as their staple food. In recent years, due to the slow increase in rice yield, some areas have seen stagnant yield growth. Therefore, whether rice production can meet the growing population demand in the future has become an especially important part of the world's food security issues. The greater challenge is how to significantly increase yields under the existing or even reduced planting area. In the process of rice planting, physiological indicators such as plant height, number of tillers, number of effective tillers, tiller angle, panicle length and 100-grain weight may all affect the final rice yield. Therefore, it is urgent to tap the rice gene pool and screen genes that can regulate rice plant height, number of tillers, number of effective tillers, tiller angle, panicle length and 100-grain weight, which will have application prospects in regulating rice growth and increasing rice yield. Summary of the invention

[0003] The main purpose of the present invention is to MTB03g gene, MTB03g protein, containing MTB03g Gene expression cassette or containing MTB03g Recombinant plant expression vectors of genes are used to regulate plant growth or yield.

[0004] To achieve the above purpose, the main technical solutions adopted by the present invention include: One aspect of the present invention is to MTB03g gene, MTB03g protein, containing MTB03g Gene expression cassette or containing MTB03g The recombinant plant expression vector of the gene is used to regulate plant growth or plant type.

[0005] In a preferred specific embodiment of the present invention, the regulating plant growth is to promote rice growth; wherein, the promoting rice growth includes increasing plant height and shortening tillering angle; and the regulating plant shape is to make the rice plant shape compact.

[0006] Another aspect of the present invention is to MTB03g gene, MTB03g protein, containing MTB03g Gene expression cassette or containing MTB03gRecombinant plant expression vectors of genes are used to regulate plant yield.

[0007] In a preferred specific embodiment of the present invention, the regulating plant yield is to increase plant yield; wherein, the increasing plant yield includes increasing the number of tillers, the number of effective tillers, and the 100-grain weight of the plant; and shortening the ear length.

[0008] For reference, the present invention provides an embodiment. MTB03g Gene mutation MTB03g The gene expression level is reduced or the normal function of the MTB03g protein is defective, thereby increasing the plant height; shortening the tillering angle; increasing the number of tillers, the number of effective tillers, and the 100-grain weight of the plant; shortening the ear length; and promoting plant growth or increasing plant yield.

[0009] The mutations include MTB03g One or more nucleotides are substituted, deleted and / or added to the nucleotide sequence of a gene or its promoter. Preferably, the mutation can be obtained by physical mutagenesis, chemical mutagenesis, or gene editing. Physical mutagenesis includes, but is not limited to, radiation mutagenesis, space breeding, etc.; chemical mutagenesis includes mutagenesis caused by treatment with mutagens such as EMS; the gene editing method includes, but is not limited to, ZFN, TALE and / or CRISPR / Cas, etc.

[0010] Those skilled in the art can use conventional methods such as conventional gene knockout or gene editing technology to modify the gene in plants. MTB03g Gene knockout mutation, such as constructing MTB03g Gene knockout vectors or constructed using gene editing technology MTB03g CRISPR / Cas9 gene editing vectors, etc., can be used to edit genes in plants MTB03g Gene knockout or mutation are methods that are well known to those skilled in the art.

[0011] Those skilled in the art know that the main principle of the CRISPR / Cas gene editing system or gene editing method is to find the location of gene editing in the host genome through a nucleic acid fragment called guide RNA (gRNA), that is, the targeted DNA sequence, and then cut the DNA through the Cas protein. In this application, the Cas protein includes but is not limited to Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13 and / or Cas14.

[0012] The interference MTB03gThe normal expression or normal function of a gene or promoter can be interfered with by RNA interference technology (RNAi) to interfere with the normal expression of the gene encoding the MTB03g protein or its promoter or to cause defects in its normal function. RNA interference technology is a conventional technology in the art. It specifically binds to the homologous region of the mRNA expressed by the target gene through a 21-23bp short-chain double-stranded RNA (siRNA) or a long-chain double-stranded RNA (dsRNA; double-strand RNA), thereby degrading the mRNA and achieving the effect of inhibiting gene expression.

[0013] A preferred specific embodiment of the present invention, a MTB03g The construction of gene editing vector includes: MTB03g The target sequence for introducing mutations into the gene and the fragments of the homology arms are connected to the vector backbone to obtain a gene editing vector.

[0014] The gene editing vector may also contain a selective marker gene for selecting transformed cells, for selecting transformed cells or tissues. The marker gene includes genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds. In addition, the marker gene also includes phenotypic markers, such as β-galactosidase and fluorescent protein.

[0015] The transformation protocol and the protocol for introducing the polynucleotide or polypeptide into the plant may vary depending on the type of plant or plant cell being transformed. Suitable methods for introducing the polynucleotide into plant cells include microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-velocity ballistic bombardment. In certain embodiments, various transient transformation methods may be used to transform rice. MTB03g Genes are provided to plants. Transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5:81-84).

[0016] A preferred embodiment of the present invention is a method for inhibiting plant growth, comprising: overexpressing in a plant MTB03g Gene, MTB03g The increased expression of the gene may enhance the function or activity of the MTB03g protein.

[0017] The overexpression can be achieved by constructing a plant recombinant expression vector, including: MTB03gThe gene is connected to the expression control element to obtain a recombinant plant expression vector; the recombinant plant expression vector may be composed of a 5' non-coding region, the nucleotides shown in SEQ ID NO.1 and a 3' non-coding region; wherein the 5' non-coding region may include a promoter sequence, an enhancer sequence and / or a translation enhancement sequence; the promoter may be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region may include a terminator sequence, an mRNA cleavage sequence, etc. Suitable terminator sequences may be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase terminator regions.

[0018] In a preferred embodiment of the present invention, the plant is a grass plant; preferably, the grass plant is rice.

[0019] Another aspect of the present invention is to provide a rice-derived compound capable of regulating plant growth or yield. MTB03g gene or its encoded protein.

[0020] The present invention MTB03g The nucleotide sequence of the CDS of the gene is selected from any one of the nucleotide sequences described in (a) to (e) below: (a) the polynucleotide sequence shown in SEQ ID No. 1; (b) a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 3; (c) a polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under stringent hybridization conditions, and the polynucleotide sequence still has the function of regulating plant growth or yield; (d) a polynucleotide sequence having at least 95% or more identity with the polynucleotide sequence shown in any one of (a) to (c), which still has the function of regulating plant growth or yield; (e) A polynucleotide sequence that is complementary to the polynucleotide sequence described in any one of (a) to (d), and the polynucleotide sequence still has the function of regulating plant growth or yield.

[0021] The percentage of sequence identity described in the present invention can be obtained by well-known bioinformatics algorithms, including Myers and Miller algorithm, Needleman-Wunsch global alignment method, Smith-Waterman local alignment method, Pearson and Lipman similarity search method, Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0022] Those skilled in the art can easily adopt known methods, such as directed evolution or point mutation, to MTB03g The nucleotide sequence of the gene is mutated. MTB03g Nucleotides with 75% or higher identity to the nucleotide sequence of a gene are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as the encoded protein has the function of regulating plant growth or yield.

[0023] In addition, the nucleotide sequence described in the present invention can be DNA, such as cDNA, genomic DNA or recombinant DNA; it can also be RNA, such as mRNA or hnRNA.

[0024] The present invention MTB03g The genomic nucleotide sequence of the gene is shown in SEQ ID No.2.

[0025] The amino acid sequence of the MTB03g protein described in the present invention is selected from the amino acid sequence shown in any one of the following (a)-(d): (a) the amino acid sequence shown in SEQ ID NO.3; (b) a protein variant obtained by deleting or replacing one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.3, wherein the protein variant still has the function or activity of regulating plant growth or yield; (c) a protein variant obtained by inserting one or more amino acid residues into the amino acid sequence shown in SEQ ID NO.3, wherein the protein variant still has the function or activity of regulating plant growth or yield; (d) A protein having 80% or more identity with the amino acid sequence shown in SEQ ID NO. 3, which still has the function or activity of regulating plant growth or yield.

[0026] The present invention uses wild-type rice as experimental material and uses gene editing to MTB03g The gene mutation resulted in a mutant strain that was defective in the normal function of the MTB03g protein. Compared with the wild type, MTB03g The plant height of the gene mutant increased; the tiller angle was shortened; the number of tillers, the number of effective tillers and the weight of 100 grains increased; the ear length was shortened; that is, the growth performance and yield of the mutant were improved. In addition, MTB03g The tillering angle of the gene mutant is shortened, making the plant compact and conducive to dense planting. MTB03g It has the function of negatively regulating plant growth or yield. The invention has application prospects in regulating plant growth and increasing plant yield. Definitions of terms used in this invention Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0027] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-strand or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless specifically limited otherwise, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences and explicitly specified sequences of conservative modifications thereof. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0028] "Stringent hybridization conditions" as used herein refer to conditions of low ionic strength and high temperature as known in the art. Typically, under stringent conditions, the detectable degree of hybridization of a probe to its target sequence is higher than the detectable degree of hybridization to other sequences (e.g., at least 2 times greater than background). Stringent hybridization conditions are sequence-dependent and will vary under different environmental conditions, with longer sequences specifically hybridizing at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the stringency of hybridization or washing conditions. For detailed guidance on nucleic acid hybridization, reference may be made to the literature (Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid hybridization"). acidassays.1993). More specifically, the stringent conditions are usually selected to be about 5-10°C lower than the thermal melting point (Tm) of the specific sequence at a specified ionic strength pH. Tm is the temperature (under specified ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence in a balanced state (because the target sequence is present in excess, 50% of the probes are occupied in a balanced state at Tm). The stringent conditions may be the following conditions: wherein the salt concentration is lower than about 1.0 M sodium ion concentration at pH 7.0 to 8.3, usually about 0.01 to 1.0 M sodium ion concentration (or other salts), and the temperature is at least about 30°C for short probes (including but not limited to 10 to 50 nucleotides), and at least about 60°C for long probes (including but not limited to greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least two times the background hybridization, optionally 10 times the background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The wash can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0029] The "plurality" mentioned in the present invention generally means 2-8, preferably 2-4; the "replacement" mentioned refers to the replacement of one or more nucleotide residues with different nucleotide residues; the "deletion" mentioned refers to the reduction in the number of nucleotide residues, that is, the lack of one or more nucleotide residues therein; the "insertion" mentioned refers to the change of the nucleotide residue sequence, which results in the addition of one or more nucleotide residues relative to the natural molecule.

[0030] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0031] The term "operably linked" refers to a functional connection between two or more elements. The operably linked elements may be contiguous or non-contiguous.

[0032] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0033] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0034] The term "gene editing vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered to be expressed in plant cells, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 for MTB03g Flowchart for the construction of gene mutant strains; Figure 2 Wild type and MTB03g Comparison of phenotypes of gene mutant strains at different stages; Figure 2 -A is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-2 strain at 60 days; Figure 2 -B is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-2 strain at 80 days; Figure 2 -C is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-3 strains at 60 days; Figure 2 -D is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-3 strains at 80 days; Figure 3 Wild type and MTB03g The growth statistics of gene mutant strains; Figure 3 -A is wild type and MTB03g Plant height statistics of gene mutant strains; Figure 3 -B is wild type and MTB03g Statistical diagram of tillering angle of gene mutant strains; Figure 4 Wild type and MTB03g Statistical chart of the yield of gene mutant strains; Figure 4 -A is wild type and MTB03g Statistical graph of tillering number of gene mutant strains; Figure 4 -B is wild type and MTB03g Statistical graph of the number of effective tillers of gene mutant strains; Figure 4 -C is wild type and MTB03g Statistical graph of rice panicle length of gene mutant strains; Figure 4 -D is wild type and MTB03g Statistics of 100-grain weight of gene mutant strains. DETAILED DESCRIPTION

[0036] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0037] Test Example 1 MTB03g Gene mutation transformation, screening and functional identification experiments 1 Construction of gene editing vector according to MTB03g The target sequence (GTACATGGCAAACCTCCCGTTGG (SEQ ID No. 4)) was designed based on the nucleotide sequence of the CDS of the gene (SEQ ID No. 1), and the MTB03g The target sequence for introducing mutations in the gene and the target fragment of the homology arm were connected to the linearized vector backbone WMC025-pCBSG032. The connection system is shown in Table 1. After mixing on ice, put it in a PCR instrument and connect it at 37℃ for 30 min, and then put it on ice or store it at 4℃.

[0038] MTB03g

[0039] MTB03g

[0040] The amino acid sequence of the MTB03g protein is as follows: * (SEQ ID No. 3).

[0041] Table 1 Recombination connection system

[0042] After taking the competent DH5α out of the refrigerator, quickly put it on ice. After 5 minutes, add 10 µL of the ligation product when the bacterial block is dissolved, let it stand on ice for 25 min, heat shock at 42°C for 45 s, let it stand on ice for 2 min (do not shake), add 100 µL of LB liquid culture medium without antibiotics, put it in 37°C, shake it at 200 rpm for 1 h, spread it on LB solid culture medium containing 50 μg / mL kanamycin, and culture it at 37°C for one day.

[0043] 12 single clones were randomly picked from the cultured plates and placed in 2 mL sterile EP tubes. 500 µL of LB liquid culture medium was added to the sterile EP tubes in advance and the tubes were placed in a shaker at 37°C and 200 rpm for 6 h. 5 µL of bacterial solution was aspirated for PCR of each sample. The reaction system of bacterial solution PCR is shown in Table 2. Positive clones with the correct band size were selected by gel electrophoresis for sequencing.

[0044] The nucleotide sequences of primers QC-F / QC-R used in colony PCR are as follows: QC-F: CTGGCGAAAGGGGGATGTGCTGCAA (SEQ ID No. 5); QC-R: TTCAAACAAGTGTGACAAAAA (SEQ ID No. 6).

[0045] Table 2 Reaction system of bacterial liquid PCR

[0046] The plasmid with the correct sequencing results was stored in a -20°C refrigerator to complete the construction of the gene editing vector.

[0047] 2 Genetic transformation of rice Infection solution: 50 g sucrose, 2.2 g MS powder, 0.5 g MES, 500 μL Silwet L-77. First add 800 mL distilled water, adjust the pH value to 5.7 with 1 M KOH, add distilled water to make up to 1000 mL, and sterilize by high pressure.

[0048] Induction medium: N6 max Stock solution (10×) 100 mL, N6 min Stock solution (100×) 10 mL, Fe 2+ -EDTA stock solution (100×) 10 mL, vitamin stock solution (100×) 10 mL, 2, 4-D stock solution 2.5 mL, proline 0.6 g, CH 0.8 g, sucrose 30 g, plant gel 3 g, first add 900 mL of distilled water, adjust the pH value to 5.8 with 1 M KOH, add distilled water to make up to 1 L, then boil and dispense into 100 mL Erlenmeyer flasks, and sterilize by high pressure.

[0049] Solid co-culture medium: N6 max Stock solution (10×) 12.5 mL, N6 min Stock solution (100×) 1.25 mL, Fe 2+-EDTA stock solution (100×) 1.25 mL, vitamin stock solution (100×) 2.5 mL, 2, 4-D stock solution 0.625 mL, proline 0.15 g, CH 0.2 g, sucrose 7.5 g, agar powder 2 g, first add 200 mL of distilled water, adjust the pH to 5.6 with 1 M KOH, add distilled water to 250 mL, and sterilize by high pressure. Before use, add 5 mL of 50% glucose and 250 μL of LAS stock solution.

[0050] Screening medium: N6 max Stock solution (10×) 25 mL, N6 min Stock solution (100×) 2.5 mL, Fe 2+ -EDTA stock solution (100×) 2.5 mL, vitamin stock solution (100×) 2.5 mL, 2, 4-D stock solution 0.625 mL, proline 0.15 g, CH 0.2 g, sucrose 7.5 g, agar powder 2 g, first add 200 mL of distilled water, adjust the pH value to 6.0 with 1 M KOH, add distilled water to 250 mL, and sterilize by high pressure. When using, add 250 μL Hn (50 mg / ml) and 500 μL Cn (250 mg / mL), pour into a sterilized plate, blow dry on a clean bench for about 2 h before use.

[0051] Differentiation medium: MS max Stock solution (10×) 100 mL, MS min Stock solution (100×) 10 mL, Fe 2+ -EDTA stock solution (100×) 10 mL, vitamin stock solution (100×) 10 mL, KT stock solution 2.0 mL, NAA stock solution 0.2 mL, proline 0.6 g, CH 0.8 g, D-sorbitol 30 g, sucrose 30 g, plant gel 3.0 g, first add 900 mL of distilled water, adjust the pH value to 5.8 with 1 M KOH, add distilled water to make up to 1 L, then boil and dispense into 100 mL conical flasks, and sterilize by high pressure.

[0052] Rooting medium: MS max Stock solution (10×) 50 mL, MS min Stock solution (100×) 5 mL, Fe 2+-EDTA stock solution (100×) 5 mL, vitamin stock solution (100×) 5 mL, sucrose 20 g, plant gel 3.0 g, first add 900 mL of distilled water, adjust the pH to 5.8 with 1 M KOH, add distilled water to 1 L, then boil and dispense into rooting tubes, and sterilize by high pressure.

[0053] Transform the gene editing vector into Agrobacterium: Place 1 µL of the gene editing vector into 20 µL of Agrobacterium culture medium (EHA105-WM), place in an ice bath for 5 min, freeze in liquid nitrogen for 5 min, place in a 37°C water bath for 5 min, and place in an ice bath for 5 min. Add 100 µL of antibiotic-free LB liquid medium, place in a 28°C, 200 rpm shaker for 2 h, directly apply to LB solid medium containing 50 μg / mL kanamycin and 50 μg / mL rifampicin, and culture at 28°C for two days.

[0054] Two days later, a single clone was picked and placed in a 5 mL sterile EP tube. 2 mL of LB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL rifampicin was added to the sterile EP tube in advance and cultured overnight. 400 μL of bacterial solution was placed in 100 μL 75% sterile glycerol, marked, and stored in a -80℃ refrigerator.

[0055] Select mature rice seeds, peel off the husk, pour into a 50 mL centrifuge tube, add 75% ethanol to disinfect for 1 min, pour out the ethanol, rinse with sterile water, pour out, add 30% sodium hypochlorite to disinfect for 20 min, pour out the sodium hypochlorite and rinse with sterile water 5-6 times. Use a pipette to absorb excess water and transfer the seeds to the induction medium, 20-25 seeds per dish. After the callus grows, the original embryo can be used for direct transformation.

[0056] Streak the Agrobacterium EHA105 containing the target gene vector on LB solid medium containing 50 μg / mL kanamycin and culture in the dark at 28°C for 2 days until a single colony appears. Prepare the infection solution and use a pipette to aspirate the infection solution to wash off the Agrobacterium on the plate to obtain the Agrobacterium suspension for co-cultivation of rice transformation.

[0057] Select a sufficient number of callus tissues (in good condition, bright yellow in color, round and hard in texture, and preferably with a particle diameter of about 3 mm) and place them in a 100 mL sterile conical flask, add an appropriate amount of Agrobacterium suspension (ensure that there is enough bacterial liquid in contact with the material), and place them at room temperature for infection for 20 minutes, shaking them from time to time. Pour out the bacterial liquid, place the callus tissue on a sterile filter paper to absorb the excess bacterial liquid, and then transfer it to a solid co-culture medium covered with a layer of sterile filter paper, and culture it in the dark at 26°C for 3 days.

[0058] MTB03gThe flowchart of gene mutant construction is as follows Figure 1 As shown in the figure, the specific steps are as follows. After 3 days of co-culture, the callus tissue was washed, and the callus on the solid co-culture medium was sown into a sterilized triangular flask with a 1 mL blue pipette tip, and sterile water was added to rinse both sides. The third time was rinsed with sterile water containing 500 μL / L carbenicillin. After the excess water was sucked off by the pipette, the callus was transferred to a sterile filter paper and the water on the callus was blown dry by the wind of the clean bench. The blowing time was controlled at about 30 min. After the callus was blown dry, it was transferred to the screening medium for screening culture. The culture conditions were 28-30℃ and dark culture. The screening time was 3-4 weeks. After one month of screening, bright yellow positive callus can be seen growing. At this time, the positive callus can be picked to the differentiation medium for differentiation and regeneration. 16 positive callus were placed on each differentiation dish and placed in a 28-30℃ greenhouse for light culture. Generally, green spots can emerge from the callus in about 10 days, and seedlings will differentiate after about 10 days. When the differentiated seedlings grow to about 2-3cm and have obvious root systems, they can be transferred to rooting medium to grow. The rooting medium should be poured into a relatively high bottle or tube so that the rooted seedlings have enough space to grow taller. The rooting culture conditions are 28-30℃ and sterile light culture.

[0059] After transplanting, the resistance gene and target site of T0 plants were detected by PCR. The reaction system and reaction procedure of PCR detection are shown in Tables 3 and 4. The primers for detecting resistance genes are HYG-F1 / HYG-R1, and the primers for detecting target sites are LOC_Os03g054200_J2281092-A1-F1 / R1. The nucleotide sequences of the two sets of primers are as follows: HYG-F1: CAAAGATCGTTATGTTTATCGGCACT (SEQ ID No. 7); HYG-R1: TTGGCGACCTCGTATTGGGAA (SEQ ID No. 8).

[0060] LOC_Os03g05420_J2281092-A1-F1:TTGGTCCTCTTGGTCTGC (SEQ ID No. 9); LOC_Os03g05420_J2281092-A1-R1: AGTCCTCTGCTACGCTTG (SEQ ID No. 10).

[0061] Table 3 Reaction system for PCR detection

[0062] Table 4 PCR reaction procedure

[0063] 3 MTB03g Functional identification test of gene mutant rice 3.1 MTB03g Results of identification of growth performance of gene mutant rice The rice seeds were spread flat on a culture dish lined with moist filter paper at 28°C for germination. After 3 days, the rice seeds were basically germinated and transferred to a rice culture box for culture at 28°C for about 30 days. They were then transferred to a rice field for continued growth. A measuring ruler was used to measure the distance from the root to the top of the rice 60 and 80 days after germination, the width of the widest part in the middle of the rice leaf, and the angle between the outermost tiller of the rice and the vertical line at 60 and 80 days was measured.

[0064] The phenotypic results of rice at 60 and 80 days after germination are as follows Figure 2 As shown, Figure 2 -A is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-2 strain at 60 days; Figure 2 -B is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-2 strain at 80 days; Figure 2 -C is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-3 strain at 60 days; Figure 2 -D is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-3 strain at 80 days; compared with the wild type, MTB03g The mutant strains showed the trait of higher plant height; Figure 3 Wild type and MTB03g Statistical chart of the growth of gene mutant strains; among them, the statistical results of plant height are as follows Figure 3 -A shows that compared with the wild type, the MT1-2 strain increased by 4.4%, and the MT1-3 strain increased by 6.0%; the statistical results of tillering angle are shown in Figure 3 -B shows that compared with the wild type, MTB03g The mutant strains showed a tight tiller angle. Compared with the wild type, the tiller angle of the MT1-3 strain was shortened by 1.7%, which was more conducive to dense planting. MTB03g The growth performance of the gene mutant strain was improved.

[0065] 3.2 MTB03g Yield identification results of gene mutant rice The rice seeds were spread flat in a petri dish with moist filter paper at 28°C for germination. After 3 days, the rice seeds were basically germinated and transferred to a rice culture box for culture at 28°C for about 30 days. They were transferred to a rice field for continued growth until 60 days. The number of tillers per rice plant was counted by a timer. When the rice was mature, the distance from the base to the tip of the rice panicle after mature harvest was measured with a measuring ruler, the number of tillers per rice plant was counted with a timer, and the weight of 100 full rice seeds was weighed with an analytical balance.

[0066] wild type and MTB03g The yield indicators of gene mutant rice are as follows Figure 4 As shown, Figure 4 -A is the statistical result of the number of rice tillers, compared with the wild type, MTB03g The tillering number of the mutant rice strains increased significantly, with the MT1-2 strain increasing by 16.4% and the MT1-3 strain increasing by 14.3%; Figure 4 -B is the statistical result of the number of effective tillers at the mature stage of rice. Compared with the wild type, MTB03g The number of effective tillers of the mutant rice increased, with the MT1-3 line increasing by 31.4%; Figure 4 -C is the statistical result of the panicle length at the mature stage of rice. Compared with the wild type, MTB03g The panicle length of the mutant rice was significantly shortened, with the MT1-3 line shortened by 5.2%; Figure 4 -D is the statistical result of 100-grain weight at rice maturity. Compared with the wild type, MTB03g The 100-grain weight of the mutant rice was significantly increased, and the MT1-2 strain increased by 8.0%. MTB03g The yield of the gene mutant strain was improved.

Claims

1. MTB03g Gene, MTB03g protein 、 contain MTB03g Gene expression cassette or containing MTB03g The use of a recombinant plant expression vector of a gene in regulating plant growth or plant type; wherein, The plant is a grass plant.

2. The use according to claim 1, characterized in that The regulating plant growth is to promote rice growth; wherein, the promoting rice growth includes increasing the height of rice plants; and the regulating plant shape is to make the rice plant shape compact.

3. MTB03g Gene, MTB03g protein 、 contain MTB03g Gene expression cassette or containing MTB03g Use of a recombinant plant expression vector of a gene in regulating plant yield; wherein, The plant is a grass plant.

4. The use according to claim 3, characterized in that: The regulating plant yield is to increase rice yield; wherein, the increasing rice yield includes increasing the number of rice tillers, the number of effective tillers or the weight of 100 grains; or shortening the length of rice panicles.

5. The use according to any one of claims 1 to 4, characterized in that: include: The plants MTB03g Gene mutation or silencing MTB03g The reduced expression of the gene may cause defects in the normal function of the MTB03g protein.

6. The use according to claim 1, characterized in that: The regulating plant growth is inhibiting plant growth.

7. The use according to claim 6, characterized in that include: Will MTB03g Overexpression of genes in plants increases MTB03g The expression amount or expression level of the gene; or enhancing the function or activity of the MTB03g protein.

8. The use according to claim 1 or 3, characterized in that: The grass plant is rice.

9. The use according to claim 1 or 3, characterized in that: The MTB03g The nucleotide sequence of the CDS of the gene is selected from the nucleotide sequence described in (a) or (b) below: (a) the polynucleotide sequence shown in SEQ ID NO.1; (b) A polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.

3.

10. The use according to claim 1 or 3, characterized in that The amino acid sequence of the MTB03g protein is the amino acid sequence shown in SEQ ID NO.3.

Images