Centrifugal column method-based phage nucleic acid extraction method

Abstract

The invention relates to a method for extracting bacteriophage nucleic acid based on a centrifugal column method. The method comprises the steps of urea cracking, denaturation, adsorption, rinsing and the like. According to the technical principle that high-concentration urea can unfasten an inclusion body structure for denaturation and purification, a denaturation lysate containing urea is used for destroying phage capsid protein to expose internal nucleic acid, phage nucleic acid extraction is carried out based on a centrifugal column method, and compared with a commercial virus nucleic acid extraction kit, the method has the advantages of being simple and efficient, and the application prospect is wide. The method is economical and convenient, and nucleic acid extraction can be completed within 45 minutes.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, relates to a bacteriophage nucleic acid extraction technology, and particularly relates to a bacteriophage nucleic acid extraction method based on a centrifugal column method. Background Art

[0002] Bacteriophage is a type of virus that can specifically infect microorganisms such as bacteria, fungi, and actinomycetes. It is a biological entity composed of a layer of protein or lipoprotein capsid wrapped with internal nucleic acid. It is widely distributed in soil, water, air, or animals and plants. Its bactericidal mechanism against bacteria is mainly completed by the lysis of host strain cells mediated by lytic phages. After adsorption and infection, lytic phages can use the host bacteria biosynthesis mechanism, and finally cause the host bacteria cells to lyse and die and release progeny phages. It was successfully used in the early 1920s to treat bacterial infections in humans and animals, but the large-scale application of antibiotics has gradually slowed down the development of phage therapy. Phages have high and strict host specificity. While mediating the rapid lysis and death of host bacteria, they have almost no effect on human or animal cells, showing extremely high biosafety. At the same time, as an important member of the microecological environment, it involves all aspects of maintaining the stability of the microecological system. It faces the dilemma of the spread of antibiotic resistance. The use of phages and their derivatives as a potential alternative therapy to antibiotics has once again attracted widespread attention from researchers.

[0003] In order to clarify the mechanism behind the biological characteristics of phages and guide the development of new therapies and antimicrobial drugs, the extraction of phage genome nucleic acid sequences is crucial in many studies. Phage genome information can reveal its mechanism of infecting hosts, gene functions, drug resistance, host specificity and other internal mechanisms. Before modifying phages based on genetic engineering and synthetic biology strategies, synthesizing new artificial phages or using phage vectors for biological component delivery research, it is necessary to understand the phage genome information in detail. Due to the similarities between phages and eukaryotic cell viruses, conventional phage nucleic acid sequence extraction methods mainly rely on commercial virus extraction kits. The most critical steps in these kits are to use proteinase K (such as DNA Viral Genome Extraction Kit; Solarbio, D2400) or OBProtease Solution (such as EZNA Viral DNA Kit; Omega, D3892) to cleave the phage capsid protein, expose the internal nucleic acid, and use a silicon-based material nucleic acid adsorption column to adsorb the nucleic acid and then rinse it multiple times to achieve the purpose of purifying and recovering the phage nucleic acid. The original purpose of developing these kits was to be used for the extraction of eukaryotic viral genomes. Although there are certain similarities between the enrichment, separation and purification of eukaryotic viruses and phage research, the phage enrichment and purification operations are much simpler than those of eukaryotic viruses. The standard steps provided in the commercial kits can be reasonably streamlined when applied to phage nucleic acid extraction. In addition, the proteinase K and OB Protease Solution commonly used in the kits have a high loss rate and are relatively expensive, which to a certain extent is not conducive to their widespread application in phage research.

[0004] Currently, there is no patented solution for the extraction of bacteriophage nucleic acid and there are few commercial solutions. Therefore, developing a simple, efficient and low-cost method for extracting bacteriophage nucleic acid is particularly important in the research of bacteriophages and their derivatives. Summary of the invention

[0005] The purpose of the present invention is to provide a method for extracting phage nucleic acid based on a centrifugal column method, so as to overcome the problems that the current phage extraction kit has a high loss rate, is relatively expensive, and is inconvenient to use.

[0006] The present invention is achieved through the following technical scheme: a method for extracting phage nucleic acid based on a centrifugal column method, characterized in that the method comprises the following steps: (1) Take 1 mL of phage enrichment solution and mix it with an equal volume of denaturing lysis solution by inversion, and let it stand at room temperature for 3 min; (2) Take 1.6 mL of denaturation buffer, mix it with the solution in the previous step, gently invert it up and down 6 to 10 times, leave it at room temperature for 5 minutes, centrifuge it at 4°C, 13,000 r / min for 10 minutes, and carefully take the supernatant; (3) Place the supernatant from the previous step into the nucleic acid adsorption column, let it stand for 2 min, then centrifuge at 4°C, 12,000 r / min for 2 min, discard the waste liquid, and add more liquid in batches if there is too much liquid; (4) Add 600 μL of rinse solution to the adsorption column, centrifuge at 12,000 r / min at 4°C for 1 min, and discard the waste liquid; (5) Repeat step (4) once; (6) Centrifuge the adsorption column at 4°C, 12,000 rpm for 2 min, open the lid, and leave at room temperature for 5 min to remove the remaining rinse solution. (7) Place the adsorption column in a clean centrifuge tube, add 50 μL of sterile deionized water to the center of the adsorption membrane, place at room temperature for 5 min, and centrifuge at 4°C, 12,000 r / min for 1 min; (8) The eluate obtained by centrifugation is placed in a new adsorption column again, left at room temperature for 2 min, and then centrifuged at 4°C and 12,000 r / min for 2 min to obtain the phage genomic DNA.

[0007] 2. The method for extracting phage nucleic acid based on the centrifugal column method according to claim 1 is characterized in that: in step (1), the phage enrichment solution is prepared by centrifuging 5 mL of host bacteria-phage overnight culture at 4°C and 5000 r / min for 15 min, and the supernatant is filtered through a 0.22 μm filter membrane.

[0008] 3. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: the configuration of the denaturing lysis solution in step (1) is: Tris 30-50 mmol / L, NaCl 500 mmol / L, urea 6-8 mol / L, which are fully dissolved in 1000 mL of deionized water and adjusted to pH 7.5 using hydrochloric acid.

[0009] 4. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: the configuration of the denaturing buffer in step (2) is: 3 mol / L potassium acetate, 5 mol / L acetic acid, and deionized water is added to 1000 mL.

[0010] 5. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: the configuration of the rinsing solution in step (4) is: Tris 10 mmol / L, fully dissolved in 200 mL of deionized water, adjusted to pH 7.5 with hydrochloric acid, and supplemented with 800 mL of anhydrous ethanol before use.

[0011] The positive effects of adopting the above technical solutions: (1) The present invention replaces the proteinase K or OB Protease Solution in the commercial viral nucleic acid extraction kit with a protein denaturing lysis solution containing 8 mol / L urea and which can be stably stored at room temperature. The lysis solution can effectively hydrolyze the phage protein capsid and release the internal nucleic acid for adsorption and recovery, thereby effectively reducing the economic cost of the phage nucleic acid extraction process; (2) All reagents used in the present invention can be prepared manually, and the extraction steps are further optimized based on the commercial virus nucleic acid extraction kit. The method can obtain phage genome nucleic acid for further experimental analysis within 8 steps, and nucleic acid extraction can be completed within 45 minutes, which has the advantages of short-term and high efficiency; (3) This invention innovatively proposed a standardized process for phage nucleic acid extraction, filling the research gap in the relevant field and laying the foundation for phage-related research. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a plaque picture of the T7 phage standard strain; Figure 2 This is a plaque image of T4-like phage P9; Figure 3 This is a plaque picture of T7-like phage Q5; Figure 4 This is a plaque image of N4-like phage PWJ; Figure 5 This is an evolutionary tree constructed based on the sequence of the terminase large subunit; Figure 6 This is a gel electrophoresis diagram of PCR verification based on the terminase large subunit sequence primer after extracting phage nucleic acid using the method, in which: Marker; T7 standard strain; phage P9; phage Q5; phage PWJ. DETAILED DESCRIPTION

[0013] The technical solution of the present invention is further described below in conjunction with specific embodiments and comparative examples, but they should not be construed as limiting the present invention. Example

[0014] This example will specifically demonstrate the specific operation process and steps for purifying and enriching phages before extracting phage nucleic acids.

[0015] The strains, reagents and culture media involved in the embodiment are: The phages used in the experiment were T7 phage standard strain (purchased from Beina Biotechnology, catalog number: BNCC358500; Genbank accession number: NC_001604.1), T4-like phage P9 (preserved in our laboratory; Genbank accession number: MT630408.1), T7-like phage Q5 (preserved in our laboratory; Genbank accession number: MZ833439.1) and N4-like phage PWJ (preserved in our laboratory; Genbank accession number: OR237807.1). For details on plaque morphology, see Figures 1 to 4 .

[0016] The strains used in the experiment were Escherichia coli BL21 (DE3) (T7 phage standard strain host strain, purchased from Sangon Biotech (Shanghai) Co., Ltd., Catalog No.: B528414), Escherichia coli C600 (bacteriophage P9, Q5 host strain, preserved in our laboratory) and Pseudomonas aeruginosa ATCC27853 (bacteriophage PWJ host strain, preserved in our laboratory).

[0017] LB nutrient agar medium (1 L): Weigh 40 g of LB agar medium, dissolve it in 1 L of deionized water, and sterilize it at 121°C for 20 min.

[0018] LB broth medium (1 L): Weigh 21 g of LB broth medium, dissolve it in 1 L of deionized water, and sterilize it at 121°C for 20 min.

[0019] 0.7% semi-solid culture medium (1 L): Weigh 21 g LB broth medium and 7.0 g agar powder, dissolve in 1 L deionized water, and sterilize at 121°C for 20 min.

[0020] Phage recovery and enrichment: Take out the phage storage solution frozen at -20℃, return it to room temperature, aspirate 100 μL, mix it with 100 μL of host bacteria logarithmic growth phase culture in 5 mL LB broth medium, and culture it continuously at 37℃, 150 r / min for 18 h. After the culture is completed, centrifuge the culture at 4℃, 5000 r / min for 15 min, take the supernatant and filter it through a 0.22 μm filter membrane. The filtrate obtained is the phage enrichment solution.

[0021] The phage enrichment solution was diluted to a suitable multiple (in this experiment, the dilution multiple was 10 -8), phage purification was performed using the double-layer plate method. 100 μL of the diluted phage suspension was taken and mixed thoroughly with 100 μL of the corresponding host bacterial solution in 5 mL of semi-solid culture medium, and evenly spread on the pre-prepared LB nutrient agar medium plate, and cultured at 37°C for 6-12 h. During the period, observation was intermittent. After a single transparent plaque of uniform size appeared, the culture was stopped and a single phage plaque was picked and mixed thoroughly with 100 μL of the corresponding host bacterial logarithmic growth phase culture in 5 mL of LB broth medium, and cultured continuously at 37°C and 150 r / min for 18 h. After the culture was completed, the culture was centrifuged at 4°C and 5000 r / min for 15 min, and the supernatant was filtered through a 0.22 μm filter membrane. The filtrate obtained was the phage purification enrichment solution.

[0022] Take 100 μL of phage purification enrichment solution, dilute it to the appropriate multiple, and use the double-layer plate method to count the plaques again to convert its titer. In this study, the titer of the T7 phage standard strain used was calculated to be 3.16×10 13 cfu / mL, the titer of bacteriophage P9 was 1.79×10 13 cfu / mL, the titer of bacteriophage Q5 was 4.5×10 13 cfu / mL, the phage PWJ titer was 6.6×10 11 cfu / mL.

[0023] The remaining phage purification enrichment solution can be used for nucleic acid extraction operations. Example

[0024] This example will specifically demonstrate the preparation methods of the denaturing lysis solution, the denaturing buffer, and the rinsing solution, as well as the detailed operation steps for extracting phage nucleic acid using this technology.

[0025] Preparation of denaturing lysis buffer: Tris 30-50 mmol / L, NaCl 500 mmol / L, urea 6-8 mol / L, fully dissolve in 1000 mL deionized water, and adjust the pH to 7.5 with hydrochloric acid.

[0026] Preparation of denaturation buffer: 3 mol / L potassium acetate, 5 mol / L acetic acid, add deionized water to 1000 mL.

[0027] Preparation of rinsing solution: Tris 10 mmol / L, fully dissolved in 200 mL of deionized water, adjusted to pH 7.5 with hydrochloric acid, and added 800 mL of anhydrous ethanol before use.

[0028] Use sterile deionized water as the nucleic acid eluent.

[0029] Nucleic acid extraction process: 1. Take out 1 mL of pre-stored or newly prepared phage purification enrichment solution, mix it with an equal volume of denaturing lysis solution by inversion, and let it stand at room temperature for 3 min.

[0030] 2. Take 1.6 mL of denaturation buffer, mix it with the solution obtained in the previous step, and gently invert it upside down 6 to 10 times. Leave it at room temperature for 5 min, centrifuge it at 4°C, 13,000 r / min for 10 min, and carefully take the supernatant.

[0031] 3. Place the supernatant from the previous step into a nucleic acid adsorption column (purchased from Hangzhou Bio Medical Technology Co., Ltd., or a similar silicon-based nucleic acid adsorption column), let it stand for 2 min, centrifuge at 4°C, 12,000 r / min for 2 min, discard the waste liquid, and add more liquid in batches if there is a lot of liquid.

[0032] 4. Add 600 μL of rinse solution to the adsorption column (check whether anhydrous ethanol has been added before use), centrifuge at 4°C, 12,000 r / min for 1 min, and discard the waste liquid.

[0033] 5. Repeat step 4 once.

[0034] 6. Centrifuge the adsorption column at 4°C, 12,000 r / min for 2 min, open the lid, and leave it at room temperature for 5 min to remove the remaining rinse solution.

[0035] 7. Place the adsorption column back into a sterile 1.5 mL centrifuge tube, add 50 μL of sterile deionized water to the center of the adsorption membrane, place it at room temperature for 5 min, and centrifuge it at 4°C, 12,000 r / min for 1 min.

[0036] 8. Put the eluate obtained by centrifugation into a new adsorption column again, put the new adsorption column into another sterile 1.5 mL centrifuge tube, place it at room temperature for 2 min, 4°C, 12000 r / min, you can get the phage genomic DNA, which can be stored at -20°C for a long time.

[0037] The nucleic acid concentrations of the four phage nucleic acids in Example 1 were detected using a micro-volume UV spectrophotometer after extraction. The nucleic acid concentration of the obtained T7 phage standard strain was 23.6 ng / μL, the nucleic acid concentration of phage P9 was 19.6 ng / μL, the nucleic acid concentration of phage Q5 was 21.6 ng / μL, and the nucleic acid concentration of phage PWJ was 24.3 ng / μL, which met the nucleic acid concentration required for PCR or conventional molecular biology experiments. Example

[0038] This example will specifically demonstrate the practical application of the nucleic acid extraction product after applying this technology in PCR.

[0039] The full genome information of T7 phage standard strain (Genbank accession number: NC_001604.1), T4-like phage P9 (Genbank accession number: MT630408.1), T7-like phage Q5 (Genbank accession number: MZ833439.1) and N4-like phage PWJ (Genbank accession number: OR237807.1) was known after Illumina sequencing. The terminase large subunit sequences were extracted and BLAST was performed with the Genbank database to draw an evolutionary tree based on the terminase large subunit ( Figure 5 ).

[0040] According to the sequence information of the large subunit of the terminase, four detection primers were designed and synthesized (Shanghai Sangon Biotechnology Co., Ltd.), and PCR detection was performed using the nucleic acid extracted in Example 2 as a template.

[0041] The upstream primer T7_F used for T7 standard strain detection was ATGTGCGTTCGTTGTGTGG (SEQ ID No. 1), and the downstream primer T7_R was AGGAGAGTGGTCAGGATTGG (SEQ ID No. 2). The PCR amplification program was: 95°C pre-denaturation for 3 min, 94°C denaturation for 25 s, 56°C annealing for 25 s, 72°C extension for 15 s, 35 cycles, and 72°C extension for 5 min. The target fragment size was 211 bp.

[0042] The upstream primer P9_F used for phage P9 detection was CAGCCTGGTATAGTTGAATGG (SEQ ID No. 3), and the downstream primer P9_R was CAGGAATCGTGGAAGTTTGG (SEQ ID No. 4). The PCR amplification program was: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 56°C for 25 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 5 min. The target fragment size was 158 bp.

[0043] The upstream primer Q5_F used for phage Q5 detection was GTTTCCGTGATGGCTACTCC (SEQ ID No. 5), and the downstream primer Q5_R was CAAATACGCATCTCCTTCATACC (SEQ ID No. 6). The PCR amplification program was: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 56°C for 25 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 5 min. The target fragment size was 199 bp.

[0044] The upstream primer PWJ_F used for phage PWJ detection was GAAAGCTGTCGCAGATGAGG (SEQ ID No. 7), and the downstream primer PWJ_R was ATGCGTAGGTGAAGGACTGG (SEQ ID No. 8). The PCR amplification program was: 95°C pre-denaturation for 3 min, 94°C denaturation for 25 s, 56°C annealing for 25 s, 72°C extension for 15 s, 35 cycles, and 72°C extension for 5 min. The target fragment size was 201 bp.

[0045] The PCR amplification system (20 μL) was as follows: 1 μL template, 10 μL 2X M5 HiPer plus Taq HiFi PCR mix, 0.5 μL upstream primer, 0.5 μL downstream primer, 8 μL ddH2O. The PCR product was detected by 1.7% agarose gel electrophoresis to detect bands at 211 bp, 158 bp, 199 bp, and 201 bp. The PCR results were as follows: Figure 6 shown.

[0046] This example illustrates the Solarbio centrifugal column viral nucleic acid extraction kit.

[0047] The nucleic acid extraction process according to the instructions is as follows: 1. Take 0.5 mL of virus supernatant and centrifuge at 12000 rpm for 5 min. Aspirate as much supernatant as possible and discard the precipitate.

[0048] 2. Add 20 μL of proteinase K to the virus supernatant, mix thoroughly, and digest at 65°C for 10-20 min. During this period, invert the centrifuge tube several times to mix.

[0049] 3. Add 500 μL of solution V to the tube and mix thoroughly. Then add 400 μL of anhydrous ethanol to the tube and mix thoroughly. Flocculent precipitation may appear at this time, which does not affect the extraction of DNA. Both the solution and flocculent precipitation can be added to the adsorption column and allowed to stand for 2 min. (The maximum volume of the adsorption column is 750 μL, which can be added twice. After one adsorption and centrifugation, add the remaining mixed liquid to the column and let it stand for centrifugation.) 4. Centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column into the collection tube.

[0050] 5. Add 600 μL of rinse solution to the adsorption column (please check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column in a collection tube.

[0051] 6. Add 600 μL of rinse solution to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the adsorption column in a collection tube.

[0052] 7. Centrifuge at 12,000 rpm for 2 min and place the adsorption column at room temperature or in a 50°C incubator for several minutes to remove the residual rinse solution in the adsorption column. Otherwise, the ethanol in the rinse solution will affect subsequent experiments such as enzyme digestion and PCR.

[0053] 8. Place the adsorption column in a clean centrifuge tube, add 50 μL~100 μL of elution solution preheated in a 65℃ water bath to the center of the adsorption membrane, let it stand at room temperature for 5 minutes, and centrifuge at 12000 rpm for 1 minute.

[0054] 9. Add the eluate obtained by centrifugation to the adsorption column, place it at room temperature for 2 minutes, and centrifuge it at 12000 rpm for 2 minutes to obtain high-quality viral genomic DNA.

[0055] Solarbio centrifugal column virus nucleic acid extraction kit uses proteinase K for nucleic acid extraction. In order to achieve the best enzymatic reaction conditions, it needs to be incubated in a water bath at 65°C for 10 minutes, and then a buffer containing EDTA and SDS needs to be added to precipitate the protein, and the supernatant needs to be centrifuged for extraction. This method uses a lysis buffer, which does not require heating and can be left to react at room temperature. The reaction time is shortened to 5 minutes. There is no need to add a buffer to precipitate the protein. The supernatant can be directly centrifuged to proceed to the next step. The method is simple and easy to operate.

[0056] This example illustrates the Omega centrifugal column viral nucleic acid extraction kit.

[0057] The nucleic acid extraction process according to the instructions is as follows: 1. Transfer the sample to a 2 mL centrifuge tube. If the volume is less than 250 μL, add 10 mM Tris-HCl or PBS buffer to make up the volume to 250 μL.

[0058] 2. Add 10 μL OB Protease Solution, 4 μL Linear Acrylamide and 250 μL BLBuffer, and vortex at high speed for 15 s to mix.

[0059] 3. Incubate at 65°C in a water bath for 10 min, vortexing gently once.

[0060] 4. Add 260 μL of anhydrous ethanol, vortex for 20 seconds to mix thoroughly, and then briefly centrifuge to collect the droplets on the tube cover.

[0061] 5. HiBind ®Insert the DNA Mini Columns into the collection tube, transfer the mixture obtained in step 4 to the binding column, centrifuge at 8000 xg for 1 min at room temperature, and discard the filtrate and collection tube.

[0062] 6. Place HiBind® DNA Mini Columns into new collection tubes, add 500 μL HBC Buffer (diluted with isopropanol) to the binding column, centrifuge at 8000 x g for 1 min, and discard the filtrate.

[0063] 7. Put the HiBind® DNA Mini Columns back into the collection tube, add 700 μL DNA Wash Buffer (diluted with anhydrous ethanol) to the binding column, centrifuge at 8000 x g for 1 min, and discard the filtrate.

[0064] 8. Repeat step 7.

[0065] 9. Put the HiBind® DNA Mini Columns back into the collection tube and centrifuge at 12,000 x g for 2 min.

[0066] 10. Place HiBind® DNA Mini Columns into a new 1.5 mL centrifuge tube, add 50-100 μL of 65°C preheated Elution Buffer to the binding column, place at room temperature for 5 min, and then centrifuge at 8000 x g for 1 min to elute the DNA.

[0067] 11. Repeat step 10 for a second elution and store the product at -20°C.

[0068] The Omega centrifugal column viral nucleic acid extraction kit is relatively complicated to operate, has many steps, and is not easy to promote and apply.

[0069] According to the corresponding instructions, the schemes in Example 2, Control Example 1 and Control Example 2 were used to extract phage nucleic acid. The specific performance values ​​are shown in Table 1: Table 1 Comparison of phage nucleic acid extraction performance Extraction method Storage Required steps Time required Number of extractions Cost Price Remark Example 2 All reagents used can be stored at room temperature for a long time Step 8 30~45min 180 times 80~90 yuan none Comparative Example 1 Proteinase K needs to be stored at -20℃ for a long time, and other reagents can be stored at room temperature Step 9 40~50min 50 times 200~300 Yuan none Comparative Example 2 OB Protease Solution needs to be stored at 4°C for a long time, and other reagents can be stored at room temperature Step 11 40~60min 50 times 550~650 Yuan Additional isopropyl alcohol is required Embodiment 2 Compared with reference example 1 and reference example 2, the present invention uses urea to replace proteinase K, greatly reducing the price of consumables used for preparing reagents, and the cost of preparing 200mL at a time is only about 80 yuan, which is much lower than the existing test kit cost, and the existing test kit can be used 50 times, and the test kit of the present invention can extract about 180 times if 200mL lysate is configured, and the number of extractions becomes more, the cost is lower, and it is convenient to use. And all reagents used can be manually prepared and stored for a long time at room temperature, without the need to add other reagents, the extraction time is shorter, and nucleic acid extraction can be completed within 45 minutes, and the number of extractions is 3.6 times that of the test kit method, with an absolute advantage of short-term efficiency.

[0070] In summary, the present invention provides a phage nucleic acid extraction method based on the centrifugal column method and applies it in PCR experiments. On the basis of commercial viral nucleic acid extraction kits, it saves experimental costs and can quickly extract phage nucleic acids for application in conventional molecular biology experiments.

Claims

1. A method for extracting bacteriophage nucleic acid based on a centrifugal column method, characterized in that: The method comprises the following steps: (1) Take 1 mL of phage enrichment solution and mix it with an equal volume of denaturing lysis solution by inversion, and let it stand at room temperature for 3 min; (2) Take 1.6 mL of denaturation buffer, mix it with the solution in the previous step, gently invert it up and down 6 to 10 times, leave it at room temperature for 5 min, centrifuge it at 4°C, 13,000 r / min for 10 min, and carefully take the supernatant; (3) Place the supernatant from the previous step into the nucleic acid adsorption column, let it stand for 2 min, then centrifuge at 4°C, 12,000 r / min for 2 min, discard the waste liquid, and add more liquid in batches if there is too much liquid; (4) Add 600 μL of rinse solution to the adsorption column, centrifuge at 12,000 r / min at 4°C for 1 min, and discard the waste liquid; (5) Repeat step (4) once; (6) Centrifuge the adsorption column at 4°C, 12,000 rpm for 2 min, open the lid, and leave at room temperature for 5 min to remove the remaining rinse solution. (7) Place the adsorption column in a clean centrifuge tube, add 50 μL of sterile deionized water to the center of the adsorption membrane, place at room temperature for 5 min, and centrifuge at 4°C, 12,000 r / min for 1 min; (8) The eluate obtained by centrifugation is placed in a new adsorption column again, left at room temperature for 2 min, and then centrifuged at 4°C and 12,000 r / min for 2 min to obtain the phage genomic DNA.

2. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: Preparation of phage enrichment solution in step (1): 5 mL of host bacteria-phage overnight culture was centrifuged at 5000 r / min for 15 min at 4°C, and the supernatant was filtered through a 0.22 μm filter membrane.

3. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: The denaturing lysis buffer in step (1) is prepared by dissolving 30-50 mmol / L Tris, 500 mmol / L NaCl, and 6-8 mol / L urea in 1000 mL of deionized water and adjusting the pH to 7.5 with hydrochloric acid.

4. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: The denaturation buffer in step (2) is prepared by adding 3 mol / L potassium acetate and 5 mol / L acetic acid and adding deionized water to 1000 mL.

5. The method for extracting bacteriophage nucleic acid based on the centrifugal column method according to claim 1, characterized in that: Preparation of the rinse solution in step (4): Tris 10 mmol / L, fully dissolved in 200 mL of deionized water, adjusted to pH 7.5 with hydrochloric acid, and added with 800 mL of anhydrous ethanol before use.

Images