Application of combination of insect growth regulator and transcription factor dsRNA in prevention and control of reticulitermes formosanus

Abstract

The invention provides the application of the combination of the insect growth regulator and the transcription factor dsRNA in the prevention and control of the reticulitermes formosanus, the transcription factor dsRNA is the dsRNA of the reticulitermes formosanus RcARNT or RcCncC, and a new thought is provided for the green prevention and control strategy of the reticulitermes formosanus. The dsRNA is obtained by fragmenting cell walls of dsRNA-HT115 engineering bacteria through an ultrasonic fragmentation method, and large-scale production of the dsRNA can be achieved on the premise that the stability of the dsRNA is kept. The composite pesticide provided by the invention is good in pharmacodynamic activity, long in lasting period, low in cost and environment-friendly.

Description

Technical Field

[0001] The present invention relates to the field of termite control, and specifically relates to the application of insect growth regulators combined with transcription factor dsRNA in the control of black-breasted Reticulitermes. Background Art

[0002] Termites are an important pest worldwide, causing extensive damage, involving all aspects of daily production and life. The damage caused by termites to agriculture and forestry has always been a serious problem in the global agriculture and forestry system. Among them, the black-chested termite is a widely distributed pest, and its damage range involves a variety of forestry trees. They feed on bark and even heartwood, severely damage the phloem and cambium of trees, affect the life activities of trees, and eventually lead to the death of trees. In addition, the termites also harm houses and ancient buildings. At present, chemical control methods are mainly used to control the reproduction and spread of termites. Insect Growth Regulators (IGRs) are different from the above-mentioned traditional chemical agents. They are a type of agent that causes the death of pests by affecting the growth process of insect larvae, hindering the development process, etc. They have special action sites, high selectivity, low toxicity, less pollution, and are relatively safe for humans, animals, natural enemies, and beneficial organisms. They are conducive to sustainable development, so they are known as "third-generation pesticides", "pesticides of the 21st century", "non-biocidal insecticides", and "specific insect control agents". The insect growth regulators lufenuron and thiamethoxam are chitin synthase inhibitors. Chitin synthesis inhibitors can hinder insects from synthesizing chitin, making it difficult for insects to molt and reduce feeding.

[0003] Lufenuron is a benzoylurea chitin synthesis inhibitor. Its main mechanism of action is to interfere with the formation of new cuticles by controlling the synthesis or deposition of chitin in insects. Since lufenuron is highly lipid-soluble, it accumulates in adipose tissue after ingestion by insects, is slowly released, has a long duration of action, and has ovicidal activity (Bueno and Freitas 2004; Fonseca et al. 2015).

[0004] Aryl hydrocarbon receptor nuclear translocator (ARNT), also known as hypoxia-inducible factor-1β (HIF-1β), belongs to the bHLH-PAS protein family and is a constitutive nuclear protein of the bHLH-PAS protein family. It forms a heterodimer with another ligand-activated transcription factor AhR to mediate various responses to toxic chemicals (Kudo et al. 2018). At present, research on ARNT in the field of insects mainly focuses on AhR and ARNT co-regulating the expression of detoxification enzyme genes to mediate insect metabolism of xenobiotics (Shi Xueyan 2018). Transcription factor ARNT plays an important role in the insect immune system. This gene can regulate the response of insects to harmful substances in the external environment to a certain extent, including antibacterial, antiviral and antifungal immune responses. Its function is similar to the "switch" of the insect immune system, regulating the expression of immune-related genes, thereby affecting the insect's resistance and resistance to pathogens. By affecting the activity of this protein, the insect's immune response can be regulated, thereby affecting their resistance to diseases and other external threats (Kikuchi et al. 2003).

[0005] In order to reduce the use of chemical pesticides, researchers have conducted many studies on the regulation of detoxification enzymes by the AhR-ARNT signaling pathway in insects. Lepidoptera insects such as Helicoverpa armigera (Li et al. 2014), Papiliopolyxenes and Papilio glaucus (Mcdonnell et al. 2004) regulate the transcription level of CYP6 family CYP450 genes through the AhR signaling pathway, which can enhance the adaptability to plant secondary metabolites such as anthocyanin, gossypol and 2-tridecanone (Li et al. 2021). Shang Qingli et al. reported that the transcription factor AhR / ARNT of Myzus persicae synergistically regulates the expression of CYP6CY3 and CYP6CY4, enhancing the adaptability of peach aphids to nicotine (Li et al. 2014); AhR and ARNT of cotton aphids (Aphis gossypii Glover) are involved in regulating the transcription level of CYP6DA2. Silencing AhR and ARNT can significantly reduce the transcription level of CYP6DA2 and increase the sensitivity of cotton aphids to gossypol and spirotetramat (Pan et al. 2019). The combination of chemical pesticides and dsRNA can significantly increase the insecticidal activity of chemical pesticides. The combination of thiamethoxam and synaptobrevin dsRNA can induce the death of cotton aphids (Dietrich 2016). Some researchers interfered with ARNT in brown planthoppers. After silencing, the sensitivity of brown planthoppers to imidacloprid, ethoxyfen and isoprocarb increased significantly (Qu et al. 2022). However, there are no reports on the function of RcARNT in R. nigropterygii. Whether RcARNT plays an important role in the detoxification and metabolism of lufenuron has not been reported at home and abroad.

[0006] Buprofezin is a highly selective insect growth regulator. It is a low-toxic biomimetic insecticide of the thiadiazin class developed by a Japanese pesticide company in 1981. It is a highly effective chitin synthesis inhibitor (Luo Hui et al. 2009). This pesticide inhibits the formation of chitin-protein complex structures in the insect exoskeleton, causing insects to molt and die due to deformities (Toscano et al. 2001; Marimuthu et al. 2013). It also has the advantages of slow efficacy and long duration (Zhao Yuhua 2016).

[0007] The detoxification metabolism of insects is one of the most important biological processes in insect humoral immunity (Chris and Nauen 2023). Detoxification enzymes are mainly divided into three categories: cytochrome P450 monooxygenase, esterase and glutathione S-transferase (Zhou et al. 2012). A large number of studies have shown that the ability of various detoxification enzymes of insects to metabolize pesticides determines the tolerance of insects to such pesticides. After the larvae of the diamondback moth were treated with fenthion, the initial induction of three detoxification enzymes led to an increase in the activity of GST, CAT and SOD, which improved the tolerance of the diamondback moth to pesticides (Chen Jixiang 2019). Some researchers found that CYP353Dlv2 was overexpressed in the thiamethoxam-resistant strain of the gray leafhopper. After expressing it into a protein in vitro and then being determined by liquid phase, it was found that the gene could metabolize thiamethoxam (Elzaki et al. 2017), indicating that the detoxification enzyme P450 of the gray leafhopper would respond to thiamethoxam.

[0008] Transcription factors regulate detoxification enzymes at the transcriptional level. Under the stimulation of upstream signals, CncC participates in the transcriptional regulation of insect detoxification metabolism of insecticides. CncC binds to antioxidant response elements, regulates the expression of detoxification enzymes, and increases the tolerance of organisms to agents (Liu Pu 2021). There are many studies on detoxification enzymes at the transcriptional level. Researchers have found that in Drosophila melanogaster, CncC protein directly regulates genes related to ecdysone biosynthesis or ecdysone response genes (Misra et al. 2012). In cotton bollworm, CncC protein regulates the transcription of CYP321A1 gene (Zhang Chunni 2010). Given that RNAi interference technology can silence the corresponding genes of insects. After interfering with the CncC gene in cotton aphids, some researchers enhanced the toxicity of the toxic substance cottonpol to cotton aphids (Peng et al. 2020). After interfering with the CncC gene of the citrus fruit fly, the expression of its GSTZ2 and CYP473A3 genes decreased, and its sensitivity to avermectin increased (Tang et al. 2019). However, whether the RcCncC of the black-chested termite plays an important role in the detoxification and metabolism of thiamethoxam has not been reported at home and abroad. Summary of the invention

[0009] To solve the above problems, the present invention provides an application of an insect growth regulator in combination with a transcription factor dsRNA in the control of black-breasted termites, thereby reducing the amount of chemical pesticides used, increasing the toxicity of chemical pesticides in killing termites, and reducing pollution and damage to the environment.

[0010] The specific technical solutions are:

[0011] The invention discloses an application of an insect growth regulator in combination with a transcription factor dsRNA in the control of Reticulitermes crassifolia, wherein the transcription factor dsRNA is the dsRNA of RcARNT or RcCncC of Reticulitermes crassifolia.

[0012] Furthermore, the insect growth regulator is lufenuron or buprofezin.

[0013] Furthermore, the full-length cDNA of the RcARNT or RcCncC gene is shown as SEQ ID No.1 and SEQ ID No.2 respectively.

[0014] Furthermore, the primer sequence for synthesizing the dsRNA of the RcARNT gene is the upstream primer (5'-3') CTAGGGAGCTTACTCAGACTGTACCAGGGACT, and the downstream primer (5'-3') CCGAAGCTTCGCTCTGTGGCTGATTCAGT; the primer sequence for synthesizing the dsRNA of the RcCncC gene is the upstream primer (5'-3') CTAGCTAGCGCTCGACACCACTCAGATGTG, and the downstream primer (5'-3') CCGCTCGAGCTGGTATCCATCAGGATCTCG.

[0015] The application is to first treat the termites with the dsRNA of Reticulitermes nigromaculata RcARNT or RcCncC, and then treat the termites with an insect growth regulator.

[0016] Furthermore, the application is to first treat the termites with 1 μg / μL of dsRNA of Reticulitermes nigromaculata RcARNT for 36 hours, and then use 0.5 μL, 7.16×10 -7 mol / L lufenuron to treat termites.

[0017] Furthermore, the application is to treat termites with 1 μg / μL of dsRNA of Reticulitermes nigromaculata RcCncC for 36 hours, and then treat with 0.5 μL of 5.12×10 -7 mol / L of thiamethoxam to treat termites.

[0018] The method for preparing dsRNA in any of the above applications comprises the following steps to obtain a dsRNA disrupted bacterial solution: preparing a dsRcARNT-HT115 bacterial solution or a dsRcCncC-HT115 bacterial solution, inducing dsRNA expression, and then treating the bacterial solution with ultrasound to release dsRNA.

[0019] Furthermore, the bacterial suspension was pulverized using an ultrasonic homogenizer.

[0020] Beneficial effects of the present invention:

[0021] (1) The technical solution provided by the present invention has good drug activity, an enhanced lasting effect, can be transmitted between termites, and can control termites with a smaller amount of pesticides.

[0022] (2) The insect growth regulator used in the present invention is safe, efficient, and has little environmental pollution. It is compounded with the transcription factor dsRNA to obtain a green compound formula with good insecticidal effect on black-chested termites.

[0023] (3) The present invention uses ultrasonic disruption to break up the cell wall of the engineered bacteria, thereby accelerating the release of dsRNA and making it easier for it to enter the insect body, thereby increasing the interference efficiency. This method is highly efficient and environmentally friendly, and can achieve rapid preparation of dsRNA. It can achieve large-scale production of dsRNA while maintaining the stability of dsRNA, providing a theoretical basis and technical support for the combined use of insecticides and RNAi for termites, and providing more possibilities for practical applications in pest control.

[0024] (4) The present invention provides a theoretical basis for the combined use of insect growth regulators and transcription factor dsRNA to control black-chested Reticulitermes cyrtonema through the study of the combined use of black-chested Reticulitermes cyrtonema and dsRcCncC with thiamethoxam, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The expression of RcARNT gene in Reticulitermes nigromaculata after treatment with lufenuron;

[0026] Figure 2 The expression of RcCncC gene in Reticulitermes mellifera after treatment with thiamethoxam.

[0027] Figure 3 This is the effect of dsRcARNT on the relative expression level of RcARNT in black-chested termites.

[0028] Figure 4 This is the effect of dsRcCncC on the relative expression level of RcCncC in black-breasted termites.

[0029] Figure 5 This is a bioassay of dsRcARNT combined with lufenuron (SM) against black-chested termites.

[0030] Figure 6 This is a bioassay of dsRcCncC combined with thiamethoxam (sq) against black-chested termites. DETAILED DESCRIPTION

[0031] 1. Experimental Materials

[0032] 1. Test insect source

[0033] The test insects were black-chested Reticulitermes, collected from Nanjing, Jiangsu, and raised in a 20 cm × 8 cm × 5 cm plastic box in the dark, at a temperature of 25 ± 1 ° C and a relative humidity of 90 ± 5%. The termites used in the experiment were uniformly sized and robust worker ants.

[0034] 2. Reagents

[0035] Lufenuron: Weigh 4.19 mg of 97.3% lufenuron stock and dissolve it in 1 mL of acetone to prepare 1×10 -2 mol / L as a stock solution and stored at 4°C.

[0036] Buprofezin: Weigh 3.14 mg of 97.3% Buprofezin stock and dissolve it in 1 mL of acetone to prepare 1×10 -2 mol / L as a stock solution and stored at 4°C.

[0037] The above mother solution was diluted with acetone to 2×10 -3 mol / L、4×10 -4 mol / L、8×10 -5 mol / L、1.6×10 - 5 mol / L、3.2×10 -6 mol / L for subsequent experiments.

[0038] The stock solution of lufenuron was diluted with acetone to a sublethal concentration LC 20 (7.16×10 -7 mol / L); dilute the mother solution of thiazinone with acetone to a sublethal concentration LC 20 (5.12×10 -7 mol / L).

[0039] Other major experimental reagents are as follows: chloroform, isopropanol, TRNzol-A+, anhydrous ethanol, deionized water, DL2000maker, RNA reverse transcription reagent, tromethamine, disodium ethylenediaminetetraacetic acid dihydrate (CHN2O8Na2·2H2O), PrimeScript RT Master Mix (Perfect Real Time) reverse transcription kit, ChamQ Blue UniversalSYBR qPCR Master Mix kit, TS-GelRed nucleic acid gel dye, ChamQ Blue Universal SYBRqPCR Master Mix kit, acetone, 97.6% lufenuron technical drug, and 98% thiamethoxam technical drug.

[0040] 3 Instruments

[0041] The main experimental instruments are as follows: high pressure sterilizer, ME204T electronic balance, NanoDrop spectrophotometer, MIR-554-PC low temperature constant temperature incubator, ultra-low temperature refrigerator, XOKB-15 ice maker, micro dropper, homogenizer, Centrifuge5417R desktop high-speed refrigerated centrifuge, VS-1300L-U clean bench, shaking incubator.

[0042] Example 1 Bioassay of Two Insect Growth Regulators against Reticulitermes nigrofon

[0043] After selecting 15 healthy black-chested Reticulitermes workers with small size differences, they were placed in a culture dish with filter paper and the 2×10 -3 mol / L、4×10 -4 mol / L、8×10 -5 mol / L、1.6×10 -5 mol / L、3.2×10 - 6 0.5 μL of the five concentrations of the drug solution was dripped on the pronotum of the termites. Three replicates were set for each concentration, and the acetone treatment was used as the control. All culture dishes were placed in a light-shielding condition with a temperature of 25±1°C and a relative humidity of 90±5%. The death of the test termites was observed every 12 hours, and the moisture in the culture dishes was maintained. The toxicity regression equation of each agent and the corresponding LD were calculated. 50 .

[0044] The killing effect of black-chested termites is analyzed based on the corrected mortality rate:

[0045]

[0046] Calculation of the median lethal dose LD of each pesticide to Reticulitermes nigrocristatus using the DPS treatment system 50 .

[0047] The results show:

[0048] Table 1 Toxicity determination of lufenuron and buprofezin to Reticulitermes nigricans

[0049]

[0050] This indicates that lufenuron and thiamethoxam are slow-acting but long-lasting pesticides suitable for termite control. Therefore, these two insect growth regulators (lufenuron and thiamethoxam) were used to develop a new compound pesticide for black-chested termites.

[0051] Example 2 Cloning of RcARNT and RcCncC of Reticulitermes nigrotermes

[0052] 1 Total RNA extraction and quality detection of black-chested termite workers

[0053] The RNA extraction procedure is as follows:

[0054] (1) Select 6 black-chested termite workers of uniform size and good vitality and place them in a 1.5 mL centrifuge tube. Add 1 mL of TRNzol-A + , grind with a homogenizer to a homogenous state.

[0055] (2) Centrifuge the lysate (12000 g, 4°C, 5 min) and aspirate the supernatant.

[0056] (3) Add 200 μL of chloroform to the lysate obtained in the previous step and shake on an oscillator for 15 seconds until the emulsion becomes turbid. Let stand at 4°C for 5 minutes.

[0057] (4) Centrifuge the test solution obtained in the previous step at 12000g, 4°C, for 15 min. Carefully remove the centrifuge tube. The solution is separated into three layers: upper, middle and lower, namely the aqueous phase layer, the protein layer and the organic layer. Carefully pipette the upper aqueous phase into a new 1.5 mL centrifuge tube.

[0058] (5) Add an equal volume of pre-cooled isopropanol to the centrifuge tube, mix by inverting, and let stand at 4°C for 10 min.

[0059] (6) Centrifuge at 12,000 g, 4°C for 10 min. A white precipitate should be visible at the bottom of the centrifuge tube.

[0060] (7) Pour the supernatant in the tube into the waste container. Be careful not to pour out the precipitate. Then add 1 mL of pre-cooled 75% ethanol, gently shake to suspend the precipitate, and turn the centrifuge tube upside down several times. Let it stand at room temperature for 6 minutes.

[0061] (8) Centrifuge at 12000g, 4°C for 5 min and discard the waste liquid.

[0062] (9) Dry and let stand in a clean bench for 5 min, add 35 μL RNase-free ddH2O to dissolve, take 5 μL for detection and determination of RNA concentration, and store the rest in a -80°C ultra-low temperature refrigerator.

[0063] After extraction, the integrity of RNA was tested:

[0064] After adding 100 μL RNase-Free ddH2O to dilute the RNA, the absorbance at 260 nm was measured using a UV spectrophotometer. The integrity of the RNA was detected using agarose gel electrophoresis.

[0065] (1) Prepare 50×TAE buffer, weigh 242 g of tromethamine (Tris) and 37.2 g of disodium ethylenediaminetetraacetic acid dihydrate (CHN2O8Na2·2H2O) into a 1 L beaker.

[0066] (2) Add 800 mL of deionized water to the cup and stir evenly; add 57.1 mL of glacial acetic acid to fully dissolve the solute, and add deionized water to make the volume 1 L. When using, dilute with deionized water to 1×TAE buffer.

[0067] (3) Prepare 1.5% agarose gel: weigh 0.25 g of agarose, add 25 mL of 1×TAE buffer, heat in a microwave oven until the agarose dissolves, cool to an appropriate temperature, add 2.5 μL of nucleic acid dye, pour into an electrophoresis cassette to make a gel, and use it for electrophoresis after the agarose is completely solidified.

[0068] (4) Mix 2.5 μL RNA with 2.5 μL loading buffer and perform electrophoresis in 1×TAE buffer at a voltage of 8 V / cm for 20 min. Use a gel imager to observe the electrophoresis results.

[0069] 2 Reverse transcription

[0070] The total RNA extracted was used as reference 1 st Reverse transcription was performed according to the Strand cDNASynthesis Kit (+gDNAwiper) instructions as follows:

[0071] (1) Genomic DNA removal

[0072] Prepare the following mixture in an RNase-free centrifuge tube:

[0073]

[0074] Mix by gently pipetting with a micropipette. React at 42°C for 2 minutes

[0075] (2) Preparation of first-strand cDNA synthesis reaction solution

[0076] 10×RT Mix 2μL

[0077] HiScipt II Enzyme Mix 2μL

[0078] Mixture from the previous step to 16 μL

[0079] Gently pipette with a micropipette

[0080] (3) Perform the first-strand cDNA synthesis reaction under the following conditions

[0081] 50℃ 15min

[0082] 85℃ 2min

[0083] The reaction product can be used immediately or stored at -20°C

[0084] 3 Primer design

[0085] Primer premier 5 was used to design primers. The ORF frame of RcARNT or RcCncC was analyzed by the ORFfinder tool on the NCBI website so that the primers could completely cover the ORF frame. The primer sequences are shown in the table:

[0086] Table 2 Primer sequences used for cloning RcARNT and RcCncC genes

[0087]

[0088] 4 PCR amplification of target gene

[0089] Perform PCR using the primers designed in step 3 and the cDNA obtained after reverse transcription in step 2:

[0090]

[0091] Add the above system into a PCR tube, flick the bottom of the tube to mix the system thoroughly, and perform PCR amplification with the following program: 94°C for 4 min, 25 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30, 72°C for 7 min, and 4°C∞.

[0092] After the PCR reaction was completed, the product was used for gel electrophoresis and photographed.

[0093] 5. Gel recovery of PCR products of RcARNT or RcCncC gene

[0094] In order to purify the product containing the RcARNT or RcCncC gene sequence fragment from the PCR gel, the specific steps of using the gel recovery kit are as follows:

[0095] (1) Place the adsorption column in the collection tube, add 250 μL of Buffer BL to the adsorption column, and centrifuge at 12,000 g for 1 min to activate the silica membrane;

[0096] (2) Under a 365 nm long-wave ultraviolet lamp, cut off the desired DNA band and place it in a 2 mL centrifuge tube, ensuring that the operating environment is as clean as possible to avoid any exogenous DNA contamination;

[0097] (3) Add 500 μL of Buffer GL to the centrifuge tube containing the gel and wait for the fragments to completely melt;

[0098] (4) Incubate at 65°C in a water bath for 5 min, mixing by inverting every 1 min until the gel is completely melted.

[0099] (5) Transfer the solution from the previous step to the EC adsorption column, centrifuge at 12,000 g for 1 min, discard the waste liquid, and return the EC adsorption column to the empty collection tube;

[0100] (6) Add 700 μL of Buffer W2 to the adsorption column, centrifuge at 12,000 g for 1 min, and discard the waste liquid;

[0101] (7) Repeat the previous step once;

[0102] (8) Place the adsorption column back into the empty collection tube and centrifuge at 12,000 g for 2 min.

[0103] (9) Take out the adsorption column from the centrifuge, put it into a 1.5 mL centrifuge tube sterilized by high temperature and high pressure, place it at 25°C for 2 min, add 40 μL of Eluent to the middle part of the adsorption membrane, let it stand for 2 min, and centrifuge it at 12000g for 2 min to obtain the gel recovery product;

[0104] (10) Use a spectrophotometer to measure the concentration of the glue recovery product and record it.

[0105] 6. Ligation and transformation of RcARNT or RcCncC gene cloning vector

[0106] Connect the recovered DNA fragments to the cloning vector pClone007 and prepare the connection system at room temperature:

[0107]

[0108] The above system was gently pipetted and mixed, and then placed at 16°C for 5 minutes to obtain the ligation product.

[0109] (1) Mix 5 μL of the ligation product with 50 μL of competent cells, pipette to mix thoroughly, and place on ice for 30 min.

[0110] (2) After the ice bath, place in a water bath at 42°C for 45 seconds, and then place in an ice bath for 2 minutes.

[0111] (3) Add 500 μL LB liquid culture medium and place on a shaker at 37°C, 180 rpm for 1 h.

[0112] (4) Prepare LB solid medium containing 50 μg / mL Amp, pour it into the culture dish, and culture the competent cells after solidification and recovery at 37°C overnight.

[0113] (5) Select white colonies from the single colonies, place them in 50 mL of LB liquid culture medium, culture them in a 37°C incubator overnight, and send them for sequencing.

[0114] The results showed that the full-length gene (RC_transcript_4769) of RcARNT in the third-generation transcriptome library of R. nigrotermes was cloned. The coding region of the gene was 2001 bp long and encoded 666 amino acids.

[0115] The RcCncC gene of Reticulitermes nigrotermes was successfully cloned and characterized. The coding region of the gene is 2841 bp long and encodes 946 amino acids.

[0116] Example 3 Response of RcARNT or RcCncC of Reticulitermes nigropunctatus to insect growth regulators 1. Test insect treatment

[0117] For the experiment, 15 black-chested termite workers with good vitality and similar body size were selected and placed in a 9 cm diameter culture dish in a dark environment with a temperature of 24 ± 1 °C and a relative humidity of 90 ± 5%. -7 mol / L of lufenuron or 5.12×10 -7 mol / L thiamethoxam, 0.5 μL was dripped on the pronotum, while the control group was replaced with acetone. Three replicates were set for each treatment group. Samples were taken at 6, 12, 24 and 48 h of treatment.

[0118] 2 Reverse transcription

[0119] Method is the same as in Example 2.

[0120] 3 Primer design

[0121] The primers used for real-time fluorescence quantitative PCR (qPCR) of RcARNT or RcCncC gene are shown in Table 3. The primers used for experiments using heat shock protein 70 (HSP70) and beta-actin (β-Actin) as internal reference genes are shown in the table:

[0122] Table 3 Primers used in qPCR experiments

[0123]

[0124] 4qPCR

[0125] qPCR was performed using the ChamQ Blue Universal SYBR qPCR Master Mix Kit (Vazyme) and RcARNT or RcCncC upstream and downstream primers designed in 3. The experimental system was as follows:

[0126]

[0127] The qPCR reaction procedure is divided into three stages (pre-denaturation, cycle reaction, melting curve): pre-denaturation: 95℃30sec; cycle reaction: 95℃10sec, 60℃30sec 40 times; melting curve uses the instrument's default acquisition procedure. The experiment was repeated three times.

[0128] The results showed that the black-chested termites were treated with lufenuron, and qPCR was used to quantify the expression level of the RcARNT gene at different treatment times. The results showed that only during the 6-hour treatment period, the expression of the RcARNT gene was not induced. During the 12, 24, and 48-hour treatment periods, the RcARNT gene was inhibited, while during the 72 and 96-hour treatment periods, the expression of the RcARNT gene was induced. In particular, at 72 hours, the expression of RcARNT in the black-chested termites increased by 278.6% (Figure 2). Figure 1 ).

[0129] The black-chested Reticulotermes was treated with thiamethoxam, and qPCR was used to quantify the expression level of the RcCncC gene at different treatment times. The results showed that the expression of the RcCncC gene was not induced at the treatment periods of 6, 12, 24, and 96 hours. However, at the 48 and 72 hours treatment periods, the expression of the RcCncC gene was induced, and the expression of RcCncC in the black-chested Reticulotermes increased by 190.65% at 48 hours (Figure 2). Figure 2 ).

[0130] Example 4 Cloning and purification of dsRcARNT or dsRcCncC

[0131] 1 Total RNA extraction and quality detection of black-chested termite workers

[0132] The extraction and detection methods are the same as those in Part 1 of Example 2.

[0133] 2 Reverse transcription

[0134] The reverse transcription method is the same as that in Example 2.

[0135] 3 Primer design

[0136] Based on the ORF frame of the RcARNT or RcCncC gene sequence of Reticulitermes nigrostachianus, possible RNAi sites were predicted through an online website (http: / / sidirect2.rnai.jp / ), and specific amplification primers were designed using the software Primer primer 5 (see Table 4). The restriction sites are underlined in the table.

[0137] Table 4 Primer sequences used for dsRNA synthesis

[0138]

[0139]

[0140] 4 Construction of dsRcARNT or dsRcCncC expression vector

[0141] Using the full-length gene plasmid of RcARNT or RcCncC as a template, the interference fragments of RcARNT and RcCncC dsRNA were amplified using the primers in Table 4. RcARNT plasmid and L4440 plasmid were double-digested with SacⅠ and SmaⅠ restriction endonucleases, respectively; RcCncC plasmid and L4440 plasmid were double-digested with NheⅠ and SacⅠ enzymes, respectively; plasmid containing green fluorescent protein (GFP) and L4440 plasmid as controls were double-digested with SacⅠ and HindⅢ restriction endonucleases.

[0142] The system is as follows:

[0143]

[0144] The double enzyme digestion was performed overnight at 37°C, and the fragment and the vector were purified by 1% agarose gel electrophoresis. The method was the same as that in Part 5 of Example 2. Then, the fragment and the vector were ligated overnight at 16°C using T4 DNA ligase. The ligation system was as follows:

[0145]

[0146] After the ligation is completed, a recombinant plasmid containing the target fragment can be obtained, which is transformed into HT115 competent cells. After taking out the HT115 competent cells from -80°C, immediately place them on ice and wait for the bacterial block to melt. Subsequently, add the target plasmid, gently mix the bottom of the EP tube, and then let it stand on ice for 25 minutes.

[0147] The next steps include:

[0148] (1) Place the sample in a 42°C water bath for 45 seconds, then quickly return to ice and let stand for 2 minutes.

[0149] (2) Add 700 μL of LB culture medium without antibiotics to the centrifuge tube and resuscitate at 37°C at 200 rpm for 60 min.

[0150] (3) Centrifuge at 5000 rpm for 1 min, collect about 50 μL of supernatant, gently blow to resuspend the bacterial mass, and smear it on LB solid medium containing tetracycline (concentration of 12.5 μg / mL) and ampicillin (concentration of 50 μg / mL).

[0151] (4) Invert the plate and place it in a 37°C incubator for overnight culture.

[0152] (5) The monoclonal antibodies in the culture medium after overnight culture will be picked out and added to LB culture medium containing tetracycline and ampicillin, and cultured at 37°C and 200 rpm until turbidity occurs.

[0153] (6) After double enzyme digestion and sequencing identification, the ligation product was mixed with 50% glycerol at a ratio of 1:1 and stored in a -80°C refrigerator.

[0154] 7. Preparation of dsRcARNT or dsRcCncC of Reticulitermes fuscata

[0155] Add 20 μL of the preserved dsRcARNT-HT115 bacterial solution or dsRcCncC-HT115 bacterial solution to 100 ml of Luria-Bertani (LB) medium, add ampicillin and tetracycline at final concentrations of 75 μg / mL and 12.5 μg / mL, and culture in a constant temperature shaker at 37°C and 180 rpm for 24 h. Add 1 mL of the bacterial solution to 50 mL of LB liquid medium, and the concentrations of ampicillin and tetracycline in the medium are the same as above. Incubate the solution at 37°C with shaking until the OD 600 =0.4-0.6, then add 400 μL isopropyl-β-D-thiogalactopyranoside (IPTG, final concentration of 0.8 mM) to induce the expression of dsRNA. The bacteria were cultured at 37°C with shaking for 3 hours, and the bacterial solution was treated with ultrasound to destroy the cell wall and cell membrane of the dsRcARNT-HT115 bacteria to release dsRNA. 8 mL of dsRcARNT-HT115 bacteria were centrifuged at 12,000 rpm for 5 minutes, the supernatant was removed, 5 mL of DEPC water was added and mixed thoroughly. The bacterial suspension was crushed using an ultrasonic homogenizer at 50% power, 3s on and 6s off, and the dsRNA crushed bacterial solution was obtained by coating it on LB medium without the growth of bacterial plaques.

[0156] The results showed that after the dsRNA-HT115 bacterial solution was treated with an ultrasonic disruptor, 200 μL of the sample was taken every 0.5 h and spread on the plate for 24 h. The observation results showed that after 2 h of treatment, the bacterial solution was completely inactivated and no colonies were seen growing on the culture medium.

[0157] The dsRNA-HT115 bacterial solution was treated with an ultrasonic disruptor, and 200 μL of the sample was spread on a plate every 0.5 h and cultured for 24 h. The observation results showed that after 2.5 h of treatment, the bacterial solution was completely inactivated and no colonies were observed on the culture medium.

[0158] Example 5 Determination of the Optimal Time for Treating Black-chested Reticulitermes Workers with dsRcARNT or dsRcCncC

[0159] 20 black-chested Reticulotermes worker ants were placed in a 7 cm petri dish filled with dry filter paper, and 400 μL of broken bacterial solution was evenly dripped on the petri dish filter paper using a micropipette. dsGFP was used as a control and stored in a light-free condition for 24 hours after treatment. The black-chested Reticulotermes were sampled at 6, 12, 24, 36 and 48 hours and stored in an ultra-low temperature refrigerator. The total RNA of the black-chested Reticulotermes worker ants collected at different treatment times was extracted using the Trizol method, and the expression levels of the RcARNT or RcCncC genes of termites at different treatment times were detected using qPCR, and β-actin and HSP70 were used as internal reference genes. -ΔΔCT Methods Calculation of qPCR data.

[0160] The results showed that the RNAi interference technology was used to silence the RcARNT gene in the black-chested termite, and the interference efficiency was determined by qPCR. The results are shown in the figure. Except for 6 hours without interference, the interference efficiency of the other interference times of 12, 24, 36 and 48 hours all reached more than 20%. Among them, the interference efficiency of RcARNT was the highest at 36 hours of interference time, reaching 99.92% (as shown in Figure 1). Figure 3 ).

[0161] RNAi interference technology was used to interfere with the expression of the RcCncC gene in the black-chested termite, and the interference efficiency was determined by qPCR. The results are shown in the figure. When the interference time was 6, 12, 24 and 36 hours, the expression of the RcCncC gene was interfered, and the interference efficiency reached more than 20%. Among them, the interference efficiency of RcCncC was the highest at 36 hours of interference time, reaching 98.11% ( Figure 4 ).

[0162] Example 6 Effect of dsRcARNT treatment on the toxicity of lufenuron in black-chested termite workers

[0163] The pronotum of black-chested termites treated with 400 μL of 1 μg / μL dsRcARNT and dsGFP and RNase-free ddH2O for 36 h was inoculated with 0.5 μL of lufenuron (concentration of 7.16×10 -7 mol / L), and the mortality rate was continuously counted until the mortality rate of the control group exceeded 20% or all the worker ants in the treatment group died. Each treatment was repeated 3 times.

[0164] The results showed that after the black-chested termites were treated with dsRcARNT for 36 hours, the expression of the RcARNT gene of the black-chested termites was interfered with, and their sensitivity to lufenuron was significantly increased. At 100 hours, the mortality rate of the group treated with lufenuron combined with dsRcARNT interference was (4%), which was not significantly increased compared with other control groups (such as Figure 5 A). At 200h, the mortality rate of black-chested Reticulitermes treated with lufenuron combined with dsRcARNT (45%) was significantly higher than that of the group treated with lufenuron combined with dsGFP (23%) (see Figure 2). Figure 5 B). At 300 h, the mortality rate of black-chested Reticulitermes treated with lufenuron combined with dsRcARNT (61%) was significantly higher than that of the lufenuron and dsGFP group (49%) (see Figure 2). Figure 5 C). Survival curve results show (such as Figure 5 D), the survival rate of the group treated with lufenuron combined with dsRcARNT was lower than that of the other lufenuron treatment groups (CK-lufenuron group and dsGFP-lufenuron group), and the survival rate of the lufenuron treatment groups (CK-lufenuron, dsGFP-lufenuron and dsRcARNT-lufenuron) was lower than that of the other treatment groups (CK group, dsGFP group and dsRcARNT group). This result shows that the interference of RcARNT gene can increase the sensitivity of black-chested termites to lufenuron.

[0165] Example 7 Effect of dsRcCncC treatment on the toxicity of buprofezin

[0166] The pronotum of black-chested termites treated with 400 μL of 1 μg / μL dsRcCncC and dsGFP and RNase-free ddH2O for 36 h was inoculated with 0.5 μL of thiamethoxam (concentration of 5.12×10 -7 mol / L), and the mortality rate was continuously counted until the mortality rate of the control group exceeded 20% or all the worker ants in the treatment group died. Each treatment was repeated 3 times.

[0167] The results showed that: using RNA interference technology, the expression of RcCncC in black-chested Reticulitermes worker ants was interfered with and then treated with thiamethoxam 36 hours later. Interference with RcCncC in black-chested Reticulitermes increased the sensitivity of black-chested Reticulitermes to thiamethoxam. The mortality rate of black-chested Reticulitermes treated with thiamethoxam combined with the interference group was significantly increased compared with the group treated with thiamethoxam alone. Specific bioassay results showed (such as Figure 6 ), after interfering with the expression of the RcCncC gene of black-chested termites, its sensitivity to thiamethoxam increased significantly. At 200h, the mortality rate of the thiamethoxam combined with dsRcCncC interference treatment group was (46%), which was significantly higher than that of other control groups (such as Figure 6 A). At 300 h, the mortality rate of black-chested termites treated with lufenuron combined with dsRcCncC (78%) was significantly higher than that of the group treated with thiamethoxam combined with dsGFP (59%) and other control groups (such as Figure 6 B). Survival curve results show (such as Figure 6 C), the survival rate of the thiazinone combined with dsRcCncC group was lower than that of other thiazinone treatment groups (CK-thiazinone group and dsGFP-thiazinone group), and the survival rate of the thiazinone treatment groups (CK-thiazinone, dsGFP-thiazinone and dsRcCncC-thiazinone) was lower than that of other treatment groups (CK group, dsGFP group and dsRcCncC group). This result shows that the interference of RcCncC gene can increase the sensitivity of black-chested Reticulitermes to thiazinone.

Claims

1. The application of insect growth regulator combined with transcription factor dsRNA in the control of black-chested termites, characterized in that: The transcription factor dsRNA is the dsRNA of Reticulitermes nigropunctatus RcARNT or RcCncC.

2. The use according to claim 1, characterized in that: The insect growth regulator is lufenuron or buprofezin.

3. The use according to claim 1, characterized in that: The full-length cDNA of the RcARNT or RcCncC gene is shown as SEQ ID No.1 and SEQ ID No.2 respectively.

4. The use according to claim 3, characterized in that: The primer sequence for synthesizing the dsRNA of the RcARNT gene is the upstream primer (5'-3') CTAGGGAGCTTACTCAGACTGTACCAGGGACT, and the downstream primer (5'-3') CCGAAGCTTCGCTCTGTGGCTGATTCAGT. The primer sequence for synthesizing the dsRNA of the RcCncC gene is the upstream primer (5'-3') CTAGCTAGCGCTCGACACCACTCAGATGTG, and the downstream primer (5'-3') CCGCTCGAGCTGGTATCCATCAGGATCTCG.

5. The use according to any one of claims 1 to 4, characterized in that: The termites were first treated with dsRNA of RcARNT or RcCncC of Reticulitermes nigropunctatus, and then treated with an insect growth regulator.

6. The use according to claim 5, characterized in that: Termites were treated with 1 μg / μL dsRNA of RcARNT of Reticulitermes nigromaculata for 36 h, and then 0.5 μL, 7.16×10 -7 mol / L lufenuron to treat termites.

7. The use according to claim 5, characterized in that: Termites were treated with 1 μg / μL dsRNA of RcCncC of black-chested termites for 36 h, and then 0.5 μL of 5.12×10 -7 mol / L of thiamethoxam to treat termites.

8. A method for preparing dsRNA for use according to any one of claims 1 to 7, characterized in that: The following steps are taken to obtain dsRNA-disintegrated bacterial solution: prepare dsRcARNT-HT115 bacterial solution or dsRcCncC-HT115 bacterial solution, induce dsRNA expression, and then use ultrasound to treat the bacterial solution to release dsRNA.

9. The preparation method according to claim 8, characterized in that: The bacterial suspension was pulverized using an ultrasonic homogenizer.

Images