CRISPR / Cas9 gene knockout vector applicable to penicillium digitatum W03 as well as construction method and application of CRISPR / Cas9 gene knockout vector

Abstract

The invention discloses a CRISPR / Cas9 gene knockout vector suitable for Penicillium digitatum W03 and a construction method and application thereof. The CRISPR / Cas9 gene knockout vector comprises a single-gene knockout vector and a double-gene knockout vector, the invention also provides an identification method of the penicillium digitatum W03 mutant strain. The CRISPR / Cas9 gene knockout system developed by utilizing an endogenous promoter of pathogenic fungi and tRNA has the advantages of convenience in vector construction, high gene knockout efficiency, capability of simultaneously carrying out multi-gene editing and the like, so that a penicillium digitatum gene mutant is easier to obtain, and a technical foundation is laid for further exploring the pathogenesis of penicillium digitatum.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a CRISPR / Cas9 gene knockout vector suitable for Penicillium digitatum W03, and a construction method and application thereof. Background Art

[0002] Penicillium digitatum is a facultative trophic fungus widely found in nature. It can parasitize citrus fruits and cause green mold. This disease is the most serious disease in the storage and transportation of citrus fruits after harvest. If it is not properly controlled, the loss caused accounts for about 20-30% of the total post-harvest output of the citrus industry. Understanding the pathogenic mechanism of the pathogen is crucial to establishing an efficient and sustainable citrus green mold disease prevention and control system. However, due to the low efficiency of the genetic transformation system, the relevant research progress has been slow, and the infection mechanism of Penicillium digitatum is still unclear.

[0003] CRISPR / Cas9 is a technology that uses sgRNA to mediate the specific editing of target genes by Cas9 nuclease. The technology is based on clustered regularly interspaced short palindromic repeats (CRISPR) and associated proteins (Cas9) to generate double-strand breaks (DSBs) at the target site, and through non-homologous end joining (NHEJ)-mediated DNA repair, it leads to the insertion / deletion of one or several bases in the target gene. This technology originated from the immune system of archaea. Due to its advantages such as simple vector construction, high gene editing efficiency and low cost, it has been widely used in filamentous fungal gene editing research. However, the CRISPR / Cas9 system still needs to be further improved in terms of gene editing efficiency and multi-gene knockout in Penicillium digitatum.

[0004] Garrigues et al. first applied CRISPR / Cas9 technology to Penicillium digitatum and edited the WetA gene of Penicillium digitatum, with an editing efficiency of 10-12%; Carolina et al. used the gene editing method of CRISPR / Cas9 to increase the gene editing efficiency to 54-83% by extending the culture time of protoplasts after resurrection and increasing the number of cycle cultures. However, this editing efficiency still cannot meet the research needs, and its editing process is cumbersome and cannot perform multi-gene editing, which greatly hinders the study of the molecular mechanism of this fungus. Summary of the invention

[0005] The purpose of the present invention is to provide a CRISPR / Cas9 system suitable for efficient gene editing of the plant pathogenic fungus Penicillium digitatum and a construction method thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a method for constructing a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03 based on a single guide RNA, comprising the following steps: a. Construction template: pdmle promoter fragment and endogenous tRNA of Penicillium digitatum Gly-GCC1-3 The fragment was used as a template to obtain pdmle-tRNA by fusion PCR Gly-GCC1-3 The fragment was recorded as template 1 (tp1); the sgRNA scaffold fragment was recorded as template 3 (tp3); b. Design and amplify target sequences: Based on the target sequence of the target gene, denoted as sgRNA1, tp1 and tp3 were used as templates to construct two fragments containing the target sequence by amplification technology: tp1-sgRNA1 fragment and sgRNA1-tp3 fragment; c. Fusion PCR: The three fragments containing the target sequence were fused by PCR to obtain pdmle-tRNA Gly-GCC1-3 -sgRNA1-sgRNAscaffold (tp1-sgRNA1-tp3) fragment; d. Vector construction: Based on the pFC332-sgRNA plasmid, the pFC332-sgRNA vector was digested with restriction endonuclease BglII, and the tp1-sgRNA1-tp3 fragment was connected to the pFC332-sgRNA vector using homologous recombinase, and the ligation product was transformed into DH5α competent cells. After ampicillin resistance screening, vector primers were designed to verify the recombinant vector, thereby obtaining a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03.

[0007] In addition, the present invention also provides a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03 constructed by the above method.

[0008] In a second aspect, the present invention provides a method for constructing a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03 based on dual guide RNA, comprising the following steps: a. Build template: Penicillium digitatum endogenous tRNA Gly-GCC1-3 The fragment and sgRNA-scaffold fragment (tp3) were used as templates to obtain tRNA by fusion PCR. Gly-GCC1-3 -sgRNA scaffold, denoted as tp2; b. Design and amplify target sequence: Two target sequences of the target gene were designed near the start codon and the stop codon of the exon sequence of the target gene, respectively; the target sequence at the start codon was sgRNA1, and the target sequence at the stop codon was sgRNA2; tp1, tp2 and tp3 were used as templates, respectively, to design and amplify three fragments containing the target sequence: tp1-sgRNA1 fragment, sgRNA1-tp2-sgRNA2 fragment and sgRNA2-tp3 fragment; c. Fusion PCR: The three fragments containing the target sequence were fused PCR to obtain pdmle-tRNA Gly-GCC1-3 - sgRNA1-sgRNAscaffold- tRNA Gly-GCC1-3 - sgRNA2-sgRNA scaffold (tp1- sgRNA1-tp2- sgRNA2-tp3) fragment; d. Vector construction: pFC332-sgRNA was digested with restriction endonuclease BglII and used as a vector. The tp1-sgRNA1-tp2- sgRNA2-tp3 fragment was connected to the pFC332-sgRNA vector using homologous recombinase; the ligation product was transformed into DH5α competent cells. After ampicillin resistance screening, vector primers were designed to verify the recombinant vector, thus obtaining a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03.

[0009] In addition, the present invention also provides a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03 constructed by the above method.

[0010] In a third aspect, the present invention provides a method for identifying a mutant strain of Penicillium digitatum W03, comprising the following steps: a. Conversion: Transforming the vector described in claim 4 into the protoplasts of Penicillium digitatum W03, and extracting the genomic DNA of the transformant for identification; b. Identification: A pair of primers were designed upstream and downstream of the target gene sequence. PCR amplification was performed using the transformant genomic DNA as a template and the wild-type Penicillium digitatum W03 genomic DNA as a control; the size of the product bands after PCR amplification was compared to complete the identification of the strain mutation.

[0011] Furthermore, the band size of the mutant strain PCR product is smaller than that of the wild-type Penicillium digitatum W03, and the difference in band size is the sequence length between sgRNA1 and sgRNA2 at the target site of the target gene. The PCR products of the transformant strain and the wild-type strain have a significant size difference in the agarose gel electrophoresis pattern, and this method can be used to quickly identify the mutant strain.

[0012] In a fourth aspect, the present invention provides a method for constructing a CRISPR / Cas9 double gene knockout vector suitable for Penicillium digitatum W03, comprising the following steps: a. Design and amplify target sequence: The target sequence sgRNAA of target gene A and the target sequence sgRNAB of target gene B were designed respectively, and then tp1, tp2 and tp3 were used as templates to design and amplify three fragments containing the target sequence: tp1-sgRNAA fragment, sgRNAA-tp2-sgRNAB fragment and sgRNAB-tp3 fragment; b. Fusion PCR: The three fragments containing the target sequence were fused by PCR to obtain pdmle-tRNA Gly-GCC1-3 -sgRNAA-sgRNAscaffold-tRNA Gly-GCC1-3 -sgRNAB-sgRNA scaffold (tp1-sgRNAA-tp2-sgRNAB-tp3) fragment; c. Vector construction: The tp1-sgRNAA-tp2-sgRNAB-tp3 fragment was ligated into the pFC332-sgRNA vector using homologous recombinase to obtain a CRISPR / Cas9 double gene knockout vector suitable for Penicillium digitatum W03.

[0013] In addition, the present invention also provides a CRISPR / Cas9 double gene knockout vector suitable for Penicillium digitatum W03 constructed by the above method.

[0014] In a fifth aspect, the present invention provides the CRISPR / Cas9 gene knockout vector suitable for Penicillium digitatum W03, the construction method of the gene knockout vector or the mutant strain identification method for use in Penicillium digitatum gene editing.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention utilizes the endogenous tRNA sequence and promoter pdmle of Penicillium digitatum to enhance the expression stability of sgRNA, and combines the optimized sgRNA backbone to improve the editing efficiency of the CRISPR / Cas9 system in Penicillium digitatum; the designed dual-gene editing method avoids repeated experiments through dual sgRNA tandem design, greatly improving the efficiency and reliability of multi-gene editing.

[0016] The CRISPR / Cas9 gene knockout system developed by the present invention utilizes the endogenous promoter and tRNA of pathogenic fungi, which has the advantages of convenient vector construction, high gene knockout efficiency, and the ability to perform dual gene editing at the same time, making it easier to obtain gene mutants of Penicillium digitatum, thereby laying a technical foundation for further exploring the pathogenic mechanism of Penicillium digitatum, and overcoming the defects of the current Agrobacterium tumefaciens transformation method or the CRISPR / Cas9 gene editing method of a single promoter plus sgRNA, such as complicated process, low homologous recombination efficiency, and inability to perform simultaneous editing of multiple genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the design diagram of the identification primers in Example 2.

[0018] Figure 2 This is the PCR identification result of the selected transformant genomic DNA.

[0019] Figure 3 The sequence alignment results of the PdwetA mutant and the wild-type W03. The red and yellow sequences in the figure are PAM sequences and sgRNA sequences, respectively, #n is the transformant number, the short dash in the mutant sequencing results indicates the knockout fragment, and the green sequence indicates the inserted fragment.

[0020] Figure 4 This is a plate photograph of W03 protoplasts transformed with the wetA gene knockout vector pFC332-dwetA grown in hygromycin-resistant PDA on the sixth day.

[0021] Figure 5 This is the sequencing result of double gene editing. DETAILED DESCRIPTION

[0022] The present invention is further described below in conjunction with embodiments and drawings.

[0023] The construction method of the templates tp1, tp2, and tp3 used in this embodiment is as follows: 1. Search the glycine (Gly) sequences of all tRNAs of Penicillium digitatum from the website (GtRNAdb: Genomic tRNA Database (ucsc.edu)) and select the tRNA with the shorter sequence length. Gly-GCC1-3 (tRNA) fragment was used as a template and fused with the pdmle promoter to obtain pdmle-tRNA Gly A fragment named template 1 (tp1).

[0024] 2. Using RNA from Penicillium digitatum Gly-GCC1-3 The fragment and sgRNA-scaffold fragment were used as templates for fusion PCR to obtain tRNA Gly-GCC1-3 -sgRNA scaffold fragment, which is named template 2 (tp2).

[0025] 3. The modified plasmid pFC334 contains the sgRNA scaffold sequence, and this fragment is used as template 3 (tp3).

[0026] The primers designed for constructing the template are shown in Table 1: Table 1 Primer name Sequence (5'-3') tp1-F CTCGCCGAATGATAT Pdmle-R TAGACCAATGATGCTAGTTGAGGAGGCGAAGGAAGCGTGG <![CDATA[tRNA Gly-GCC1-3 -F]]> CCACGCTTCCTTCGCCTCCTCAACTAGCATCATTGGTCTA tp1-R TGCATCATCCGTGAATCGAA tp2-F GTTTTAGAGCTAGAAATAGC sgRNA scaffold-R TAGACCAATGATGCTAGTTGGCACCGACTCGGTGCCACTT <![CDATA[stRNA Gly-GCC1-3 -F]]> AAGTGGCACCGAGTCGGTGCCAACTAGCATCATTGGTCTA tp3-F GTTTTAGAGCTAGAAATAGC tp3-R GCACCGACTCGGTGC The sequences used in this example are: Pdmle: CTCGCCGAATGATATCGGACTTGATTATTTTGTCGAGATGTGTGGTGCCACCCTGAGACATGAACAAATGCCTCAATGGCGTCATGCCGAGACAGATAAACTATATGGTGATGTTTAGTCAGCATTGTCCGCACAGATTGCTTAAAAGGCGCGGACCTTGTCATTATTTAGAAGAAATTCAGAGTATTTTTTCATACCATTTCAAGTGTTCTACAATCTCTTTTCATATTTTCCTCCACGCTTCCTTCGCCTCCT sgRNA scaffold: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGC tRNA Gly-GCC1-3 : CAACTAGCATCATTGGTCTAGTGGTAGAATTCGTCGTTGCCATCGACGAGGCCCGTGTTCGATTCACGGATGATGCA Example 1 Construction of single gene knockout vector pFC332-wetA The target sequence of wetA (GeneID: 26232753) 5'-GTTCAACCAATACGTCAACA-3' was obtained using the CRISPR online website (http: / / crispor.gi.ucsc.edu / ), and tp1-F / tp1-siwetA-R and tp3-siwetA-F / tp3-R were used as primer pairs, and tp1 and tp3 were used as templates for PCR amplification to obtain the tp1-wetA fragment containing the target sequence and the wetA-tp3 fragment containing the target sequence. The reaction system of the tp1-wetA fragment containing the target sequence was 50 μL: ddH2O 17 μL, 2×max buffer 25 μL, dNTP 1 μL, tp1-siwetA-F 2 μL, tp1-siwetA-R 2 μL, tp1 2 μL, and 2×penta enzyme 1 μL. PCR program: 95℃ pre-denaturation for 3min, 95℃ denaturation for 30s, 56℃ annealing for 15s, 72℃ extension for 30s, 35 cycles, 72℃ extension for 5min. The wetA-tp3 fragment containing the target sequence replaced the template and primers, and the amplification method was the same as above. Then the fragment containing the target sequence obtained after gel recovery and the wetA-tp3 fragment containing the target sequence were subjected to fusion PCR. The reaction system was 50μL: ddH2O 17μL, 2max buffer 25μL, dNTP 1μL, tp1-wetA 3μL, wetA-tp3 3μL, 2×penta enzyme 1μL. PCR program: 95℃ pre-denaturation for 3min, 95℃ denaturation for 30s, 56℃ annealing for 15s, 72℃ extension for 30s, 11 cycles, 72℃ extension for 5min. Finally, PCR amplification was performed using the fusion product as a template and tp1-siwetA-F and tp3-siwetA-R as a primer pair (the amplification method was the same as that of the tp1-wetA fragment containing the target sequence) to obtain a tp1-wetA-tp3 fragment containing a vector homologous fragment, whose sequence is shown in SEQ ID NO.1.

[0027] The plasmid pFC332 was digested with restriction endonuclease BglⅡ, incubated at 37℃ for 15min, and inactivated at 65℃ for 10min. The tp1-wetA-tp3 was connected to the pFC332 vector after digestion with homologous recombinase to construct the pFC332-sgRNA-wetA recombinant vector. The recombinant vector was transformed into DH5a competent cells, screened with LB plates containing ampicillin, and clones were picked. PFC332-F / pFC332-R were used as primers for bacterial liquid PCR, positive clones were screened and expanded, and plasmids were extracted for sequencing and identification. Sequencing was completed by Zhejiang Shangya Company. Thus, the CRISPR / Cas9 single gene knockout vector pFC332-sgRNA-wetA suitable for Penicillium digitatum W03 was obtained.

[0028] The primers used in Example 1 are shown in Table 2 below: Table 2 Primer name Sequence (5'-3') tp1-F ATACTGGGCCCGGGAAGATCTCTCGCCGAATGATAT tp1-siwetA-R GCTATTTCTAGCTCTAAAACTGTTGACGTATTGGTTGAACTGCATCATCCGTGAATCGAA tp3-siwetA-F TTCGATTCACGGATGATGCAGTTCAACCAATACGTCAACAGTTTTAGAGCTAGAAATAGC tp3-R ACAGCTATGACCATGAGATCTAAAAGCACCGACTCGGTGC pFC332-F GTGAAGGAGATGGAGCCG pFC332-R GCACCGACTCGGTGC Example 2 Construction of gene editing vector pFC332-dwetA for rapid PCR identification of mutants Two target sequences of the wetA gene were designed near the promoter and terminator of the wetA sequence, wetA1 (A1) at the promoter: 5'-GTTCAACCAATACGTCAACA-3', wetA2 (A2) at the terminator: 5'-GTTCGCACCATGCAAAGCGT-3', and then tp1, tp2 and tp3 were used as templates, tp1-F / tp1- siwetA -R, tp3-siwetA-F / tp2-A2-R, tp3-A2-F / tp3-R were used as amplification primer pairs to amplify the tp1-A1 fragment containing the target sequence, the A1-tp2-A2 fragment containing the target sequence and the A2-tp3 fragment containing the target sequence, and fusion PCR was performed to obtain pdmle-tRNA Gly -A1-sgRNA scaffold- tRNA Gly -A2-sgRNA scaffold (tp1-A1-tp2-A2-tp3) fragment, whose sequence is SEQ ID NO. 2. The gene knockout vector pFC332-dwetA was obtained according to the method in Example 1.

[0029] According to the W03 protoplast transformation method of Garrigues et al. (2022), the gene knockout vector pFC332-dwetA was transferred into W03 protoplasts and cultured at 28°C for three days. The germinated single colonies were picked and cultured on PDA plates containing hygromycin. The genomic DNA of the transformants was extracted two days later.

[0030] The 5' end identification primer wetA-jd-F was designed about 350 bp upstream of the wetA promoter and the A1 target sequence, and the 3' end identification primer wetA-jd-R was designed about 400 bp downstream of the wetA terminator and the A2 target sequence, such as Figure 1 As shown. PCR amplification was performed using the picked transformant genomic DNA as a template and the genomic DNA of Penicillium digitatum W03 as a control. The identification reaction system was 10 μL: ddH2O 3.2 μL, 2×taq mix 5 μL, wetA-jd-F 0.4 μL, wetA-jd-R 0.4 μL. PCR program: 98°C pre-denaturation for 5 min, 98°C denaturation for 30 s, 56°C annealing for 15 s, 72°C extension for 1 min, 30 cycles, and 72°C extension for 5 min. The results showed that when the wild-type strain W03 genomic DNA was used as a template, a target fragment of 1690 bp was obtained, while when the transformant genomic DNA after knocking out wetA was used as a template, a fragment of 700 bp was obtained, as shown in FIG. Figure 2 As shown in the agarose gel electrophoresis pattern, there is an obvious size difference. The PCR products with size difference were sent for testing, and it was found that mutations occurred at the two target sequences, resulting in a base deletion at A1-A2 ( Figure 3 At the same time, the transformants with a size difference from the wild-type strain W03 amplification product had a white spore phenotype, proving that the wetA gene was successfully knocked out ( Figure 4 ).

[0031] The primers used in Example 2 are shown in Table 3 below: Table 3 Primer name Sequence (5'-3') tp2-A2-R GCTATTTCTAGCTCTAAAACACGCTTTGCATGGTGCGAACTGCATCATCCGTGAATCGAA tp3-A2-F TTCGATTCACGGTGATGCAGTTCGCACCATGCAAAGCGTGTTTTAGAGCTAGAAATAGC wetA-jd-F TTTTCCCGCTTGACTCGCTAT wetA-jd-R TGGCTGCCGTGCTGACATT Example 3 Construction of double gene knockout vector pFC332-sgRNA-g4665 / g6097 The target sequence of the PdW03_g4665 gene 5'-CTTCGGATCCGAGCTTCAAT-3' and the target sequence of the PdW03_g6097 gene 5'-CCGGGATAGGGCCCTATCTT-3' were designed respectively. The construction method of the double gene knockout vector pFC332-sgRNA-g4665 / g6097 was similar to the vector construction method used in Example 2, except that the target sequence of A1 was replaced with the target sequence of g4665, and the target sequence of A2 was replaced with the target sequence of g6097, and its sequence is shown in SEQ ID NO. 3. The gene knockout vector pFC332-sgRNA-g4665 / g6097 was transferred to W03 protoplasts, and the transformants were picked and their genomic DNA was extracted. Design identification primers of about 600-800bp near the target sequences of g4665 and g6097, g4665-jd-F / g4665-jd-R and g6097-jd-F / g6097-jd-R, respectively. The products obtained by the identification primers contain the target sequences. PCR amplification was performed using the selected transformant genomic DNA as a template and the digitate Penicillium W03 genomic DNA as a control. The reaction system and procedure were the same as in Example 2. The PCR amplified product was sent to the company for sequencing to obtain a double gene editing mutant ( Figure 5 ).

[0032] The primers used in Example 3 are shown in Table 4 below: Table 4 Primer name Sequence (5'-3') tp1-4669-R GTCAGCATTGGTCTGTAACCTTCGGATCCGAGCTTCAATCTGCATCATCCGTGAATCGAA tp2-4669-F TTCGATTCACGGATGATGCAGATTGAAGCTCGGATCCGAAGGTTACAGACCAATGCTGAC tp2-6097-R CTATTTCTAGCTCTAAAACCCGGGATAGGGCCCTATCTTCTGCATTGACGGGGAATCGAA tp3-6097-F TTCGATTCCCCGTCAATGCAGAAGATAGGGCCCTATCCCGGGTTTTAGAGCTAGAAATAG g4665-jd-F AGCCTCATTGGTGGAACTA g4665-jd-R CCGTTGGCTAGAGTAGAAC g6097-jd-F GCTCCGATGCTTTAGTATGA g6097-jd-R TGGCGTGTTGTTGAATGT The vector sequence table involved in the present invention is as follows: SEQ ID NO.1 (Pdmle): CTCGCCGAATGATATCGGACTTGATTATTTTGTCGAGATGTGTGGTGCCACCCTGAGACATGAACAAATGCCTCAATGGCGTCATGCCGAGACAGATAAACTATATGGTGATGTTTAGTCAGCATTGTCCGCACAGATTGCTTAAAAGGCGCGGACCTTGTCATTATTTAGAAGAAATTCAGAGTATTTTTTCATACCATTTCAAGTGTTCTACAATCTCTTTTCATATTTTCCTCCACGCTTCCTTCGCCTCCT SEQ ID NO.2 (sgRNA scaffold): GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGC SEQ ID NO.3 (tRNA Gly-GCC1-3 ): CAACTAGCATCATTGGTCTAGTGGTAGAATTCGTCGTTGCCATCGACGAGGCCCGTGTTCGATTCACGGATGATGCA The above embodiments are not limitations of the present invention, and the present invention is not limited to the above embodiments. As long as the requirements of the present invention are met, they belong to the protection scope of the present invention.

Claims

1. A method for constructing a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03 based on a single guide RNA, characterized in that: The following steps are involved: a. Construction template: pdmle promoter fragment and endogenous tRNA of Penicillium digitatum Gly-GCC1-3 The fragment was used as a template to obtain pdmle-tRNA by fusion PCR Gly-GCC1-3 The fragment was recorded as tp1, and the sgRNA scaffold fragment was recorded as tp3; b. Design and amplify target sequences: Based on the target sequence of the target gene, denoted as sgRNA1, tp1 and tp3 were used as templates to construct two fragments containing the target sequence by amplification technology: tp1-sgRNA1 fragment and sgRNA1-tp3 fragment; c. Fusion PCR: The three fragments containing the target sequence were subjected to fusion PCR to obtain the tp1-sgRNA1-tp3 fragment; d. Vector construction: Based on the pFC332-sgRNA plasmid, the pFC332-sgRNA vector was digested with the restriction endonuclease BglII, and the tp1-sgRNA1-tp3 fragment was ligated into the pFC332-sgRNA vector using a homologous recombinase to obtain a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03.

2. A CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03, constructed by the method described in claim 1.

3. A method for constructing a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03 based on dual guide RNA, characterized in that: The following steps are involved: a. Build template: Penicillium digitatum endogenous tRNA Gly-GCC1-3 The fragment and tp3 were used as templates to obtain tRNA by fusion PCR. Gly-GCC1-3 -sgRNA scaffold, denoted as tp2; b. Design and amplify target sequence: Two target sequences of the target gene were designed near the start codon and the stop codon of the exon sequence of the target gene, respectively; the target sequence at the start codon was sgRNA1, and the target sequence at the stop codon was sgRNA2; tp1, tp2 and tp3 were used as templates, respectively, to design and amplify three fragments containing the target sequence: tp1-sgRNA1 fragment, sgRNA1-tp2-sgRNA2 fragment and sgRNA2-tp3 fragment; c. Fusion PCR: The three fragments containing the target sequence were subjected to fusion PCR to obtain the tp1-sgRNA1-tp2-sgRNA2-tp3 fragment; d. Vector construction: pFC332-sgRNA was digested with restriction endonuclease BglII and the tp1-sgRNA1-tp2-sgRNA2-tp3 fragment was ligated into the pFC332-sgRNA vector using homologous recombinase to obtain a CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03.

4. A CRISPR / Cas9 single gene knockout vector suitable for Penicillium digitatum W03, constructed by the method described in claim 3.

5. A method for identifying a mutant strain of Penicillium digitatum W03, characterized in that: The following steps are involved: a. Conversion: Transforming the vector described in claim 4 into the protoplasts of Penicillium digitatum W03, and extracting the genomic DNA of the transformant for identification; b. Identification: A pair of primers were designed at the upstream and downstream of the target gene sequence, and PCR amplification was performed using the transformant genomic DNA as a template and the wild-type Penicillium digitatum W03 genomic DNA as a control. Comparing the band sizes of the products after PCR amplification, the band size of the mutant strain is smaller than that of the wild-type Penicillium digitatum W03, and the difference in band size is the sequence length between sgRNA1 and sgRNA2 at the target site of the target gene.

6. A method for constructing a CRISPR / Cas9 double gene knockout vector suitable for Penicillium digitatum W03, characterized in that: The following steps are involved: a. Design and amplify target sequence: The target sequences sgRNAA and sgRNAB of target gene A and B were designed respectively, and then three fragments containing target sequences were designed and amplified using tp1, tp2 and tp3 as templates: tp1- sgRNAA fragment, sgRNAA -tp2-sgRNAB fragment and sgRNAB -tp3 fragment; b. Fusion PCR: The three fragments containing the target sequence were subjected to fusion PCR to obtain the tp1-sgRNAA-tp2-sgRNAB-tp3 fragment; c. Vector construction: The tp1-sgRNAA-tp2-sgRNAB-tp3 fragment was ligated into the pFC332-sgRNA vector using homologous recombinase to obtain a CRISPR / Cas9 double gene knockout vector suitable for Penicillium digitatum W03.

7. A CRISPR / Cas9 double gene knockout vector suitable for Penicillium digitatum W03, constructed by the method described in claim 6.

8. Use of the gene knockout vector construction method according to claim 1, 3 or 6, the gene knockout vector according to claim 2, 4 or 7, or the mutant strain identification method according to claim 5 in gene editing of Penicillium digitatum.

Images