CD200R1 reporter gene recombinant vector, Jurkat stably transfected cell strain as well as preparation method and application of Jurkat stably transfected cell strain

Abstract

The invention relates to the technical field of biological medicine, in particular to a CD200R1 reporter gene recombinant vector, a Jurkat stably transfected cell strain and a preparation method and application of the Jurkat stably transfected cell strain. The CD200R1 reporter gene recombinant vector consists of a target gene segment and a blank vector plasmid, the target gene segment is formed by combining the nucleotide sequences of HCD200R1 (p.1 to243), CD28TM and CD3zeta (Cyt), and the nucleotide sequences of the HCD200R1 (p.1 to243), the CD28TM and the CD3zeta (Cyt). HCD200R1 (p.1 to243), CD28TM and CD3zeta (Cyt) are combined to form a target gene segment, the target gene segment is combined with blank vector plasmids, a recombinant vector with multiple immunoregulation functions can be constructed, and the recombinant vector can enhance immune response and has accurate targeting and flexible immunoregulation.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a CD200R1 reporter gene recombinant vector, a Jurkat stable transgenic cell line, and a preparation method and application thereof. Background Art

[0002] CD200 membrane glycoprotein, also known as OX-2, is a highly conserved type I transmembrane glycoprotein. The CD200 gene is located on chromosome 3q13.2 and contains two IgSF immunoglobulin domains, a transmembrane region, and a 19-amino acid long cytoplasmic domain. CD200 belongs to the immunoglobulin superfamily, especially the B7 receptor family. CD200 is mainly expressed on CD19+B lymphocytes, some CD3+T cells, thymocytes, follicular dendritic cells, vascular endothelial cells, and neurons.

[0003] CD200R1 is a cell surface transmembrane glycoprotein CD200 receptor 1, which belongs to the immunoglobulin superfamily and is a transmembrane protein. It is mainly expressed on myeloid cells (such as macrophages and dendritic cells) and certain lymphocytes (such as CD4+T cells).

[0004] The binding of CD200 to CD200R leads to tyrosine phosphorylation on the cytoplasmic PTB domain of CD200R. This leads to the recruitment of the adaptor proteins DOK-1 and DOK-2, promoting the binding of SHIP to DOK-1 and the recruitment of RasGAP, thereby negatively regulating the MAPK / ERK signaling pathway. This signaling can inhibit the expression of proinflammatory cytokines such as TNF-α, IFN-γ and inducible nitric oxide synthase, the inhibition of immune cell activation, and the inhibition of mast cell degranulation.

[0005] CD200 transmits negative regulatory signals after interacting with its receptor (CD200R), inhibiting T cell-mediated immune responses by reducing the activation of myeloid cells and inducing the transformation of Th1 cells to Th2 cells, and participating in the immune regulation of pathological and physiological processes such as inflammatory response, autoimmunity, tumor immunity, and transplant rejection.

[0006] In the research and development stage of biotherapeutic drugs, the in vitro biological activity determination and screening process of drugs relative to targets is very important. For example, in the drug discovery process of CD200R1 antagonists, it is necessary to develop a binding activity determination method between candidate drugs and CD200R1 protein, such as using recombinant CD200R1 protein available on the market, mast cells, or stably transfected cell lines with high CD200R1 expression peaks to determine binding activity; whether candidate drugs with binding activity have the effect of cytological antagonists is usually performed on mast cells, using kits to detect TNF-α and IFN-γ expression to determine biological activity or mast cell degranulation. Both detection methods are costly and relatively poor in sensitivity. The multiple ratio between the signal and the target product is low, nonlinear correlation, poor signal stability, and complex data interpretation.

[0007] In preclinical and clinical studies, drug pharmacokinetics is an essential test item for evaluating drug safety and efficacy. Drug pharmacokinetics relies on quantitative analysis methods. Specifically for CD200R1 agonist drugs, receptor ligand binding assay (LBA) is used for biological analysis. It is necessary to obtain anti-candidate drug specific antibodies through hybridoma technology by immunizing animals with candidate drugs for method development. The time period is relatively long, 3-6 months, and specific antibodies need to be prepared for each candidate drug. It is not universal, and the stability and sensitivity of the quantitative method are greatly affected by the specific antibodies. Therefore, a detection method with good stability and sensitivity is extremely important. Summary of the invention

[0008] In order to solve the above technical problems, the present invention designs and transforms the connection mode between CD200R1 and the reporter gene, constructs a reporter gene cell line of CD200R1 with a stable structure, and develops a reporter gene cell line based on CD200R1, which has good stability and sensitivity and can be used to study the interaction between CD200 and CD200R1, immunize animals to prepare antibodies or in vitro screening of antibodies, etc., to help CD200 / CD200R1 related drug research and development. It is of great significance for in vitro research on the interaction between CD200 and CD200R1, immunize animals to prepare antibodies or in vitro screening of antibodies, etc.

[0009] In the first aspect, the present application provides a CD200R1 reporter gene recombinant vector, which adopts the following technical scheme: a CD200R1 reporter gene recombinant vector, which is composed of a target gene fragment and a blank vector plasmid; The target gene fragment is composed of the nucleotide sequences of H_CD200R1 (p.1to243), CD28TM and CD3ζ (Cyt); The nucleotide sequence of H_CD200R1 (p.1to243) is shown in SEQ ID NO.1; The nucleotide sequence of the CD28TM is shown in SEQ ID NO.2; The nucleotide sequence of the CD3ζ (Cyt) is shown in SEQ ID NO.3.

[0010] By adopting the above technical scheme, the H_CD200R1 (p.1to243) is a truncated body of H_CD200R1 (UniProt: Q8TD46-1), and its introduction enables the recombinant vector to have the ability to respond to CD200 signals. The truncated body reduces the molecular weight of the entire molecule by removing part of the amino acid sequence, which helps to reduce the complexity and preparation cost of the protein. The truncated body improves the overall stability by removing unstable regions or domains. The truncated body makes the remaining domains more compact by removing the amino acid sequences that are not related to binding, thereby improving the affinity with the target molecule. In addition, because the molecular weight of the truncated body is small, it is easier to be recognized by the detection system.

[0011] CD28 is a co-stimulatory molecule expressed on the surface of T lymphocytes and plays an important role in the activation of T cells. CD28TM (i.e., the transmembrane region of CD28) is responsible for combining the function of CD28 with the cell membrane. The addition of CD28TM enables the recombinant vector to simulate the co-stimulatory signal during T cell activation, thereby enhancing the activation and proliferation ability of T cells.

[0012] The CD3 molecule is composed of four subunits: CD3ε, CD3δ, CD3γ, and CD3ζ. It is the core part of the TCR-CD3 complex and plays a key role in T cell recognition and response to antigens. The intracellular domain of CD3ζ contains three ITAMs, which play a key role in TCR signal transduction. The introduction of CD3ζ (Cyt) provides a strong signal transduction capability for the recombinant vector, enabling T cells to more effectively receive and transmit antigen stimulation signals through the TCR-CD3 complex. CD3ζ (Cyt) is also involved in the production of IL-2 and the positive localization of proteins, further enhancing the immune response ability of T cells.

[0013] The present application combines H_CD200R1 (p.1to243), CD28TM and CD3ζ (Cyt) to form a target gene fragment, and combines it with a blank vector plasmid to construct a recombinant vector with multiple immune regulatory functions. The recombinant vector can enhance the immune response, has precise targeting and flexible immune regulation.

[0014] In a second aspect, the present application provides a method for preparing a CD200R1 reporter gene recombinant vector, using the following technical solution: A method for preparing a CD200R1 reporter gene recombinant vector, used for preparing the above-mentioned CD200R1 reporter gene recombinant vector, comprises the following steps: Amplify blank vector fragments, amplify target gene fragments, connect blank vector fragments and target gene fragments, connect plasmid transformation screening, and identify connected plasmids; The amplification of the blank vector fragment comprises the following steps: Amplifying the plasmid: culturing the bacterial solution containing the blank vector plasmid overnight and extracting it to obtain the target plasmid; Double digestion: the target plasmid is double digested with two restriction endonucleases, XbaI and BamHI, to obtain digestion products; separation of blank vector fragments: the digestion products are subjected to agarose gel electrophoresis, and then the gel strip containing the blank vector fragment is separated and incubated to obtain a blank vector fragment gel solution; Recovery of blank vector fragments: centrifuging and drying the blank vector fragment gel solution, adding ddH2O, and obtaining a blank vector fragment solution; The amplification of the target gene fragment comprises the following steps: PCR amplification: PCR amplify the target gene fragment to obtain PCR products; Isolating the target gene fragment: performing agarose gel electrophoresis on the PCR product, and then separating the gel strip containing the target gene fragment and incubating it to obtain a gel solution of the target gene fragment; Recovery of target gene fragments: centrifuging and drying the target gene fragment gel solution, adding ddH2O, and obtaining a target gene fragment solution; The method of connecting the blank vector fragment and the target gene fragment comprises the following steps: connecting the blank vector fragment solution and the target gene fragment solution under the Hieff CloneTM recombination reaction system to obtain a connection plasmid; The ligated plasmid transformation screening comprises the following steps: Transformation: transforming the ligated plasmid into competent cells to obtain cells to be screened; Initial culture: the cells to be screened are initially cultured in a SOC medium without antibiotics to obtain an initial culture solution; resistance screening: the initial culture solution is added to a SOC medium plate containing antibiotics for overnight culture to obtain colonies to be tested, wherein the antibiotics are the antibiotics to which the blank vector plasmid is resistant; Sequencing verification: the colony to be tested is cultured overnight and then extracted to obtain the plasmid to be tested; the plasmid to be tested is sequenced to determine the CD200R1 reporter gene recombinant vector.

[0015] By adopting the above technical scheme, the bacterial solution containing the blank vector plasmid is cultured overnight to ensure that the plasmid in the bacterial solution is fully replicated. The target plasmid is double-digested using two restriction endonucleases, XbaI and BamHI. The selection of these two enzymes should be based on the restriction sites on the blank vector plasmid to ensure that the required blank vector fragment can be cut out. The gel strip containing the blank vector fragment is separated from the agarose gel and incubated to soften the gel and release the DNA fragment. The blank vector fragment gel solution is centrifuged and dried to remove excess gel and solution. ddH2O (deionized water) is added to dissolve the DNA fragment to obtain a blank vector fragment solution.

[0016] PCR can amplify the target gene fragment in large quantities. Under the Hieff CloneTM recombination reaction system, the blank vector fragment and the target gene fragment can be successfully connected. The connected plasmid is transformed into competent cells. The transformation method can be heat shock, electroporation or chemical method. SOC medium is a nutrient-rich medium that helps the growth and reproduction of cells, allowing the transformed cells to multiply in large quantities. Resistance screening can screen out transformants containing the target gene (i.e., cells that successfully integrate the connected plasmid into the cell genome). Sequence the plasmid to be tested to verify the correctness of the CD200R1 reporter gene recombinant vector. The sequencing results should be consistent with the expected sequence of the target gene fragment and the blank vector fragment.

[0017] Preferably, in the step of PCR amplification, the amplification primers are as follows: F:TCGAAGTATACCTCGAGTCTAGAGCCAC; R: GCGATCGCAGATCCTTGGATCCTTAGCGAGGGGGCAGGG.

[0018] Preferably, in the step of sequencing verification, the sequencing primer sequence is as follows: PEF-F: TCAAGCCTCAGACAGTGGTTC; Specific primers: CCTGCAAGTGCTGGTGACC; PGK-R:CTACACAAGTGGCCTCTGGC.

[0019] In a third aspect, the present application provides a method for preparing a Jurkat stably transfected cell line, using the following technical solution: a method for preparing a Jurkat stably transfected cell line, comprising the following steps: virus packaging and construction of a reporter gene cell line; The virus packaging comprises the following steps: Cell passaging: 293T anchorage-dependent epithelial cells were cultured. When the cell density reached 70-80%, new culture medium was replaced to obtain cells to be transfected. Mixing plasmid: Mix the CD200R1 reporter gene recombinant vector, DMEM culture medium, Lenti-HG Mix and HG transgene reagent described above to obtain a mixed plasmid; Transfection: adding the mixed plasmid to the cells to be transfected and culturing them to obtain transfected cells; Virus collection: the transfected cells are concentrated by centrifugation to obtain a virus concentrate; Titer determination: 293T anchorage-dependent epithelial cells in the logarithmic growth phase are cultured overnight, and when the cell density reaches 30-50%, cells to be infected are obtained; the virus concentrate is graded diluted, added to the cells to be infected for culture, and then RT-PCR is performed to obtain the titer of the virus concentrate; The construction of the reporter gene cell line comprises the following steps: Infection: Infecting NFAT-Luc Reporter Jurkat CellLine cells in the logarithmic growth phase with the virus concentrate, and then culturing to obtain mixed Jurkat transfected cells; Screening: subjecting the mixed Jurkat transfected cells to at least two rounds of drug screening to obtain Jurkat transfected cells to be tested; Verification: The Jurkat transfected cells to be tested are verified, and if the verification passes, a Jurkat stable transfected cell line is obtained.

[0020] By adopting the above technical solution, when the cell density reaches 70-80%, new culture medium is replaced to obtain cells to be transfected. This step ensures that the cells are in a good growth state, which is conducive to the subsequent transfection process. The transfected cells are centrifuged and concentrated to obtain a virus concentrate. The virus concentrate contains a large number of virus particles, which is the key to the subsequent infection step.

[0021] The virus concentrate is used to infect NFAT-Luc Reporter Jurkat Cell Line cells in the logarithmic growth phase. This step is necessary to ensure that the virus can successfully infect the target cells and integrate the reporter gene into the cell genome. The drug screening process can kill cells that have not successfully integrated the reporter gene, thereby screening out cells that have successfully integrated the reporter gene.

[0022] Preferably, in the step of titer determination, the primer sequences used in the RT-PCR determination are as follows: WPRE-F: CGCTATGTGGATACGCTGCTTTA; WPRE-R:GCAACCAGGATTTATACAAGGAGGA.

[0023] Preferably, in the step of verification, the verification includes at least one of flow cytometry verification, Jurkat transfected cell activation verification and antibody blocking verification.

[0024] By adopting the above technical solution, the original CD200R1 intracellular signaling pathway is changed through the CD200R1 reporter gene recombinant vector. After CD200 binds to CD200R1, the intracellular Luciferase fluorescence signal intensity is detected, and the binding ability of CD200 / CD200R1 related drugs is intuitively reflected during verification.

[0025] Preferably, in the step of mixing the plasmid, 10 μg of the CD200R1 reporter gene recombinant vector, 1 mL of DMEM culture medium, 10 μL of Lenti-HG Mix and 60 μL of HG transgene reagent are mixed.

[0026] In a third aspect, the present application provides a Jurkat stable cell line, which adopts the following technical solution: A Jurkat stable cell line is prepared by the above-mentioned method for preparing the Jurkat stable cell line.

[0027] In a fourth aspect, the present application provides an application of a Jurkat stably transfected cell line, using the following technical solution: An application of a Jurkat stable cell line includes the application of the Jurkat stable cell line in in vitro studies of the interaction between CD200 and CD200R1, immunization of animals to prepare antibodies or in vitro screening of antibodies. Since the Jurkat stable cell line has high stability and sensitivity, it can be better applied in the above applications.

[0028] In summary, this application has the following beneficial effects: 1. Since the present application combines H_CD200R1 (p.1to243), CD28TM and CD3ζ (Cyt) to form a target gene fragment, and combines it with a blank vector plasmid, a recombinant vector with multiple immune regulation functions can be constructed, which can enhance immune response, has precise targeting and flexible immune regulation; 2. The present application uses Jurkat stably transfected cell lines with high stability and sensitivity, and can be used to study the interaction between CD200 and CD200R1 in vitro, immunize animals to prepare antibodies, or screen antibodies in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is the map of the blank vector plasmid lenti-CMV-MCS-PGK-Puro; Figure 2 The map of CD200R1 reporter gene recombinant vector lenti-EF1A-H_CD200R1(SP-ECD)(Codon opt)-CD28 TM-CD3ζ(Cyt)-PGK-Puro; Figure 3 This is a double enzyme digestion verification diagram of the CD200R1 reporter gene recombinant vector.

[0030] Figure 4 The results of the flow verification test are shown.

[0031] Figure 5 CD200 cell activation assay results are shown.

[0032] Figure 6 Antibody inhibition assay results are shown. DETAILED DESCRIPTION

[0033] The raw materials in this application include the following parts: NFAT-Luc Reporter Jurkat Cell Line cells, Anti-CD200R hIgG4 Antibody antibodies and H_CD200CHO-K1 Cell Line cells were all provided by Yoshiman Biotechnology (Shanghai) Co., Ltd.

[0034] The present application is further described in detail below with reference to the embodiments.

[0035] A method for preparing a CD200R1 reporter gene recombinant vector comprises the following steps: amplifying a blank vector segment, amplifying a target gene segment, connecting the blank vector segment and the target gene segment, connecting plasmid transformation screening, and connecting plasmid identification.

[0036] The target gene fragment is composed of the nucleotide sequences of H_CD200R1 (p.1to243), CD28TM and CD3ζ (Cyt); The nucleotide sequence of H_CD200R1 (p.1to243) is shown in SEQ ID NO.1; The nucleotide sequence of CD28TM is shown in SEQ ID NO.2; The nucleotide sequence of CD3ζ (Cyt) is shown in SEQ ID NO.3.

[0037] The blank vector plasmid is lenti-EF1a-MCS-PGK-Puro, with a base pair size of 10306 bp, see Figure 1 .

[0038] Amplification of the blank vector fragment includes the following steps: (1) Amplification of plasmid: Culture the E. coli culture containing the blank vector plasmid overnight, take 4 mL of the cultured E. coli culture and extract it to obtain the target plasmid. For specific methods, refer to the instructions for the TIANGEN plasmid mini-extractor.

[0039] (2) Double digestion: Take 1 μg of blank vector plasmid and perform double digestion with two restriction endonucleases, XbaI and BamHI, at 37°C for about 3 hours to obtain the digestion product. The digestion system is a 50 μL system, as follows: Blank vector plasmid 1 μg green Buffer 5μL Xgf 2μL B H 2μL <![CDATA[ddH2O]]> Make up to 50 μL (3) Separation of blank vector fragments: The digested products were subjected to agarose gel electrophoresis, and then the gel strip containing the blank vector fragments was separated. The volume of the gel strip was calculated as 100 mg = 100 μL. One volume of the Binding Solution was added to the gel strip and the strip was incubated in a 65°C water bath to completely melt the gel strip to obtain the blank vector fragment gel solution.

[0040] (4) Recovery of blank vector fragments: Transfer all the blank vector fragment gel solution to the filter column placed in the EP tube and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Centrifuge to dry, add ddH2O to obtain a blank vector fragment solution; then discard the liquid in the tube, add 500μL of Wash Solution to the column, and centrifuge at 13,000 rpm for 30 seconds. Discard the liquid in the tube, add 500μL of Wash Solution to the column, and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then leave it empty for 3 minutes. Place the filter column in a new 1.5mL EP tube and dry at room temperature. Finally, add 35μL of ddH2O to the filter column, let it stand for 5 minutes, and centrifuge at 13,000 rpm for 1.5 minutes. In order to improve the recovery rate, the dissolved DNA can be added to the filter column again and centrifuged for 1 minute. Discard the filter column, obtain a blank vector fragment solution, and measure the concentration.

[0041] The target gene fragment is H_CD200R1(SP-ECD)(Codon opt)-CD28 TM-CD3ζ(Cyt), a sequence composed of SEQ ID NO.1-NO.3, without any base sequence inserted at the junction. The sequence was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd., and sequence analysis software was used to find the restriction endonuclease present in the target gene fragment, and the restriction sites at both ends of the primers were determined corresponding to the vector used, and the determined restriction sites were added to the 5' end and amplified.

[0042] Amplification of the target gene fragment includes the following steps: (1) PCR amplification: The target gene fragment was amplified by PCR to obtain the PCR product; the amplification primers are as follows: F: TCGAAGTATACCTCGAGTCTAGAGCCAC; R: GCGATCGCAGATCCTTGGATCCTTAGCGAGGGGGCAGGG.

[0043] The amplification primers were diluted to a final concentration of 10 μmol / L. During the PCR process, the annealing temperature was 64°C, the extension temperature was 72°C, and the PCR amplification system was as follows: (2) Isolation of target gene fragments: The PCR products are subjected to agarose gel electrophoresis, and then the gel strip containing the target gene fragment is separated and incubated to obtain a gel solution of the target gene fragment.

[0044] (3) Recovery of target gene fragments: The target gene fragment gel solution was centrifuged and dried, and ddH2O was added to obtain the target gene fragment solution.

[0045] The detailed steps of isolating the target gene fragment and recovering the target gene fragment are the same as those of isolating the blank vector fragment and recovering the blank vector fragment, and will not be repeated here.

[0046] Connecting the blank vector fragment and the target gene fragment comprises the following steps: connecting the blank vector fragment solution and the target gene fragment solution under the Hieff CloneTM recombination reaction system to obtain a connection plasmid.

[0047] 1. Determine the concentration of blank vector fragment solution and target gene fragment solution.

[0048] 2. The blank vector fragment and the target gene fragment were connected at 50°C for 20 minutes under the Hieff CloneTM recombination reaction system to obtain a connected plasmid. The Hieff CloneTM recombination reaction system is as follows: 5×CE Buffer 4μl Blank vector fragment 200ng Target gene fragment 56ng Exnase 2μl <![CDATA[ddH2O]]> Make up to 20 μL The ligation plasmid transformation screening includes the following steps: (1) Transformation: Place the competent E. coli cells on ice (4°C) and wait for them to thaw naturally. Then take 10 μl of the ligated plasmid and add it to the competent E. coli cells and place it on ice (4°C) for 30 minutes. Then heat shock it in a 42°C water bath for 90 seconds, and then quickly place it on ice (4°C) for 3 minutes. The ligated plasmid is transformed into the competent E. coli cells to obtain the cells to be screened.

[0049] (2) Primary culture: Add the cells to be screened to 500 μL of SOC medium without antibiotics and culture at 37°C and 225 rpm for 45 min to obtain a primary culture solution.

[0050] (3) Resistance screening: Centrifuge the primary culture at 3000 rpm for 2 min, discard 900 μL of the supernatant, disperse the primary culture at the bottom of the tube by blowing, add it to the SOC medium plate containing antibiotics, spread it evenly with a sterilized applicator, and invert it in a 37°C constant temperature incubator for overnight culture to obtain the colonies to be tested. The antibiotic is the antibiotic to which the blank vector plasmid is resistant. The antibiotic used in the example of this application is ampicillin because the antibiotic to which the blank vector plasmid is resistant is ampicillin.

[0051] (4) Sequencing verification: After the colony to be tested is cultured overnight, 4 mL of the cultured E. coli culture liquid is taken and extracted to obtain the plasmid to be tested. For specific methods, refer to the instructions for the TIANGEN plasmid mini-extraction. The plasmid to be tested is sequenced, and the sequencing is completed by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results show that the inserted target gene fragment is the same as the sequence shown in SEQ ID NO: 1-NO: 3, and it is determined to be a CD200R1 reporter gene recombinant vector, see Figure 2 .

[0052] The sequencing primer sequences are as follows: PEF-F: TCAAGCCTCAGACAGTGGTTC; Specific primers: CCTGCAAGTGCTGGTGACC; PGK-R:CTACACAAGTGGCCTCTGGC.

[0053] (5) Double enzyme digestion verification: Take 1 μg of the test plasmid and perform double enzyme digestion with two restriction endonucleases, XbaI and AspI, at 37°C for about 3 hours to obtain the digestion product. The digestion system is a 50 μL system, as follows: Plasmid to be tested 1 μg green Buffer 5μL Xgf 2μL AspI 2μL <![CDATA[ddH2O]]> Make up to 50 μL The digested products were subjected to agarose gel electrophoresis, and the results showed that the length of the ligated plasmid was correct, which was 9682bp+2022bp. Figure 3 The correctness of the CD200R1 reporter gene recombinant vector was further ensured by double enzyme digestion verification. XbaI enzyme was used to confirm that the target gene fragment was successfully inserted into the blank vector plasmid, and AspI enzyme was used to verify whether the target gene fragment was complete.

[0054] A method for preparing a Jurkat stable transfection cell line comprises the following steps: virus packaging and construction of a reporter gene cell line.

[0055] Virus packaging includes the following steps: (1) Cell passage: 293T anchorage-dependent epithelial cells were cultured in a 10 cm culture dish containing DMEM medium containing 10% FBS. When the cell density reached 70-80%, new DMEM medium was replaced at a standard of 12 mL / 10 cm dish to obtain cells to be transfected.

[0056] (2) Mixing plasmids: Mix 10 μg of CD200R1 reporter gene recombinant vector, 1 mL of DMEM culture medium, 10 μL of Lenti-HG Mix, and 60 μL of HG transgene reagent to obtain a mixed plasmid.

[0057] (3) Transfection: Add the mixed plasmid to the cells to be transfected and culture them. After 12 hours of transfection, evenly add 100×Enhancing buffer (120 μL / 10 cm dish) to promote transfection. After 20 hours of transfection, aspirate the cell culture medium, add 15 mL of fresh DMEM medium and continue culturing for 48 hours to obtain transfected cells.

[0058] (4) Virus collection: Pipette the cell supernatant of the transfected cells into a 50 mL centrifuge tube and centrifuge at 4°C 4500 g for 5 min. Filter the cell supernatant through a 0.45 μm filter and transfer it to a new centrifuge tube. Finally, transfer the filtrate in batches to a concentrator and centrifuge at 4°C 4500 g for 10 min. Discard the lower layer of liquid into a waste liquid cup containing disinfectant. Centrifuge for a final time at 4°C 4500 g for 20 min. The liquid in the upper layer of the filter is the virus concentrate.

[0059] (5) Titer determination: 293T anchorage-dependent epithelial cells in the logarithmic growth phase were digested with trypsin, inoculated into 96-well plates at 8,000 cells / well, and cultured overnight at 37°C. When the cell density reached 30-50%, the cells to be infected were obtained. The virus concentrate was diluted 10-fold using a cell culture medium containing 10% FBS. The required cell wells were selected, 90 μL of the culture medium was removed, and 90 μL of the mixed lentivirus dilution was added to each well of cells. The cells were placed in a cell culture incubator at 37°C for overnight culture. On the third day, the culture medium containing the lentivirus was removed and 100 μL of complete culture medium was added. On the fifth day, RT-PCR was performed to obtain a virus concentrate titer of 6.10×10 6 TU / mL. The specific dilution method is: No. 1 diluent: 10μL virus solution + 90μL virus dilution medium; No. 2 diluent: 10μL No. 1 diluent + 90μl virus dilution medium.

[0060] The RT-PCR titer measurement system and procedure are as follows: Components volume Ultrapure water 7.2μL 2×SYBR Mix 10μL WPRE-F (10 μM) 0.4μL WPRE-R (10 μM) 0.4μL template 2μL Overall system 20μL The primer sequences used in the RT-PCR assay are as follows: WPRE-F: CGCTATGTGGATACGCTGCTTTA; WPRE-R:GCAACCAGGATTTATACAAGGAGGA.

[0061] The construction of reporter cell lines involves the following steps: (1) Infection: The virus concentrate (the eukaryotic resistance of the viral plasmid vector corresponds to Puromycin) is calculated to be 1 mL according to the virus MOI = 150, and the virus dosage is infecting NFAT-Luc Reporter Jurkat CellLine cells in the logarithmic growth phase (the cells are resistant to Blasticidin). The mixture is transferred to a 24-well plate and centrifuged at 2100 rpm for 30 minutes. After centrifugation, the cell culture plate is placed in a 37°C, 5% CO2 incubator for overnight culture. During this period, the cell state is observed. If the state deteriorates significantly, the culture medium containing the lentiviral particles is promptly aspirated and replaced with a full amount of fresh culture medium; if the state is normal, the fluid is replenished to 1 mL of the full culture medium. After 4 days of culture, mixed Jurkat transfected cells are obtained.

[0062] (2) Screening: The mixed Jurkat transfected cells were subjected to at least two rounds of drug screening, each round lasting 2 days. The drug selected was 3.5 μg / mL Blasticidin + 0.75 μg / mL Puromycin. No large-scale cell death was observed under a microscope during the screening process, and the Jurkat transfected cells to be tested were obtained. At this time, the cells were stable, and after stabilization, RPMI 1640 + 10% FBS + 1% P.S + 3.5 μg / mL Blasticidin + 0.75 μg / mL Puromycin complete medium was used to maintain the cells.

[0063] (3) Verification: The Jurkat transfected cells to be tested are verified, and if the verification passes, a Jurkat stable transfected cell line is obtained.

[0064] Validation included flow cytometry validation, Jurkat transfected cell activation validation and antibody blocking validation.

[0065] Streaming verification includes the following steps: (1) Before verification, it is necessary to wait for the growth rate of the Jurkat transfected cells to stabilize, which takes about 3-5 days.

[0066] (2) On the day of verification, trypsinize the Jurkat transfected cells to be tested and take 100 μL of cell suspension (adjust the concentration to 2×10 with PBS after counting the cells). 6 cells / mL), added an appropriate amount of surface antibody Anti-CD200R hIgG4Antibody, and incubated at 4°C in the dark for 1 h.

[0067] Among them, the above-mentioned Anti-CD200R hIgG4 Antibody was provided by Jiman Biotechnology (Shanghai) Co., Ltd.

[0068] (3) Add 1-2 mL of PBS to rinse and repeat this step.

[0069] (4) Add fluorescently labeled secondary antibody Goat anti-Human IgG-Fc Fragment Cross-Adsorbed Antibody HRP Conjugated and incubate at 4°C in the dark for 30 min.

[0070] Among them, the above-mentioned Goat anti-Human IgG-Fc Fragment Cross-Adsorbed Antibody HRPConjugated antibody is provided by BETHYL, with the product number A80-304P.

[0071] (5) Centrifuge at 1000 rpm for 5 min, remove the supernatant, and resuspend in 300 μL PBS.

[0072] 1. Immediately test on the machine, test value (see Figure 4 ) showed color development, NFAT-Luc Reporter Jurkat Cell Line cells expressed CD200R1 gene, the infection was successful, and the Jurkat stable cell line was named H_CD200R1 ReporterJurkat Cell Line.

[0073] Jurkat transfected cell activation verification includes the following steps: The number of Jurkat transfected cells to be tested in this verification was 1×10 5 cells / well.

[0074] (1) H_CD200 CHO-K1 Cell Line cells were provided by Yoshiman Biotechnology (Shanghai) Co., Ltd. The cell concentration of the first well of H_CD200 CHO-K1 Cell Line was 1×10 7cells / mL, 3-fold gradient dilution, Conc.01-Conc.09 are arranged in B2-B10 respectively, and B11 is a 0 concentration control. 100 μL PBS is added to the surrounding wells to prevent evaporation of the side wells.

[0075] (2) 16-24 h before the experiment, digest and centrifuge the H_CD200 CHO-K1 Cell Line, resuspend the cells in an appropriate amount of complete medium, detect cell viability and count, and then adjust the cell density to 1×10 with complete medium. 7 cells / mL, 3-fold gradient dilution, take 100 μL cells / well with a pipette and add to the middle well according to the above table. Add 100 μL PBS to the surrounding wells. Cover the plate and incubate in the incubator overnight.

[0076] (3) 1-2 h before the experiment, collect the Jurkat transfected cells to be tested by centrifugation, resuspend the cells in Assay Buffer, calculate the cell density and viability, and adjust the cell concentration to 2×10 by adding Assay Buffer. 6 cells / mL.

[0077] (4) Take out the prepared Jurkat transfected cells to be tested, add 55 μL of cells (B2-B11) to the gradient dilution cell well plate, and incubate for 15 hours.

[0078] (5) Detect luciferase using the GMOne-Step Luciferase Reporter Gene Assay Kit (see Figure 5 ), the result is color development for detection. This indicates that Jurkat transfected cells can be used to activate Luciferase with H_CD200CHO-K1 Cell Line and detect fluorescent signals.

[0079] Antibody blocking validation includes the following steps: In this verification, the number of Jurkat transfected cells to be tested was 1×10 5 cells / well, the cell number of H_CD200 CHO-K1Cell Line cells was 1.5×10 4 cells / well.

[0080] 1. This experiment uses Anti-CD200R hIgG4 Antibody (hereinafter referred to as Anti-CD200R; molecular weight: 150kDa) as a positive antagonist. Anti-CD200R hIgG4 Antibody is provided by Jiman Biotechnology (Shanghai) Co., Ltd. The final concentration of the first well is 100μg / mL, 3-fold gradient dilution, Conc.01-Conc.09 are arranged in B2-B10, and B11 is a 0 concentration control. 100μL PBS is added to the surrounding wells to prevent evaporation of the side wells.

[0081] 2. 16-24 hours before the experiment, digest and centrifuge the H_CD200 CHO-K1 Cell Line, resuspend the cells in an appropriate amount of complete medium, detect cell viability and count, and then adjust the cell count to 1×10 7 cells / mL, 3-fold gradient dilution, take 100 μL cells / well with a pipette and add to the middle well according to the above table. Add 100 μL PBS to the surrounding wells. Cover the plate and incubate in the incubator overnight.

[0082] 3. 1-2 hours before the experiment, collect the Jurkat transfected cells to be tested by centrifugation, resuspend the cells with Assay Buffer, calculate the cell density and viability, and adjust the cell concentration to 2×10 6 cells / mL.

[0083] 4. Use a sterile 96-well V-bottom plate to prepare drug dilutions. Use one row (e.g., B2-B10) for each antibody to be tested. For an Anti-CD200R concentration of 2 mg / mL, add 8.25 μL of Anti-CD200R to B2, and then add 74.25 μL of Assay Buffer. Add 55 μL of Assay Buffer to B3-B10. Pipette 27.5 μL of liquid from the first gradient dilution well, B2, and add it to the second gradient dilution well, B3, and mix thoroughly. Repeat this process until the 9th gradient dilution well (B10).

[0084] 5. Take out the prepared Jurkat transfected cells to be tested, add 55 μL of cells (B2-B11) to the gradient diluted antibody well plate, and incubate for 1 hour.

[0085] 6. After 1 hour, take out the prepared H_CD200 CHO-K1 cell well plate, discard 90 μL of cells from each well, then add 100 μL / well of the incubated mixture into the cell well plate, cover the plate, and continue incubating in a 37°C CO2 incubator for 15 hours.

[0086] 7. Detect luciferase using the GMOne-Step Luciferase Reporter Gene Assay Kit (see Figure 6 ), and the result is color development. This indicates that after the Jurkat transfected cells to be detected are activated with H_CD200 CHO-K1Cell Line, the Anti-CD200R hIgG4 Antibody can be used to inhibit the fluorescence signal of Luciferase.

[0087] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed. However, as long as it is within the scope of the claims of the present application, it shall be protected by the patent law.

Claims

1. A CD200R1 reporter gene recombinant vector, characterized in that: It is composed of the target gene fragment and a blank vector plasmid; The target gene fragment is composed of the nucleotide sequences of H_CD200R1 (p.1to243), CD28TM and CD3ζ (Cyt); The nucleotide sequence of H_CD200R1 (p.1to243) is shown in SEQ ID NO.1; The nucleotide sequence of the CD28TM is shown in SEQ ID NO.2; The nucleotide sequence of the CD3ζ (Cyt) is shown in SEQ ID NO.

3.

2. The method for preparing the CD200R1 reporter gene recombinant vector according to claim 1, characterized in that: The following steps are involved: Amplify blank vector fragments, amplify target gene fragments, connect blank vector fragments and target gene fragments, connect plasmid transformation screening, and identify connected plasmids; The amplification of the blank vector fragment comprises the following steps: Amplifying the plasmid: culturing the bacterial solution containing the blank vector plasmid overnight and extracting it to obtain the target plasmid; Double digestion: The target plasmid is double digested with two restriction endonucleases, XbaI and BamHI, to obtain digestion products; Separating the blank vector fragment: subjecting the enzyme cleavage product to agarose gel electrophoresis, and then separating the gel strip containing the blank vector fragment and incubating it to obtain a blank vector fragment gel solution; Recovery of blank vector fragments: centrifuging and drying the blank vector fragment gel solution, adding ddH2O, and obtaining a blank vector fragment solution; The amplification of the target gene fragment comprises the following steps: PCR amplification: PCR amplify the target gene fragment to obtain PCR products; Isolating the target gene fragment: performing agarose gel electrophoresis on the PCR product, and then separating the gel strip containing the target gene fragment and incubating it to obtain a gel solution of the target gene fragment; Recovery of target gene fragments: centrifuging and drying the target gene fragment gel solution, adding ddH2O, and obtaining a target gene fragment solution; The method of connecting the blank vector fragment and the target gene fragment comprises the following steps: connecting the blank vector fragment solution and the target gene fragment solution under the Hieff CloneTM recombination reaction system to obtain a connection plasmid; The ligated plasmid transformation screening comprises the following steps: Transformation: transforming the ligated plasmid into competent cells to obtain cells to be screened; Initial culture: the cells to be screened are initially cultured in a SOC medium without antibiotics to obtain an initial culture solution; Resistance screening: adding the primary culture solution to a SOC medium plate containing antibiotics for overnight culture to obtain colonies to be tested, wherein the antibiotics are the antibiotics to which the blank vector plasmid is resistant; Sequencing verification: the colony to be tested is cultured overnight and then extracted to obtain the plasmid to be tested; the plasmid to be tested is sequenced to determine the CD200R1 reporter gene recombinant vector.

3. The method for preparing the CD200R1 reporter gene recombinant vector according to claim 2, characterized in that: In the PCR amplification step, the amplification primers are as follows: F:TCGAAGTATACCTCGAGTCTAGAGCCAC; R: GCGATCGCAGATCCTTGGATCCTTAGCGAGGGGGCAGGG.

4. The method for preparing the CD200R1 reporter gene recombinant vector according to claim 2, characterized in that: In the sequencing verification step, the sequencing primer sequences are as follows: PEF-F: TCAAGCCTCAGACAGTGGTTC; Specific primers: CCTGCAAGTGCTGGTGACC; PGK-R:CTACACAAGTGGCCTCTGGC.

5. A method for preparing a Jurkat stable cell line, characterized in that: The following steps are involved: Virus packaging and construction of reporter cell lines; The virus packaging comprises the following steps: Cell passaging: Culture 293T anchorage-dependent epithelial cells. When the cell density reaches 70-80%, replace the culture medium with new one to obtain the cells to be transfected. Mixing plasmid: mixing the CD200R1 reporter gene recombinant vector described in claim 1, DMEM culture medium, Lenti-HG Mix and HG transgene reagent to obtain a mixed plasmid; Transfection: adding the mixed plasmid to the cells to be transfected and culturing them to obtain transfected cells; Virus collection: the transfected cells are concentrated by centrifugation to obtain a virus concentrate; Titer determination: 293T anchorage-dependent epithelial cells in the logarithmic growth phase are cultured overnight, and when the cell density reaches 30-50%, cells to be infected are obtained; the virus concentrate is graded diluted, added to the cells to be infected for culture, and then RT-PCR is performed to obtain the titer of the virus concentrate; The construction of the reporter gene cell line comprises the following steps: Infection: infecting NFAT-Luc Reporter Jurkat Cell Line cells in the logarithmic growth phase with the virus concentrate, and then culturing to obtain mixed Jurkat transfected cells; Screening: subjecting the mixed Jurkat transfected cells to at least two rounds of drug screening to obtain Jurkat transfected cells to be tested; Verification: The Jurkat transfected cells to be tested are verified, and if the verification passes, a Jurkat stable transfected cell line is obtained.

6. The method for preparing a Jurkat stably transfected cell line according to claim 5, characterized in that: In the titer determination step, the primer sequences used in the RT-PCR determination are as follows: WPRE-F: CGCTATGTGGATACGCTGCTTTA; WPRE-R:GCAACCAGGATTTATACAAGGAGGA.

7. The method for preparing a Jurkat stably transfected cell line according to claim 5, characterized in that: In the step of verification, the verification includes at least one of flow cytometry verification, Jurkat transfection cell activation verification and antibody blocking verification.

8. The method for preparing a Jurkat stably transfected cell line according to claim 5, characterized in that: In the step of mixing the plasmid, 10 μg of the CD200R1 reporter gene recombinant vector according to claim 1, 1 mL of DMEM culture medium, 10 μL of Lenti-HG Mix and 60 μL of HG transgene reagent are mixed.

9. A Jurkat stable cell line, characterized in that: The Jurkat stably transfected cell line is prepared by the preparation method of any one of claims 5 to 8.

10. A use of a Jurkat stable cell line, characterized in that: The use of the Jurkat stably transfected cell line as claimed in claim 9 in studying the interaction between CD200 and CD200R1 in vitro, immunizing animals to prepare antibodies or screening antibodies in vitro.

Images