Primer for identifying tilapia mossambica as well as detection kit and application thereof

Abstract

The invention provides a primer for identifying tilapia mossambica as well as a detection kit and application thereof, and belongs to the technical field of molecular biology. The invention provides a primer for identifying the variety of tilapia mossambica, which can be used for quickly, efficiently and accurately identifying Oreochromis niloticus, Oreochromis aurea and Oreochromis spp., so that a scientific basis is provided for germplasm resource protection and variety identification of the tilapia mossambica.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a primer for identifying tilapia, a detection kit and an application thereof. Background Art

[0002] Tilapia (Tilapias) belongs to the phylum Chordata, subphylum Vertebrata, class Actinopterygii, subclass Actinopterygii, suborder Wrasse, family Cichlidae, genus Oreochromis spp., and is widely distributed in tropical and subtropical low-latitude areas. It is a group of euryhaline tropical fish native to the African continent. It likes high temperatures, tolerates low oxygen and high salt, and can live in both seawater and freshwater. It has a mixed diet, and adult fish like to eat plankton and benthic organisms. It has a strong ability to grab food and grows rapidly. There are more than 600 known species of tilapia in the world, and the Food and Agriculture Organization of the United Nations recommends that it be introduced to more than 100 countries and regions for aquaculture to improve protein supply. It has now become one of the most important non-native populations for breeding in China, especially in tropical and subtropical areas in southern China. The tilapias raised in China include Tilapia chinensis, Nile tilapia, Mozambique tilapia, yellow-lipped black tilapia, Aurelia tilapia, Oni tilapia, and red tilapia. Due to the large number of tilapia varieties, the existing tilapia germplasm resources or population identification still mainly uses traditional assessment methods, which are more dependent on the experience of the identifier, and are slow to identify and are prone to low identification accuracy. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a primer for identifying tilapia, which has the characteristics of rapid, efficient and accurate identification of at least one of Nile tilapia (Oreochromis niloticus), Aureus tilapia (Oreochromis aureus) and red tilapia (Oreochromisspp.), and can be used for the protection of tilapia germplasm resources and variety identification.

[0004] The present invention provides a primer for identifying tilapia varieties, comprising a first primer and / or a second primer;

[0005] The first primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:8 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:9;

[0006] The second primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 20 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 21.

[0007] The invention provides a kit for identifying tilapia varieties, comprising the primers.

[0008] Preferably, it includes a PCR amplification reaction premix and / or a positive standard.

[0009] Preferably, the positive standard comprises a recombinant plasmid comprising the first DNA fragment and / or a recombinant plasmid comprising the second DNA fragment;

[0010] The nucleotide sequence of the first DNA fragment is shown in SEQ ID NO:22;

[0011] The nucleotide sequence of the second DNA fragment is shown in SEQ ID NO:23.

[0012] The invention provides application of the primer or the kit in identifying tilapia varieties, wherein the tilapia comprises at least one of the following: Nile tilapia (Oreochromis niloticus), Oreochromisaureus and red tilapia (Oreochromis spp.).

[0013] The present invention provides a method for identifying tilapia varieties, comprising the following steps:

[0014] Using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primers to obtain a PCR product;

[0015] According to the fragment length of the PCR product, the species of tilapia from which the sample to be tested comes is determined:

[0016] When the first primer is used for identification, if a PCR product of 762 bp in length and a PCR product of 1088 bp in length are obtained, the sample to be tested is derived from Nile tilapia;

[0017] When the second primer is used for identification, only a PCR product of 762 bp in length is obtained, and when the first primer is used for identification, if a PCR product of 332 bp in length is obtained, the sample to be tested is derived from red tilapia;

[0018] When identification was based on the second primer, only one PCR product of 762 bp in length was obtained, and when identification was based on the first primer, one PCR product of 332 bp in length and one PCR product of 302 bp in length were obtained. The sample to be tested originated from Oreochromis aureus.

[0019] Preferably, the reaction volume of the PCR amplification is 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 0.5 μl 10 μM forward and reverse primers, and 1 μl 50 ng / μl DNA template.

[0020] Preferably, the reaction procedure of the PCR amplification is: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; and extension at 72°C for 5 min.

[0021] The invention provides a primer for amplifying and identifying tilapia varieties, which can detect at least one variety of Nile tilapia, Aurelian tilapia and red tilapia, has the characteristics of rapid, high efficiency and accurate identification, and can be used for the protection of tilapia germplasm resources and variety identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the fingerprint map of the core SNP loci;

[0023] Figure 2 It is the fingerprint map of 7 SNP sites;

[0024] Figure 3 The results of preliminary identification of 7 pairs of SNP markers in Nile tilapia (ON), Aurelian tilapia (OA) and red tilapia (OS);

[0025] Figure 4 Figure 1 shows the results of identifying Nile tilapia (ON), Oreochromis aureus (OA) and Red tilapia (OS) for marker SNP6;

[0026] Figure 5 Results of identifying Nile tilapia (ON), Oreochromis aureus (OA) and red tilapia (OS) for marker SNP7;

[0027] Figure 6 Figure 1. Identification results of Aurelian tilapia (OA) and red tilapia (OS) for marker SNP1. DETAILED DESCRIPTION

[0028] The invention provides a primer for identifying tilapia varieties, comprising a first primer and / or a second primer; the first primer comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:8 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:9; the second primer comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:20 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:21.

[0029] The present invention does not impose any special restrictions on the source of the primers, and the gene synthesis method known in the art can be used. In the embodiment of the present invention, the primers were commissioned to be synthesized by Yixin Biotechnology (Shanghai) Co., Ltd.

[0030] The invention provides a kit for identifying tilapia varieties, comprising the primers.

[0031] In the present invention, it is preferred to include a PCR amplification reaction premix and / or a positive standard. The PCR amplification reaction premix is ​​preferably Premix Ex Taq. It is purchased from Takara Biotechnology Co., Ltd. The positive standard preferably includes a recombinant plasmid containing the first DNA fragment and / or a recombinant plasmid containing the second DNA fragment. The nucleotide sequence of the first DNA fragment is as shown in SEQ ID NO: 22

[0032] (Shown as (AGGGATTCAAACACGGACAGCACTACTGGGAACTGGAGGTGTCCAAGC CTTGGGCCTACCTCGGGGTAAGGATATCATAATGCTGTGTACACTGTGGCTTTGTGACACATCGCTTTGTAGCAGGTCGCTAATGGGGACATTCTGGGTCTTGCCTAGTAAATCGTTACATGGACCTGCTCAATAGTAGATCTACTCTGATGTGTCTAATCAGTCGAGAATGTTTCAACAGATTTTCCTAAAGTGTTATACAGGGATTCATTGTTCCCACAGAGATGGCCACAGCATGCTAATGTTTCC[C / T]TTGTTCTGCGTATCCTCCTCTCCAG));The nucleotide sequence of the second DNA fragment is shown in SEQ ID NO: 23 (GGTCAACACATCAGTCCACGCTTTCTTTATCCTGAT, wherein R is G / A). ;

[0033] The invention provides application of the primer or the kit in identifying tilapia varieties, wherein the tilapia comprises at least one of the following: Nile tilapia (Oreochromis niloticus), Oreochromisaureus and red tilapia (Oreochromis spp.).

[0034] In the present invention, in the application, preferably, the second primer is used to distinguish only Nile tilapia from Oreochromis aureus or red tilapia, and the second primer is used to perform PCR amplification, and Nile tilapia is identified according to the length of the PCR product fragment. On the basis of the second primer, the first primer is used to perform PCR amplification, and red tilapia and Oreochromis aureus can be distinguished according to the length of the PCR product fragment.

[0035] The present invention provides a method for identifying tilapia varieties, comprising the following steps:

[0036] Using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primers to obtain a PCR product;

[0037] According to the fragment length of the PCR product, the species of tilapia from which the sample to be tested comes is determined:

[0038] When the second primer is used for identification, if a PCR product of 762 bp and a PCR product of 1088 bp are obtained, the sample to be tested is derived from Nile tilapia;

[0039] When the second primer is used for identification, only a PCR product of 762 bp in length is obtained, and when the first primer is used for identification, if a PCR product of 332 bp in length is obtained, the sample to be tested is derived from red tilapia;

[0040] When identification was based on the second primer, only one PCR product of 762 bp in length was obtained, and when identification was based on the first primer, one PCR product of 332 bp in length and one PCR product of 302 bp in length were obtained. The sample to be tested originated from Oreochromis aureus.

[0041] The present invention uses the genomic DNA of the sample to be tested as a template and uses the primers to perform PCR amplification to obtain a PCR product.

[0042] The present invention has no particular restrictions on the method for extracting genomic DNA from the sample to be tested, and a DNA extraction method known in the art can be used. In an embodiment of the present invention, a genomic DNA extraction kit is used to extract the genomic DNA from the sample to be tested. The type of the sample to be tested preferably includes at least one of the following: tilapia visceral tissue, body fluid, tilapia meat and tilapia fins.

[0043] In the present invention, the reaction volume of the PCR amplification is preferably 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 0.5 μl forward and reverse primers (10 μM), and 1 μl DNA template (50 ng / μl). The reaction procedure of the PCR amplification is preferably: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, and 72°C for 50 s, for 35 cycles; and 72°C for 5 min extension.

[0044] In the present invention, the fragment length of the PCR product is preferably obtained by electrophoresis detection or by sequencing. The electrophoresis detection preferably includes detection by 1% agarose gel electrophoresis.

[0045] In the embodiment of the present invention, the second primer obtains a specific band of 762bp in length when amplifying Aureus tilapia and red tilapia. In Nile tilapia, in addition to a specific band of 762bp in length, there is also a specific band of 1088bp in length. The second primer can accurately distinguish Nile tilapia from Aureus tilapia or red tilapia. After accurately distinguishing the difference band of Nile tilapia, the first primer obtains a specific band of 332bp in length in red tilapia. In Aureus tilapia, in addition to a specific band of 332bp in length, a 302bp specific band is also amplified. The first primer can accurately distinguish Aureus tilapia from red tilapia.

[0046] The primers for identifying tilapia and the detection kit and application thereof provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] The construction and application of a DNA fingerprint of tilapia developed based on SNP markers comprises the following steps:

[0049] (1) Fifteen tail fin samples of Nile tilapia, Oreochromis aureus, and red tilapia were collected, DNA was extracted, and resequencing was performed;

[0050] (2) Perform quality control on the test data and obtain the SNP sites of the samples using the UnifiedGenotyper program;

[0051] (3) To ensure the reliability of SNP loci, preliminary filtering was performed according to the SNP hard filtering criteria to obtain SNP loci that could completely separate all samples. The filtering conditions were as follows: Fisher test of strand bias (FS) ≤ 60; Haplotype Score ≤ 13.0; Mapping Quality (MQ) ≥ 40; Quality Depth (QD) ≥ 2; ReeadPosRankSum ≥ -8.0; MQRankSum> -12.5;

[0052] (4) Plink software was used to further screen the SNP loci and select the core SNP loci. The screening conditions were as follows: only retain the loci on NC_031965.2-NC_031987.2 (except NC_031968.2); select the loci with minimum gene frequency (MAF)>0.2; select the loci with heterozygosity (het)<0.05; select the loci with missing rate (geno)<0.2; remove the intergenic SNP loci according to the SNP annotation information; use beagle (v5.1) software for genotype filling; select the loci with minimum gene frequency (MAF)>0.3; select the loci with heterozygosity (het)<0.01; select the linkage disequilibrium (LD) r 2 <0.2, the following 105 core SNP loci information was obtained, see Table 1 for details.

[0053] Table 1 Core SNP locus information

[0054]

[0055]

[0056]

[0057]

[0058] (5) Use the matplotlib graphics library of Python 3 software to draw the corresponding fingerprint map of the screened SNP sites, such as Figure 1 .

[0059] (6) Plink software was used to calculate the genetic distance between samples, and SNP sites with higher polymorphism were screened and streamlined from the core SNP sites for identification of tilapia varieties in production. The screening conditions were as follows: only sites on NC_031965.2-NC_031987.2 (except NC_031968.2) were retained; sites with minimum gene frequency (MAF)>0.2 were screened; sites with heterozygosity (het)<0.05 were screened; sites with missing rate (geno)<0.1 were screened; based on SNP annotation information, intergenic SNP sites were removed; beagle (v5.1) software was used for genotype filling; sites with minimum gene frequency (MAF)>0.3 were screened; sites with heterozygosity (het)<0.01 were screened; linkage disequilibrium (LD) r 2 <0.2, the following 7 SNP locus information were obtained, see Tables 2 and 3.

[0060] Table 2 Information of 7 SNP loci

[0061] SNP number chromosome Location Allele A Allele B SNP1 Chr7 25,098,070 C T SNP2 Chr12 17,644,090 G A SNP3 Chr12 27,379,890 C T SNP4 Chr13 10,766,350 C G SNP5 Chr15 23,219,247 G A SNP6 Chr20 29,863,952 T C SNP7 Chr12 40,005,392 G A

[0062] Table 3 Information of 7 SNP molecular markers

[0063]

[0064]

[0065]

[0066]

[0067] (7) Use the matplotlib graphics library of phtyon3 to plot the corresponding fingerprint of the screened SNPs (see Figure 2 ).

[0068] Example 2

[0069] The specific steps for verification of specific SNP markers are as follows:

[0070] (1) Design of 7 pairs of SNP marker-specific primers.

[0071] The 400 bp gene sequence upstream and downstream of the SNP marker was extracted, and the primers were designed for the extracted sequence using Primer 6.0 software. The DNA fragments of the 7 SNP markers and the positions of the SNP sites in the DNA fragments and the primer sequences are shown in Table 4:

[0072] Table 4 Amplification primer sequences of 7 SNP molecular markers

[0073]

[0074] (2) Verification of sample collection. 30 live samples of Nile tilapia, Oreochromis aureus and red tilapia were collected, and about 0.5 g of tail fin was cut from each sample and quickly frozen in liquid nitrogen, and then promptly transferred to a -80°C refrigerator for storage. Genomic DNA was extracted from the tail fin samples using a genomic DNA extraction kit. The quality of DNA extraction was tested by 1% agarose gel electrophoresis, and DNA was quantified using an ultraviolet spectrophotometer.

[0075] (3) Screening and verification of SNP markers. Seven pairs of SNP marker primers were used to perform PCR amplification on the genomic DNA of Nile tilapia (ON), Oreochromis aureus (OA) and red tilapia (OS) samples. The amplification volume was 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 0.5 μl forward and reverse primers (10 μM), and 1 μl DNA template (50 ng). The amplification conditions were: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, and 72°C for 50 s, 35 cycles; 72°C for 5 min extension. The PCR products were detected by 1% agarose gel electrophoresis. Based on whether the PCR amplification products showed obvious difference bands in the three tilapia species, the SNP markers that could preliminarily identify the three tilapia species were screened. The results are as follows:

[0076] like Figure 3 As shown in A, marker SNP1 has two specific bands at 332bp and 488bp in Aurelia tilapia, red tilapia and Nile tilapia, and Aurelia tilapia also has a specific band at 302bp. Marker SNP1 can preliminarily identify the three tilapia species. Marker SNP2 has a specific band at 488bp in all three tilapia species, but cannot effectively distinguish the three tilapia species. Marker SNP3 has a specific band at 332bp in all three tilapia species, but cannot effectively distinguish the three tilapia species.

[0077] exist Figure 3 In Figure B, marker SNP5 and marker SNP4 have a specific band at 288 bp in all three tilapia species, and fail to effectively distinguish the three tilapia species. Marker SNP6 has a specific band of the same size at about 400 bp in Aurelia tilapia, red tilapia, and Nile tilapia, and marker SNP6 can preliminarily identify Aurelia tilapia / red tilapia and Nile tilapia.

[0078] exist Figure 3 In C, marker SNP7 has only one specific band at 762bp in both Aurelia tilapia and red tilapia, and another specific band at 1088bp in Nile tilapia. Marker SNP7 can be used to preliminarily identify Aurelia tilapia / red tilapia and Nile tilapia. Therefore, markers SNP1, SNP6 and SNP7 were selected for further verification in more Aurelia tilapia, red tilapia and Nile tilapia samples to ensure the accuracy of the three pairs of markers.

[0079] like Figure 4As shown, marker SNP6 has a specific band at the position of 405bp in all three tilapia species, and cannot accurately distinguish between Aurelia tilapia, red tilapia and Nile tilapia. Markers SNP1 and SNP7 were further verified.

[0080] like Figure 5 As shown, the marker SNP7 produced a specific band at the 762 bp position in both Aurelia tilapia and red tilapia ( Figure 5 In Nile tilapia, in addition to a 762 bp specific band, there is also a specific band at 1088 bp ( Figure 5 C), marker SNP7 can accurately distinguish Nile tilapia from Aurelia tilapia / red tilapia ( Figure 5 (middle D).

[0081] After accurately distinguishing the differential bands of Nile tilapia, Figure 6 As shown, marker SNP1 has a specific band at the 332 bp position in red tilapia ( Figure 6 In A), in addition to a 332 bp specific band, there is also a specific band at 302 bp in Oreochromis aureus ( Figure 6 B), and marker SNP1 can accurately distinguish Aurelia tilapia from red tilapia ( Figure 6 Middle C).

[0082] In summary, the combination of markers SNP7 and SNP1 can accurately and quickly distinguish Nile tilapia, Aurelia tilapia and red tilapia. At the same time, as long as a small amount of tail fins are selected as experimental samples, the damage to the fish body is small.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer for identifying tilapia species, characterized in that: comprising a first primer and / or a second primer; The first primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:8 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:9; The second primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 20 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:

21.

2. A kit for identifying tilapia species, characterized in that: Comprising the primer according to claim 1.

3. The kit according to claim 2, characterized in that: Includes PCR amplification reaction master mix and / or positive standard.

4. The kit according to claim 2, characterized in that: The positive standard comprises a recombinant plasmid comprising the first DNA fragment and / or a recombinant plasmid comprising the second DNA fragment; The nucleotide sequence of the first DNA fragment is shown in SEQ ID NO:22; The nucleotide sequence of the second DNA fragment is shown in SEQ ID NO:

23.

5. Use of the primer according to claim 1 or the kit according to any one of claims 2 to 4 in identifying tilapia species, wherein the tilapia comprises at least one of the following: Nile tilapia (Oreochromis niloticus), Aureus tilapia (Oreochromis aureus) and red tilapia (Oreochromis spp.).

6. A method for identifying tilapia species, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primers described in claim 1 to obtain a PCR product; According to the fragment length of the PCR product, the species of tilapia from which the sample to be tested comes is determined: When the first primer is used for identification, if a PCR product of 762 bp in length and a PCR product of 1088 bp in length are obtained, the sample to be tested is derived from Nile tilapia; When the second primer is used for identification, only a PCR product of 762 bp in length is obtained, and when the first primer is used for identification, if a PCR product of 332 bp in length is obtained, the sample to be tested is derived from red tilapia; When identification was based on the second primer, only one PCR product of 762 bp in length was obtained, and when identification was based on the first primer, one PCR product of 332 bp in length and one PCR product of 302 bp in length were obtained. The sample to be tested originated from Oreochromis aureus.

7. The method according to claim 6, characterized in that: The reaction volume of the PCR amplification was 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 0.5 μl 10 μM forward and reverse primers, and 1 μl 50 ng / μl DNA template.

8. The method according to claim 6, characterized in that: The reaction program of the PCR amplification is: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min extension.

Images