InDel labeled primer group and application thereof in variety and purity identification of 'THI-P-10*P5114'

Abstract

The invention relates to the field of pepper molecular markers, and discloses an InDel marker primer group and application thereof in 'THI-P-10 * P5114' variety and purity identification. Resequencing data of a female parent THI-P-10 and a male parent P5114 of a pepper variety 'THI-P-10 * P5114' are utilized to screen differential InDel loci in a whole genome range, specific primers are designed, and eight pairs of InDel labeled primers are obtained through screening. Based on a PCR (Polymerase Chain Reaction) amplification reaction, the purity identification of the pepper variety 'THI-P-10 * P5114' and hybrid seeds can be quickly and accurately completed within 2 hours by adopting the 8 pairs of InDel molecular marker primers. The method needs a small amount of samples to be detected, is short in period, simple to operate, high in identification accuracy, low in cost and high in repeatability and stability, solves the problems of long period, large labor investment, inaccurate identification and the like in identification of the purity of the variety or the seed of the pepper 'THI-P-10 * P5114', and has extremely high commercial application prospects.

Description

Technical Field

[0001] The invention relates to the field of pepper molecular markers, and in particular to an InDel marker primer set and an application thereof in THI-P-10×P5114 variety and purity identification. Background Art

[0002] Pepper belongs to the genus Capsicum in the Solanaceae family. It is an annual or limited perennial herb. It originated in tropical and subtropical regions of Central and South America and has very rich genetic resources. Pepper is not only nutritious and has very high edible value, but also has important medicinal value. It can be said that it is a medicine and food of the same origin and is deeply loved by people. Pepper is the largest vegetable crop in my country, with an annual planting area of ​​32 million mu and an output value of more than 250 billion yuan. The development of the pepper industry has become an effective way to increase agricultural efficiency and farmers' income in various parts of my country.

[0003] As the number of pepper varieties continues to increase, the genetic differences between pepper varieties are becoming smaller and smaller, making it difficult to distinguish them effectively. The traditional method of identifying the purity of pepper varieties or hybrid seeds is mainly through morphological markers. However, this method has many disadvantages such as large workload, long cycle, and unstable phenotypic observation. In addition, the morphological marker identification method has high requirements for identification personnel, requiring identification personnel to be very familiar with the phenotypic differences between the variety and its parents, and it is difficult to eliminate the influence of environmental and human factors. Therefore, it is necessary to establish a rapid identification method based on genotype.

[0004] With the development of sequencing technology and molecular biology, the application of molecular markers to identify varieties or variety purity is becoming more and more widespread. Insertion-Deletion Length Polymorphism (InDel) markers are length polymorphic variations caused by the insertion or deletion of a certain number of nucleotides at the allele locus, and belong to the third generation of molecular markers. InDel markers are abundant in number and genetically stable, and have been widely used in genetic linkage map construction, gene localization, and purity identification, overcoming the uncertainty of identifying new varieties based solely on morphological characteristics.

[0005] The pepper variety 'THI-P-10×P5114' is a high-yield, high-quality pepper hybrid variety bred by the Institute of Economic Crops of Hubei Academy of Agricultural Sciences. It is a medium-maturing variety with strong plant growth and strong fruiting ability. The fruit is long and horn-shaped, with straight pepper strips. The green fruit is dark green, the red fruit is bright red, the fruit surface is relatively smooth, with two ventricles, crisp flesh, and spicy taste. The fruit has a longitudinal diameter of 22 to 24 cm, a transverse diameter of 1.8 cm, and a flesh thickness of 0.15 cm. The single fruit weighs about 18 g, and the yield per mu is more than 3,000 kg.

[0006] 'THI-P-10×P5114' is a first-generation hybrid, which is obtained by crossing the female parent THI-P-10 flower with pollen from the male parent P5114 after the female parent THI-P-10 flower is emasculated. However, if the female parent THI-P-10 flower is not emasculated thoroughly or emasculation is omitted, false hybrids will be produced, which will seriously affect the purity of 'THI-P-10×P5114' seed production.

[0007] So far, there is no molecular marker and identification method suitable for the pepper variety 'THI-P-10×P5114'. The development of molecular identification markers suitable for the pepper variety 'THI-P-10×P5114' will be beneficial to ensuring the purity of pepper seed production, strengthening market supervision and enhancing intellectual property protection. Summary of the invention

[0008] The invention provides an InDel marker primer set and application thereof in THI-P-10×P5114 variety and purity identification, which effectively solves the problems existing in the authenticity or seed purity detection of the existing pepper variety 'THI-P-10×P5114'.

[0009] To achieve the above object, the present invention adopts the following technical solutions:

[0010] InDel marker primer set, the primer set consists of 8 pairs of primers, namely:

[0011] Primers for the molecular marker InDel-PepChr01-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2;

[0012] Primers for the molecular marker InDel-Chr04-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4;

[0013] Primers for the molecular marker InDel-PepChr04-4, the upstream primer nucleotide sequence is shown in SEQ ID NO.5, and the downstream primer nucleotide sequence is shown in SEQ ID NO.6;

[0014] Primers for the molecular marker InDel-Chr08-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8;

[0015] Primers for the molecular marker InDel-PepChr10-5, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10;

[0016] Primers for the molecular marker InDel-PepChr11-3, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12;

[0017] Primers for the molecular marker InDel-Chr12-2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.14;

[0018] The primers of the molecular marker InDel-Chr12-3, the upstream primer nucleotide sequence is shown in SEQ ID NO.15, and the downstream primer nucleotide sequence is shown in SEQ ID NO.16.

[0019] Application of InDel marker primer set in identifying the authenticity of pepper 'THI-P-10×P5114' variety.

[0020] Application of InDel-labeled primer set in identifying the purity of pepper 'THI-P-10×P5114' seeds.

[0021] The method for identifying the authenticity or seed purity of pepper 'THI-P-10×P5114' variety comprises the following steps:

[0022] (1) extracting genomic DNA from seed samples of pepper varieties to be tested;

[0023] (2) Using the extracted sample genomic DNA as a template, and using the above-mentioned 8 pairs of primers as forward and reverse primers to establish a PCR amplification system and perform PCR amplification respectively;

[0024] (3) Detecting the amplified product by agarose gel electrophoresis;

[0025] (4) If the banding pattern of each of the eight amplification products simultaneously has the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is the pepper hybrid 'THI-P-10×P5114'; if the banding pattern of any of the eight amplification products does not simultaneously have the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is not the pepper hybrid 'THI-P-10×P5114';

[0026] (5) Calculate seed purity according to the seed purity formula.

[0027] As a preferred embodiment of the above scheme, in step (1), when identifying the authenticity of the pepper variety 'THI-P-10×P5114', the genomic DNA of the seed sample of the pepper variety of similar type to be tested is extracted; when identifying the purity of the pepper 'THI-P-10×P5114' seeds, the genomic DNA of the seed sample of the pepper 'THI-P-10×P5114' variety to be tested is extracted.

[0028] As a preferred embodiment of the above scheme, in step (1), the genomic DNA of the pepper seeds to be tested is extracted using a modified CTAB method.

[0029] As a preferred embodiment of the above scheme, in step (2), the PCR amplification system is: 2×Magic Green TaqSuperMix 5 μL, 10 μM forward primer and reverse primer 1.0 μL each, DNA template 10 ng-100 ng, add ddH2O to 10 μL;

[0030] The PCR amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 52°C for 15 s, 72°C for 35 s, 35 cycles; 72°C for 10 min.

[0031] As a preferred embodiment of the above scheme, in step (3), the electrophoresis detection comprises: using 3% agarose electrophoresis gel, at a constant voltage of 150V / cM, performing 3% agarose gel electrophoresis for 35 minutes, and then photographing using a gel imaging system.

[0032] As a preferred embodiment of the above scheme, in step (4), the molecular marker InDel-PepChr01-1 amplifies one characteristic band in the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114', and the band sizes are 146 bp and 180 bp respectively. The variety 'THI-P-10×P5114' has two characteristic bands of both the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114'; the molecular marker InDel-Chr04-1 amplifies one characteristic band in each of the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114'. One characteristic band was amplified from each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', and the band sizes were 172 bp and 141 bp, respectively. The variety 'THI-P-10×P5114' had two characteristic bands from both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-PepChr04-4 amplified one characteristic band from each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The band sizes were 141bp and 172bp respectively. The variety 'THI-P-10×P5114' had two characteristic bands in both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The band sizes were 174bp and 151bp respectively. The variety 'THI-P-10×P5114' had two characteristic bands in both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114'. ×P5114' female parent THI-P-10 and 'THI-P-10×P5114' male parent P5114; the molecular marker InDel-PepChr10-5 amplified one characteristic band in each of 'THI-P-10×P5114' female parent THI-P-10 and 'THI-P-10×P5114' male parent P5114, with band sizes of 120bp and 154bp, respectively. 'THI-P-10×P5114' variety has both the two characteristic bands of 'THI-P-10×P5114' female parent THI-P-10 and 'THI-P-10×P5114' male parent P5114;The molecular marker InDel-PepChr11-3 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 140 bp and 177 bp, respectively. The variety 'THI-P-10×P5114' has two characteristic bands from both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr12-2 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 1 44bp and 166bp, the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114; the molecular marker InDel-Chr12-3 amplified one characteristic band in each of the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, and the band sizes were 181bp and 153bp, respectively, and the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114. ;

[0033] As a preferred embodiment of the above scheme, in step (5), seed purity = number of detected 8 amplification products having both the banding patterns of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114' / total number of detected seeds×100%.

[0034] Due to the above structure, the beneficial effects of the present invention are:

[0035] 1. The present invention uses the resequencing data of the maternal parent THI-P-10 and the paternal parent P5114 of the pepper variety 'THI-P-10×P5114' to screen differential InDel sites in the whole genome and design specific primers, with high accuracy and stable and reliable results;

[0036] 2. The present invention utilizes agarose gel electrophoresis for detection, which has the advantages of simple operation, fast speed, low cost and high safety compared with polyacrylamide gel electrophoresis;

[0037] 3. The present invention is based on PCR amplification reaction and uses InDel molecular markers at 8 sites to quickly and accurately complete the authenticity identification of the pepper variety 'THI-P-10×P5114' or the hybrid seed purity identification in a short time. The method is simple and fast, the detection cycle is short, and the cost is saved, and it has a good application and promotion prospect. The use of InDel molecular markers at the 8 sites can facilitate standardized, large-scale, and rapid identification of the authenticity or seed purity of the pepper variety 'THI-P-10×P5114'. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for describing the embodiments are briefly introduced below.

[0039] Figure 1 It is the agarose gel electrophoresis diagram of the PCR amplification products of 8 pairs of primer pairs of pepper variety 'THI-P-10×P5114' female parent THI-P-10, pepper variety 'THI-P-10×P5114' male parent P5114, and pepper variety 'THI-P-10×P5114'; M in the figure is Marker, and lanes 1, 2, and 3 in the figure are mixed samples of 5 seeds of pepper variety 'THI-P-10×P5114' female parent THI-P-10, pepper variety 'THI-P-10×P5114' male parent P5114, and pepper variety 'THI-P-10×P5114' respectively;

[0040] Figure 2The electrophoresis diagram of the pepper variety 'THI-P-10×P5114' detected using primers InDel-PepChr01-1, InDel-Chr04-1, InDel-PepChr04-4, InDel-Chr08-1, InDel-PepChr10-5, InDel-PepChr11-3, InDel-Chr12-2 and InDel-Chr12-3; M in the figure is Marker, and lanes 01-19 are the female parent THI-P-10 of 'THI-P-10×P5114', the male parent P 5114, 'THI-P-10×P5114' varieties, the female parent THI-P-10 of the pepper hybrid 'THI-P-10×P5114B', the male parent TP023-PM-1 of the pepper hybrid 'THI-P-10×P5114B', the pepper hybrid 'THI-P-10×P5114B', '8819 Pepper A', 'Er Jin Tiao', 'Zhai Bubai Green Pepper', 'Xiang La Er Jin Tiao', 'Hong Tian Xia· Pepper F1', 'Xiang La Liu Hao', 'Spicy Princess No. 1', '8819 Pepper B', 'Hao Ji Chang Xian', 'Hei Long Green Pepper', 'Shen He Spicy Pepper', 'Pepper Xiang Chu Mo Jin', 'Chuan Jiao No. 19' samples;

[0041] Figure 3 Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-PepChr01-1; M in the figure is Marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0042] Figure 4 Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-Chr04-1; in the figure, M is a marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0043] Figure 5Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-PepChr04-4; M in the figure is Marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0044] Figure 6 Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-Chr08-1; in the figure, M is a marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0045] Figure 7 Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-PepChr10-5; in the figure, M is Marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0046] Figure 8 Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-PepChr11-3; in the figure, M is a marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0047] Fig. 9 Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-Chr12-2; M in the figure is Marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested;

[0048] Fig.10Partial electrophoresis diagrams of the seed purity of pepper variety 'THI-P-10×P5114' detected using primer InDel-Chr12-3; in the figure, M is Marker, lane 01 is the female parent THI-P-10 of pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested. DETAILED DESCRIPTION

[0049] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0050] The first aspect of the present invention provides an InDel marker primer set for identifying the authenticity or seed purity of the pepper variety 'THI-P-10×P5114'. The primer set consists of 8 pairs of primers, which are:

[0051] Primers for the molecular marker InDel-PepChr01-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2;

[0052] Primers for the molecular marker InDel-Chr04-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4;

[0053] Primers for the molecular marker InDel-PepChr04-4, the upstream primer nucleotide sequence is shown in SEQ ID NO.5, and the downstream primer nucleotide sequence is shown in SEQ ID NO.6;

[0054] Primers for the molecular marker InDel-Chr08-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8;

[0055] Primers for the molecular marker InDel-PepChr10-5, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10;

[0056] The primers of the molecular marker InDel-PepChr11-3, the upstream primer nucleotide sequence is shown in SEQ ID NO.11, and the downstream primer nucleotide sequence is shown in SEQ ID NO.12.

[0057] The primers of the molecular marker InDel-Chr12-2, the upstream primer nucleotide sequence is shown in SEQ ID NO.13, and the downstream primer nucleotide sequence is shown in SEQ ID NO.14.

[0058] The primers of the molecular marker InDel-Chr12-3, the upstream primer nucleotide sequence is shown in SEQ ID NO.15, and the downstream primer nucleotide sequence is shown in SEQ ID NO.16.

[0059] The second aspect of the present invention provides an application of the above-mentioned InDel marker primer pair group in authenticity identification of pepper hybrid 'THI-P-10×P5114' variety, the identification method comprising:

[0060] (1) extracting genomic DNA from seed samples of similar pepper varieties to be tested;

[0061] (2) Using the extracted sample genomic DNA as a template, and using the above-mentioned 8 pairs of primers as forward and reverse primers to establish a PCR amplification system and perform PCR amplification respectively;

[0062] (3) Detecting the amplified product by agarose gel electrophoresis;

[0063] (4) If the banding pattern of each of the eight amplification products simultaneously has the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is the pepper hybrid 'THI-P-10×P5114'; if the banding pattern of any of the eight amplification products does not simultaneously have the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is not the pepper hybrid 'THI-P-10×P5114'.

[0064] In step (1), the genomic DNA of the pepper seeds to be tested is extracted using the modified CTAB method.

[0065] In step (2), the PCR amplification system is: 5 μL of 2×Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTP and optimized buffer system), 1.0 μL of 10 μM forward primer and reverse primer, 10 ng-100 ng of DNA template, and ddH2O to 10 μL; the PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 52°C for 15 s, 72°C for 35 s, 35 cycles; 72°C for 10 min.

[0066] In step (3), the electrophoresis detection: using 3% agarose electrophoresis gel, at a constant voltage of 150V / cM, after 3% agarose gel electrophoresis for 35 minutes, photographing with a gel imaging system;

[0067] In step (4), the molecular marker InDel-PepChr01-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', and the band sizes were 146 bp and 180 bp, respectively. The variety 'THI-P-10×P5114' had two characteristic bands of both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'; the molecular marker InDel-Chr04-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, and the band sizes were 146 bp and 180 bp, respectively. One characteristic band was amplified in I-P-10 and the male parent P5114 of 'THI-P-10×P5114', with the band sizes of 172bp and 141bp respectively. The variety 'THI-P-10×P5114' had two characteristic bands of both the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-PepChr04-4 amplified one characteristic band in the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114', with the band sizes of 172bp and 141bp respectively. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of THI-P-10 and the paternal parent P5114 of THI-P-10×P5114, with the band sizes of 174bp and 151bp respectively. The variety THI-P-10×P5114 also has two characteristic bands in the maternal parent THI-P-10 of THI-P-10×P5114 and the paternal parent P5114 of THI-P-10×P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of THI-P-10×P5114 and the paternal parent P5114, with the band sizes of 174bp and 151bp respectively. The variety THI-P-10×P5114 also has two characteristic bands in the maternal parent THI-P-10 of THI-P-10×P5114. The molecular marker InDel-PepChr10-5 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', with the band sizes of 120bp and 154bp respectively. The variety 'THI-P-10×P5114' also has two characteristic bands in the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'.The molecular marker InDel-PepChr11-3 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 140 bp and 177 bp, respectively. The variety 'THI-P-10×P5114' has two characteristic bands from both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr12-2 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 1 44bp and 166bp, the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114; the molecular marker InDel-Chr12-3 amplified one characteristic band in each of the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, and the band sizes were 181bp and 153bp, respectively, and the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114. ;

[0068] The third aspect of the present invention provides an application of the InDel-based marker primer pair group to the identification of the purity of pepper hybrid 'THI-P-10×P5114' seeds, the identification method comprising:

[0069] (1) Extracting genomic DNA from the seed samples of pepper 'THI-P-10×P5114' variety to be tested;

[0070] (2) Using the extracted sample genomic DNA as a template, and using the above-mentioned 8 pairs of primers as forward and reverse primers to establish a PCR amplification system and perform PCR amplification respectively;

[0071] (3) Detecting the amplified product by agarose gel electrophoresis;

[0072] (4) If the banding pattern of each of the eight amplification products simultaneously has the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is the pepper hybrid 'THI-P-10×P5114'; if the banding pattern of any of the eight amplification products does not simultaneously have the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is not the pepper hybrid 'THI-P-10×P5114';

[0073] (5) Seed purity = the number of eight amplification products detected that have both the banding patterns of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114' / the total number of seeds detected×100%.

[0074] In step (1), the genomic DNA of the pepper seeds to be tested is extracted using the modified CTAB method.

[0075] The PCR amplification system described in step (2) is: 5 μL of 2×Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTP and optimized buffer system), 1.0 μL of 10 μM forward primer and reverse primer, 10 ng-100 ng of DNA template, and ddH2O to 10 μL; the PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 52°C for 15 s, 72°C for 35 s, 35 cycles; 72°C for 10 min.

[0076] The electrophoresis detection in step (3) is as follows: using 3% agarose gel electrophoresis, at a constant voltage of 150 V / cM, after 35 minutes of 3% agarose gel electrophoresis, and then photographing using a gel imaging system;

[0077] In step (4), the molecular marker InDel-PepChr01-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', and the band sizes were 146 bp and 180 bp, respectively. The variety 'THI-P-10×P5114' had two characteristic bands of both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'; the molecular marker InDel-Chr04-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, and the band sizes were 146 bp and 180 bp, respectively. One characteristic band was amplified in I-P-10 and the male parent P5114 of 'THI-P-10×P5114', with the band sizes of 172bp and 141bp respectively. The variety 'THI-P-10×P5114' had two characteristic bands of both the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-PepChr04-4 amplified one characteristic band in the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114', with the band sizes of 172bp and 141bp respectively. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of THI-P-10 and the paternal parent P5114 of THI-P-10×P5114, with the band sizes of 174bp and 151bp respectively. The variety THI-P-10×P5114 also has two characteristic bands in the maternal parent THI-P-10 of THI-P-10×P5114 and the paternal parent P5114 of THI-P-10×P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of THI-P-10×P5114 and the paternal parent P5114, with the band sizes of 174bp and 151bp respectively. The variety THI-P-10×P5114 also has two characteristic bands in the maternal parent THI-P-10 of THI-P-10×P5114. The molecular marker InDel-PepChr10-5 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', with the band sizes of 120bp and 154bp respectively. The variety 'THI-P-10×P5114' also has two characteristic bands in the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'.The molecular marker InDel-PepChr11-3 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 140 bp and 177 bp, respectively. The variety 'THI-P-10×P5114' has two characteristic bands from both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr12-2 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 1 44bp and 166bp, the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114; the molecular marker InDel-Chr12-3 amplified one characteristic band in each of the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, and the band sizes were 181bp and 153bp, respectively, and the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114. ;

[0078] Specific:

[0079] Example 1: Screening for differential InDel sites across the entire genome and designing specific primers for screening

[0080] 1 Test method

[0081] 1.1Illumina high-throughput sequencing

[0082] The genomic DNA of the female parent THI-P-10 superior inbred line and the male parent P5114 superior inbred line of the pepper variety 'THI-P-10×P5114' was extracted. After the genomic DNA was tested, the DNA was fragmented by mechanical shearing (ultrasound), and then the fragment size was selected. The fragmented DNA ends were repaired, A was added to the 3′ end, and the sequencing adapter was connected. Then PCR amplification and purification were performed. The PCR amplified DNA fragments were single-stranded circularized to form circular DNA. Using the circularized DNA as a template, the library was prepared into DNA nanoballs (DNA nanoballs, DN B) through a unique linear amplification mode (rolling circle amplification). The prepared DNB library was combined with the array site on the sequencing chip to perform library sequencing. The Raw Reads (double-end sequences) obtained by sequencing were quality evaluated and filtered to obtain Clean Reads for subsequent bioinformatics analysis. Clean Reads were aligned with the reference genome CA59 (Ver 2024-2-21, https: / / db.cngb.org / search / project / CNP0001129 / ) sequence, and InDel variation detection analysis was performed based on the alignment results.

[0083] 1.2 InDel site screening and specific primer design

[0084] The Perl script was used to screen the unique InDel sites in the parental genomes of pepper 'THI-P-10×P5114'. The InDel size was set to 20-100 bp, and the sequencing depth was greater than 8. Based on the reference genome information, the screened sites were located on the genome, and the nucleotide sequences of 180 bp upstream and downstream of the InDel marker site were extracted. Primers were designed using Primer5.0, and the parameters were set to Tm value (60±2)℃, primer length (25±2) bp, PCR product expected length of 100-280 bp, and other parameters were default. The designed and synthesized primers were used to perform PCR amplification of pepper 'THI-P-10×P5114' and its parents.

[0085] 2 Test results

[0086] Figure 1The figure shows the electrophoresis diagram of PCR amplification products of 8 pairs of primers of the pepper variety 'THI-P-10×P5114' female parent THI-P-10, the pepper variety 'THI-P-10×P5114' male parent P5114, and the pepper variety 'THI-P-10×P5114'; the 8 pairs of InDel primers can simultaneously amplify the characteristic bands of the pepper variety 'THI-P-10×P5114' female parent THI-P-10 and the pepper variety 'THI-P-10×P5114' male parent P5114, and can be used to identify the variety and seed purity of the pepper variety 'THI-P-10×P5114' (such as Figure 1 shown).

[0087] Table 1 Eight primer sets used for seed purity identification of pepper variety 'THI-P-10×P5114'

[0088]

[0089] Table 1 shows the eight pairs of InDel marker primers used to identify the purity of the 'THI-P-10×P5114' pepper variety or the 'THI-P-10×P5114' hybrid seeds in the following Experimental Examples 2 and 3.

[0090] Example 2: Rapid identification of pepper variety 'THI-P-10×P5114'

[0091] 1 Test method

[0092] 1.1 Extraction of seed genomic DNA

[0093] Prepare 5 seeds each of the female parent THI-P-10 of 'THI-P-10×P5114', the male parent P5114 of 'THI-P-10×P5114B', the male parent TP023-PM-1 of 'THI-P-10×P5114', 'THI-P-10×P5114B', '8819 Pepper A', 'Er Jin Tiao', 'Zhai Bubai Green Pepper', 'Spicy Er Jin Tiao', 'Hong Tianxia·Pepper F1', 'Spicy No. 6', 'Spicy Emperor No. 1', '8819 Pepper B', 'Hao Ji Changxian', 'Heilong Green Pepper', 'Shenhe Spicy Pepper', 'Pepper Xiangchu Mo Jin', and 'Chuanjiao No. 19'.

[0094] The test seeds were germinated for 48 hours, and after the seeds germinated, the genomic DNA of the samples was extracted according to the conventional CTAB method and stored at -20°C for later use.

[0095] 1.2 PCR amplification

[0096] Using the genomic DNA of the above sample seeds as a template, PCR amplification was performed using InDel-PepChr01-1, InDel-Chr04-1, InDel-PepChr04-4, InDel-Chr08-1, InDel-PepChr10-5, InDel-PepChr11-3, InDel-Chr12-2 and InDel-Chr12-3 as primers;

[0097] The PCR amplification system is: 5 μL of 2× Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTP and optimized buffer system), 1.0 μL of 10 μM forward primer and reverse primer, 10 ng-100 ng of DNA template, and ddH2O to 10 μL;

[0098] The PCR amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 52°C for 15 s, 72°C for 35 s, 35 cycles; 72°C for 10 min.

[0099] 1.3 Detection and analysis of PCR amplification products

[0100] At a constant voltage of 150 V / cM, 3% agarose gel electrophoresis was performed for 35 min, and the gel imaging system was used to take photos. The authenticity of 'THI-P-10×P5114' was identified based on the electrophoresis band pattern. If the band patterns of the eight InDel loci simultaneously had the band patterns of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested was determined to be the pepper hybrid 'THI-P-10×P5114'; if one of the eight InDels did not simultaneously have the band patterns of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested was determined not to be the pepper hybrid 'THI-P-10×P5114'.

[0101] 2 Identification results

[0102] The agarose gel electrophoresis results of the pepper hybrid 'THI-P-10×P5114' using the above method are as follows Figure 2In the figure, M is a marker, and lanes 01-19 are respectively the female parent THI-P-10 of the pepper hybrid 'THI-P-10×P5114', the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the variety 'THI-P-10×P5114', the female parent THI-P-10 of the pepper hybrid 'THI-P-10×P5114B', and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114'. 5114B's male parent TP023-PM-1, pepper hybrid 'THI-P-10×P5114B', '8819 Pepper A', 'Er Jin Tiao', 'Zhai Bubai Green Pepper', 'Spicy Er Jin Tiao', 'Hong Tianxia·Pepper F1', 'Spicy No. 6', 'Spicy Emperor No. 1', '8819 Pepper B', 'Haoji Changxian', 'Heilong Green Pepper', 'Shenhe Spicy Pepper', 'Pepper Xiangchu Mojin', and 'Chuanjiao No. 19'.

[0103] According to the test results, the banding patterns of the eight InDel loci of the pepper hybrid 'THI-P-10×P5114' also have the banding patterns of the pepper hybrid 'THI-P-10×P5114' parents, pepper hybrids 'THI-P-10×P5114B', '8819 Line Pepper A', 'Er Jin Tiao', 'Zhai Bu Bai Qing Line Pepper', 'Xiang La Er Jin Tiao', 'Hong Tian Xia·Line Pepper F1', 'Xiang La Liu Hao', 'La Huang Fei No. 1' The banding patterns of the eight InDel sites of '8819 Line Pepper B', 'Haoji Changxian', 'Heilong Green Line Pepper', 'Shenhe Spicy Line Pepper', 'Line Pepper Xiangchu Mojin' and 'Chuanjiao No. 19' do not have the banding patterns of the pepper hybrid 'THI-P-10×P5114' parents at the same time; according to the identification results, it can be seen that the primer set designed by the present invention can accurately identify the pepper hybrid 'THI-P-10×P5114' from other pepper varieties.

[0104] Example 3: Identification of the purity of hybrid seeds of pepper variety 'THI-P-10×P5114'

[0105] 1 Test method

[0106] 1.1 Extraction of seed genomic DNA

[0107] There were 5 seeds each of the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114', and 88 hybrid sample seeds were randomly selected from a batch of 'THI-P-10×P5114' pepper hybrid seeds.

[0108] The seeds of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114' and the sample seeds were germinated for 48 hours at the same time. After the seeds germinated, 5 seeds of each parent were mixed and sampled, and 88 hybrid sample seeds were sampled individually. Genomic DNA was extracted according to the conventional CTAB method and stored at -20℃ for later use.

[0109] 1.2 PCR amplification

[0110] The genomic DNA of the pepper cultivar 'THI-P-10×P5114', the maternal parent THI-P-10, the paternal parent P5114 and the hybrid were used as templates, and PCR amplification was performed using InDel-PepChr01-1, InDel-Chr04-1, InDel-PepChr04-4, InDel-Chr08-1, InDel-PepChr10-5, InDel-PepChr11-3, InDel-Chr12-2 and InDel-Chr12-3 as primers, respectively;

[0111] The PCR amplification system is: 5 μL of 2× Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTP and optimized buffer system), 1.0 μL of 10 μM forward primer and reverse primer, 10 ng-100 ng of DNA template, and ddH2O to 10 μL;

[0112] The PCR amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 52°C for 15 s, 72°C for 35 s, 35 cycles; 72°C for 10 min.

[0113] 1.3 Detection and analysis of PCR amplification products

[0114] At a constant voltage of 150 V / cM, 3% agarose gel electrophoresis was performed for 35 min, and the gel imaging system was used to take photos. The purity of the hybrid seeds of 'THI-P-10×P5114' was identified based on the electrophoresis band pattern. If the band patterns of the eight InDel loci simultaneously had the band patterns of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested was determined to be the pepper hybrid 'THI-P-10×P5114'.

[0115] 2 Identification results

[0116] The agarose gel electrophoresis results of the seed purity identification of pepper hybrid 'THI-P-10×P5114' using the above method are shown in part. Figure 3 , Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8 , Fig. 9 , Fig.10 In the figure, M is a marker, lane 01 is the female parent THI-P-10 of the pepper hybrid 'THI-P-10×P5114', lane 02 is the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the samples to be tested.

[0117] There are 88 true hybrid seeds among the 88 sample seeds, so the purity of this batch of 'THI-P-10×P5114' hybrid seeds is 100%, which meets the national standards and is consistent with the field investigation results.

[0118] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

[0119] Sequence Listing

[0120] Institute of Economic Crops, Hubei Academy of Agricultural Sciences

[0121] InDel-labeled primer set and its application in seed purity identification of pepper 'THI-P-10×P5114'

[0122] DNA

[0123] Capsicum 1

[0125] ACCCATCTCTCTCTACCACCATTACCACATTTAGAGTATTTGAATTCCAAACATAGGATAAAATTAATTCCCAAATTTGATCCAGGGATTATTATCCTTATACCACGTACAAAACAATTGTGGCAGCAGGTTTGATTATAACAGTT

[0126] DNA

[0127] Capsicum 2

[0129] ACCCATCTCTCTCTACCACCATTACCACATTTAGAGTATTTGAATGTTGAAATGGTCTCGGGATTAACTAATAGCTCAATCCAAACATAGGATAAAATTAATTCCCAAATTTGATCCAGGGATTATTATCCTTATACCACGTACAAAACAATTGTGGCAGCAGGTTTGATTATAACAGTT

[0130] DNA

[0131] Chili (Capsicum) 3

[0133] TCTTATGCTCATGACAAGTTGGCTCTTTCTTATAAGTTGGTTTATTATTTAAAGGATAACTCCCAATGAGAGCACGTTTCTCTTTTCTTTTATATTTTTTTTGTCTGTCTCTTG TACATTCCTTTTTAGTATGAGAAAATTTCCTCC AAGCTTCCATCCACACTGTGACTTCAG

[0134] DNA

[0135] Chili (Capsicum) 4

[0137] TCTTATGCTCATGACAAGTTGGCTCTTTCTTATAAGTTGGTTTATTATTTAAAGGATAACTCCCAATGAGAGCACGTTTCTCTTTTCTTTTATATTTTTTTTGTCTGTCTCTTGAAGCTTCCATCCACACTGTGACTTCAG

[0138] DNA

[0139] Chili (Capsicum) 5

[0141] TACTATAACCCACTCGTGGAGAATCGTGGGAAACTTGATCGGATGATCCTCCAGAGGCGAAGTCAGAATTTTAGGTTTGTGGGTTTAGAATTCTAAGATAGAGGATTTTAGGTCTGTGGGTTTGAAATTCTAAGACAAAGAGTAAAAAATAAAAAATACTAGTGGGGTTCGGAC

[0142] DNA

[0143] Chili (Capsicum) 6

[0145] TACTATAACCCACTCGTGGAGAATCGTGGGAAAGCGAAGTCAGAATTTTAGGTTTGTGGGTTTAGAATTCTAAGATAGAGGATTTTAGGTCTGTGGGTTTGAAATTCTAAGACAAAGAGTAAAAAATAAAAAATACTAGTGGGGTTCGGAC

[0146] DNA

[0147] Chili (Capsicum) 7

[0149] TTCAACAAATTGGGCCAAATACTACGCAAAATATTCATCAATATCTGTTGTTCAAACTCTGAATACTTCACTTTGTCATACAAGAAGAAAAATGGCCAACATGAAAATGAAAATCTTCCATCTGATTTTCCTACTATTACA

[0150] DNA

[0151] Chili (Capsicum) 8

[0153] TTCAACAAATTGGGCCAAATACTACGCAAAATATTCATCAATATCTGTTGTTCAAACTCTGAATACTTCACTTTGTCATACAAGAAGAAAAATG AGCCAACAAGAGGTGTTGTCTCAAATGCCTG GCCAACATGAAAATGAAAATCTTCCATCTGATTTTCCTACTATTACA

[0154] DNA

[0155] Chili (Capsicum) 9

[0157] ATTTACCAACTTATATGCTCATCGCCACCACCTTCATGTGAAGACCTCATTCTTTTCGTAAGCCTTTGTGATCATCTTATCTAAACATTTTATAAGCTAGGTTGGACAAGTTCATTTCAT

[0158] DNA

[0159] Chili (Capsicum) 10

[0161] ATTTACCAACTTATATGCTCATCGCCACCACCTTCATGTGAAGACCTCATTCTTTTCGTAAGCC AAGAC ATCTATTTTCTCTAATACTATGTTAAATT TTTGTGATCATCTTATCTAAACATTTTATAAGCTAGGTTGGACAAGTTCATTTCAT

[0162] DNA

[0163] Chili (Capsicum) 11

[0165] TTATTTATGTGTCATTATCACTCCATAATCGAGTGTTTGTGAGAAAAAAATAACTAACTTGTCAAATTTTTTTAAAATAAATAATTTATGAAAACTGTTTTTAAAAATTATGACAAATAATTTGATACAGAGGGAGTCCA

[0166] DNA

[0167] Chili (Capsicum) 12

[0169] TTATTTATGTGTCATTATCACTCCATAATCGAGTGTTTGT AGTTTTCAAGAGCAATTATGTGCTACAAA GATAAAAT GAGAAAAAAATAACTAACTTGTCAAATTTTTTTAAAATAAATAATTTATGAAAACTGTTTTTAAAAATTATGACAAATAATTTGATACAGAGGGAGTCCA

[0170] DNA

[0171] Chili (Capsicum) 13

[0173] CGAATTTTATATCATTGGAAAGCTGATTCAATTATCTACAATTTGGTAGGTGTTGATATGAAAAATTTCATTAAAGTATACCCTTGTAGAATCAAATATACAACTTTGGGTGAATAAAAGGATCTTAGGTCAATTTGGCTATAA

[0174] DNA

[0175] Chili pepper (Capsicum) 14

[0177] CGAATTTTATATCATTGGAAAGCTGATTCAATTATCTACAATTTGGTAGGTGTTGATATGAAAAATTTCA TGTATATGAAAAGTTATAGACA TTAAAGTATACCCTTGTAGAATCAAATATACAACTTTGGGTGAATAAAAGGATCTTAGGTCAATTTGGCTATAA

[0178] DNA

[0179] Chili pepper (Capsicum) 15

[0181] GGATTTGTTTTAGCGTATTTCTGTTAACTAATGAGAAAATATGTTTGATTTTGTTTGTCTTTAATGTTGGTTGATTTGAAGTATCTTCTTTAATGTTGGTTGATTTGAACTTTCTTTGGATACTATGTTTTTTTTCTCCTCTCTTAAATGTGCTACTTGTTATGTTTCATGAGTTGGTTCA

[0182] DNA

[0183] Chili pepper (Capsicum) 16

[0185] GGATTTGTTTTAGCGTATTTCTGTTAACTAATGAGAAAATATGTTTGATTTTGTTTGTCTTTAATGTTGGTTGATTTGAAGTTTTCTTTGGATACTATGTTTTTTTTCTCCTCTCTTAAATGTGCTACTTGTTATGTTTCATGAGTTGGTTCA。

Claims

1. An InDel labeled primer set, characterized in that: The primer set consists of 8 pairs of primers, namely: Primers for the molecular marker InDel-PepChr01-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; Primers for the molecular marker InDel-Chr04-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; Primers for the molecular marker InDel-PepChr04-4, the upstream primer nucleotide sequence is shown in SEQ ID NO.5, and the downstream primer nucleotide sequence is shown in SEQ ID NO.6; Primers for the molecular marker InDel-Chr08-1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8; Primers for the molecular marker InDel-PepChr10-5, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10; Primers for the molecular marker InDel-PepChr11-3, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12; Primers for the molecular marker InDel-Chr12-2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.14; The primers of the molecular marker InDel-Chr12-3, the upstream primer nucleotide sequence is shown in SEQ ID NO.15, and the downstream primer nucleotide sequence is shown in SEQ ID NO.

16.

2. Use of the InDel marker primer set according to claim 1 in identifying the authenticity of the pepper variety 'THI-P-10×P5114'.

3. Use of the InDel marker primer set according to claim 1 in identifying the purity of pepper 'THI-P-10×P5114' seeds.

4. A method for identifying the authenticity of the pepper variety 'THI-P-10×P5114' or the purity of the seeds, characterized in that: The steps include: (1) extracting genomic DNA from seed samples of pepper varieties to be tested; (2) using the extracted sample genomic DNA as a template and using the eight pairs of primers described in claim 1 as forward and reverse primers to establish a PCR amplification system and perform PCR amplification respectively; (3) Detecting the amplified product by agarose gel electrophoresis; (4) If the banding pattern of each of the eight amplification products simultaneously has the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is the pepper hybrid 'THI-P-10×P5114'; if the banding pattern of any of the eight amplification products does not simultaneously have the banding pattern of the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114', the pepper variety to be tested is not the pepper hybrid 'THI-P-10×P5114'; (5) Calculate seed purity according to the seed purity formula.

5. The method according to claim 4, characterized in that: In step (1), when identifying the authenticity of the pepper variety 'THI-P-10×P5114', the genomic DNA of the seed sample of the pepper variety of similar type to be tested is extracted; when identifying the purity of the pepper 'THI-P-10×P5114' seeds, the genomic DNA of the seed sample of the pepper 'THI-P-10×P5114' variety to be tested is extracted.

6. The method according to claim 4, characterized in that: In step (1), the genomic DNA of the pepper seeds to be tested is extracted using the modified CTAB method.

7. The method according to claim 4, characterized in that: In step (2), the PCR amplification system is: 2× MagicGreen Taq SuperMix 5 μL, 10 μM forward primer and reverse primer 1.0 μL each, DNA template 10 ng-100 ng, add ddH2O to 10 μL; The PCR amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 52°C for 15 s, 72°C for 35 s, 35 cycles; 72°C for 10 min.

8. The method according to claim 4, characterized in that: In step (3), the electrophoresis detection includes: using 3% agarose electrophoresis gel, at a constant voltage of 150V / cM, performing 3% agarose gel electrophoresis for 35 minutes, and then photographing using a gel imaging system.

9. The method according to claim 4, characterized in that: In step (4), the molecular marker InDel-PepChr01-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', and the band sizes were 146 bp and 180 bp, respectively. The variety 'THI-P-10×P5114' had two characteristic bands of both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'; the molecular marker InDel-Chr04-1 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, and the band sizes were 146 bp and 180 bp, respectively. One characteristic band was amplified in I-P-10 and the male parent P5114 of 'THI-P-10×P5114', with the band sizes of 172bp and 141bp respectively. The variety 'THI-P-10×P5114' had two characteristic bands of both the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-PepChr04-4 amplified one characteristic band in the female parent THI-P-10 of 'THI-P-10×P5114' and the male parent P5114 of 'THI-P-10×P5114', with the band sizes of 172bp and 141bp respectively. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of THI-P-10 and the paternal parent P5114 of THI-P-10×P5114, with the band sizes of 174bp and 151bp respectively. The variety THI-P-10×P5114 also has two characteristic bands in the maternal parent THI-P-10 of THI-P-10×P5114 and the paternal parent P5114 of THI-P-10×P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band in each of the maternal parent THI-P-10 of THI-P-10×P5114 and the paternal parent P5114, with the band sizes of 174bp and 151bp respectively. The variety THI-P-10×P5114 also has two characteristic bands in the maternal parent THI-P-10 of THI-P-10×P5114. The molecular marker InDel-PepChr10-5 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114', with the band sizes of 120bp and 154bp respectively. The variety 'THI-P-10×P5114' also has two characteristic bands in the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'.The molecular marker InDel-PepChr11-3 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 140 bp and 177 bp, respectively. The variety 'THI-P-10×P5114' has two characteristic bands from both the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr12-2 amplified one characteristic band in each of the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P5114, with the band sizes being 1 44bp and 166bp, the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114; the molecular marker InDel-Chr12-3 amplified one characteristic band in each of the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, and the band sizes were 181bp and 153bp, respectively, and the 'THI-P-10×P5114' variety has two characteristic bands in both the 'THI-P-10×P5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114. ; 10. The method according to claim 4, characterized in that: In step (5), seed purity = the number of detected 8 amplification products that have the banding patterns of both the female parent THI-P-10 and the male parent P5114 of the pepper hybrid 'THI-P-10×P5114' / the total number of detected seeds×100%.

Images