Molecular markers of cold-tolerance genes in rice and their applications
By developing InDel molecular markers and specific primers in the promoter region of the cold-tolerant gene LTSS9a in the rice seedling stage, the problem of cold-tolerant identification of rice varieties was solved, and efficient and economical identification and breeding of rice cold-tolerant identification and breeding were achieved, which was suitable for routine laboratory operations.
Patent Information
- Application Number
- CN202510094471.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-21
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2045-01-21
AI Technical Summary
The prior art is difficult to efficiently screen and identify the cold resistance of rice varieties, resulting in low-temperature cold damage affecting rice yield, and it is impossible to quickly breed excellent cold-resistant varieties.
InDel molecular marker located in the promoter region of the cold-tolerant gene LTSS9a promoter of rice seedling stage was developed, specific primer pairs were designed, and the cold-tolerant properties of rice were identified by PCR amplification and agarose gel electrophoresis were provided, and kits and identification methods were provided.
It achieves high accuracy, stability and high resolution cold resistance identification of rice seedlings, which is simple and fast, suitable for large-scale applications, suitable for routine laboratory operations, strong adaptability and low cost.
Smart Images
Figure CN119639952B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of rice breeding, and in particular to molecular markers of rice cold-resistance genes and applications. Background Art
[0002] Due to the intensification of global climate change, the frequency of cold damage in my country's rice production areas has increased in recent years, posing a serious threat to the high and stable yield of rice. Especially in my country's southern rice-growing areas, with the rapid promotion of simplified direct seeding technology, rice growth and development in the early stages are often affected by continuous low temperature and rainy weather, resulting in delayed development of rice seedlings, and in severe cases, rotten seedlings and dead seedlings, affecting rice yield. Therefore, it is urgent to select excellent cold-resistant rice varieties from rice seed resources to effectively reduce the impact of low temperature and cold damage on rice production. Using molecular markers closely linked to the target gene, plants containing the target gene can be accurately screened, the transfer and polymerization of beneficial genes can be quickly and efficiently achieved, and the cold-resistant rice breeding process can be accelerated, which is a problem that needs to be solved urgently by those skilled in the art. Summary of the Invention
[0003] The present invention provides molecular markers of rice cold-tolerant genes and their applications. The molecular markers provided by the present invention can screen out cold-tolerant rice varieties at the seedling stage, effectively solving the problem of reduced rice yield caused by low temperature and chilling damage.
[0004] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is: providing a molecular marker of the rice cold-tolerance gene, which is an InDel molecular marker located at (-307~-364) in the promoter region of the rice seedling cold-tolerance gene LTSS9a, and the nucleotide sequence is shown in SEQ ID No: 1.
[0005] Furthermore, the identifier of the rice seedling cold-tolerance gene LTSS9a is LOC_Os09g21710.
[0006] A primer pair for detecting molecular markers of the above rice cold-tolerant gene.
[0007] Furthermore, the forward primer and the reverse primer of the primer pair are shown as SEQ ID No: 2 and SEQ ID No: 3, respectively.
[0008] A kit comprising the above primer pair.
[0009] Application of the above molecular markers, primer pairs or kits in identifying cold tolerance of rice seedlings.
[0010] A method for identifying cold tolerance of rice at the seedling stage comprises the following steps:
[0011] S1. Extract genomic DNA of the sample to be tested;
[0012] S2, using the genomic DNA described in step S1 as a template, performing PCR amplification using the primer pair to obtain a PCR product;
[0013] S3. Performing agarose gel electrophoresis on the PCR product obtained in step S2, and determining the cold tolerance of the rice variety based on the electrophoresis results.
[0014] Furthermore, in step S2, the PCR amplification system includes 5 μL 2×PCR Mix, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL template DNA and 3 μL water.
[0015] Furthermore, in step S2, the PCR amplification program is preheating at 95°C for 3 min; 34 cycles: 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s; and finally extension at 72°C for 5 min.
[0016] Furthermore, in step S3, 5% agarose gel electrophoresis was performed at 350-380 V for 15-20 min.
[0017] Furthermore, in step S3, if the obtained band is a lower band with a length of 58 bp, it is determined to be a cold-tolerant rice variety; if the obtained band is an upper band with a length of 75 bp, it is determined to be a cold-sensitive rice variety.
[0018] Furthermore, the nucleotide sequence of the cold-tolerant rice variety is shown in SEQ ID NO. 1, with a total length of 58 bp.
[0019] Furthermore, the nucleotide sequence of the cold-sensitive rice variety is shown in SEQ ID NO. 4, with a total length of 75 bp.
[0020] The method for identifying cold tolerance of rice at the seedling stage is used in screening or auxiliary screening of rice varieties with cold tolerance.
[0021] A molecular marker breeding method for screening cold-tolerant rice comprises the following steps: breeding the above-mentioned cold-tolerant rice variety as a parent, identifying the cold tolerance of hybrids obtained by breeding using the above-mentioned method for identifying the cold tolerance of rice at the seedling stage, and screening the hybrids with cold tolerance.
[0022] The present invention has the following beneficial effects:
[0023] 1. The InDel molecular marker developed in this invention uses specific primers designed based on insertion / deletion (InDel) sites in the genome for detection via PCR amplification. This marker exhibits high accuracy, excellent stability, and high resolution, enabling precise identification of target gene fragments and ensuring reliable results. It also exhibits consistent performance across samples, with low genetic variation, and is able to effectively distinguish subtle differences with excellent resolution. Furthermore, the assay is more economical, suitable for large-scale applications, and has relatively relaxed requirements for DNA template quality, making it more adaptable. Compared to SSR (simple sequence repeat) markers, InDel markers are more widely distributed and densely distributed throughout the genome. Compared to SNP (single nucleotide polymorphism) markers, InDel marker detection is simpler and faster, requiring only electrophoresis for typing, requiring less instrumentation and techniques, and suitable for routine laboratory operations.
[0024] 2. This study developed an InDel9a molecular marker targeting the promoter region (-307 to -364 positions) of the rice cold-tolerance gene LTSS9a and designed corresponding specific primers for identifying cold tolerance in rice seedlings. Experimental results showed that the PCR product of cold-tolerant varieties exhibited a lower band of 58 bp, while the PCR product of cold-sensitive varieties exhibited an upper band of 75 bp. This demonstrates that the primers designed in this study can specifically amplify the LTSS9a gene fragment and clearly distinguish the cold tolerance of rice germplasm resources through electrophoresis analysis, providing a powerful tool for studying cold tolerance in rice.
[0025] 3. In practical applications, the molecular markers provided by the present invention perform well, have high accuracy and genetic stability, are stable under different generations and environmental conditions, and are not prone to mutations; they are easy to operate, have intuitive results, and are suitable for rapid identification; the amplified product bands are clear and easy to analyze, making them particularly suitable for the breeding of cold-tolerant rice varieties. In summary, the molecular markers provided by the present invention not only have excellent accuracy and stability, but can also play an important role in the breeding of cold-tolerant rice varieties. It is an efficient, simple, and reliable molecular marker technology. Its unique performance gives it broad application prospects and important scientific value in the field of agricultural biotechnology. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 The electrophoresis results of PCR amplification products are shown in Figure 2.
[0027] Figure 2 The electrophoresis results of PCR amplification products are shown in Figure 2.
[0028] Figure 3 This is the cold tolerance phenotype of the rice germplasm to be tested at the seedling stage. DETAILED DESCRIPTION
[0029] The principles and features of the present invention are described below. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. In the examples, where specific conditions are not specified, conventional conditions or manufacturer-recommended conditions were used. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially.
[0030] Example 1 Development of molecular markers and primers for identifying the cold-tolerant gene LTSS9a in rice seedlings
[0031] The genomic sequences of the cold-tolerant gene LTSS9a from the cold-tolerant Jiangxi Dongxiang common wild rice and the cold-sensitive Guichao 2 were amplified and Sanger sequencing was performed. The sequencing results were spliced and compared. It was found that compared with Guichao 2, Jiangxi Dongxiang common wild rice had a deletion in the promoter of the cold-tolerant gene LTSS9a (-307~364). The deleted sequence was 17 bp in length. Primers were then designed based on the sequence (forward primer: 5'-GACTCACTCACATATGCTGC-3' (SEQ ID NO.2); reverse primer: 5'-GAGACCGAGTCGGATTTGG-3' (SEQ ID NO.3)). The amplified product of Jiangxi Dongxiang common wild rice was 58 bp, and the amplified product of Guichao 2 was 75 bp. The PCR products were subjected to 5% agarose gel electrophoresis. The results are as follows Figure 1 shown. Figure 1 In the figure, “i” represents an insertion of 17 bp and “d” represents a deletion of 17 bp. GC2: cold-sensitive indica rice variety Guichao 2, DXCWR: cold-tolerant common wild rice from Dongxiang, Jiangxi.
[0032] Depend on Figure 1 The cold-tolerant Jiangxi Dongxiang common wild rice is the lower band with a 17-bp deletion, while the cold-sensitive Guichao 2 is the upper band with a 17-bp insertion. Sanger sequencing of the amplified product revealed that the cold-tolerant Jiangxi Dongxiang common wild rice has the nucleotide sequence shown in SEQ ID NO. 1 (58 bp), while the cold-sensitive Guichao 2 has the nucleotide sequence shown in SEQ ID NO. 4 (75 bp). Electrophoresis can distinguish the specific bands of the cold-tolerant gene.
[0033] SEQ ID NO.1:
[0034] GACTCACTCACATATGCTGCCTTCGACCCCCAAACACCCCCAAATCCGACTCGGTCTC
[0035] SEQ ID NO.4:
[0036] GACTCACTCACATATGCTGCCTTGAGTGCCTTCGACGGTTCGACCCCCAAACACCCCCAAATCCGACTCGGTCTC
[0037] The primer sequences developed for the above molecular markers are as follows:
[0038] Forward primer: 5′-GACTCACTCACATATGCTGC-3′ (SEQ ID NO. 2);
[0039] Reverse primer: 5'-GAGACCGAGTCGGATTTGG-3' (SEQ ID NO. 3)
[0040] Therefore, the cold tolerance of rice can be determined by amplifying the rice germplasm genome according to the above primer set and detecting the band pattern by electrophoresis.
[0041] Example 2 Identification of cold tolerance of rice seedlings using the above molecular markers
[0042] 1. Extraction of rice genomic DNA
[0043] The leaves of rice germplasm were taken and their genomic DNA was extracted using the CTAB method.
[0044] 2. PCR Amplification
[0045] The rice genomic DNA to be tested was used as a template and PCR amplification was performed using the following primer pairs to obtain the amplified product.
[0046] The primer sequences are as follows:
[0047] Forward primer: 5′-GACTCACTCACATATGCTGC-3′ (SEQ ID NO. 2);
[0048] Reverse primer: 5'-GAGACCGAGTCGGATTTGG-3' (SEQ ID NO. 3)
[0049] The PCR amplification system was as follows: 2× PCR Mix 5 μL, F primer 0.5 μL, R primer 0.5 μL, template DNA 1 μL, water 3 μL;
[0050] The PCR amplification program was as follows: preheating at 95°C for 3 min; 34 cycles of 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s; and a final extension at 72°C for 5 min.
[0051] 3. Electrophoresis Identification
[0052] The PCR products obtained by the above amplification were subjected to electrophoresis on 5% agarose gel and the results were detected by gel imaging system. The electrophoresis results were as follows: Figure 2 shown. Figure 2 In the figure, “i” represents an insertion of 17 bp, “d” represents a deletion of 17 bp, and X78, X1, etc. are the numbers of the rice germplasms to be tested.
[0053] We now select some test results from a variety of test samples for illustration, and the electrophoresis test results are shown in Figure 2 The sample description corresponding to the electrophoresis result is shown in Table 1.
[0054] Table 1 Material information
[0055]
[0056] Depend on Figure 2 As shown in Table 1, the lower band (denoted as "d") of the electrophoresis bands for rice varieties X1, X69, X102, X101, X180, X208, X117, X131, X116, X9, X24, X242, X133, X136, X139, X141, X106, X228, X109, X309, X97, and X285 contains a 17-bp sequence deletion, indicating that these varieties are cold-tolerant. The upper band (denoted as "i") of the electrophoresis bands for rice varieties X78, X270, X25, X144, X12, X77, X3, X83, X81, X96, X170, X352, X353, and X354 contains a 17-bp sequence insertion, indicating that these varieties are cold-sensitive.
[0057] Example 3 Verification
[0058] In order to verify the accuracy of the identification results in Example 2, the above-mentioned rice varieties to be tested, X78, X1, X69, X102, X270, X101, X25, X180, X208, X117, X131, X116, X9, X24, X242, X133, X136, X139, X141, X106, X228, X144, X109, X309, X12, X77, X97, X285, X3, X83, X81, X96, X170, X352, X353 and X354, were subjected to cold tolerance treatment at the seedling stage, as follows:
[0059] Rice varieties from 18 different countries were subjected to a cold-resistance treatment at the seedling stage. Healthy, plump seeds were placed in a 42°C oven for 2 days to break dormancy. The seeds were then disinfected by immersing them in a 20% sodium hypochlorite solution for 20 minutes. The disinfected seeds were rinsed 3–4 times with water and incubated in a 37°C incubator for 2 days, with the water changed daily. Seeds that had just whitened were placed in a 96-well black PCR plate with the bottom removed, with the white side facing up. The plates were incubated in a 28°C artificial climate chamber (14 h light, 10 h dark) with deionized water, with the water changed every two days. When the plants reached the one-leaf, one-heart stage, the nutrient solution was replaced with a 1 / 3 concentration (nutrient solution: water ratio = 1:2 by volume). When the plants reached the 2-leaf, 1-heart stage, the solution was replaced with complete nutrient solution and low-temperature treatment was started in a low-temperature incubator for a certain period of time (treatment conditions for japonica rice: 4°C treatment for 5 days, 28°C recovery for 7 days; treatment conditions for indica rice: 10°C treatment for 10 days, 28°C recovery for 7 days). Phenotypes were then statistically analyzed (survival seedling rate % = number of surviving seedlings after recovery / total number of seedlings treated × 100%). The phenotypic identification results are shown in Tables 2 and Figure 3 shown. Figure 3 In the figure, from top to bottom are the phenotypes of japonica rice before treatment, the phenotype of japonica rice after treatment at 4℃ for 5 days and recovery at 28℃ for 7 days, the phenotype of indica rice before treatment, and the phenotype of indica rice after treatment at 10℃ for 10 days and recovery at 28℃ for 7 days. The scale bar is 5 cm.
[0060] Table 2 Genotypes and cold-tolerant phenotypes of materials
[0061]
[0062] As shown in Table 2, rice varieties X1, X69, X102, X101, X180, X208, X117, X131, X116, X9, X24, X242, X133, X136, X139, X141, X106, X228, X109, X309, X97, and X285 all had survival rates above 60% after cold treatment, making them cold-tolerant. In contrast, rice varieties X78, X270, X25, X144, X12, X77, X3, X83, X81, X96, X170, X352, X353, and X354 all had survival rates below 35% after cold treatment, making them cold-sensitive. This result is consistent with the result of molecular marker identification in Example 2, indicating that the molecular markers, primers and identification method provided by the present invention can specifically identify the cold tolerance of rice seedlings, providing practical value for cold tolerance breeding of rice.
[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. Use of a primer pair for detecting a molecular marker of a rice cold-tolerant gene or a kit comprising a primer pair for detecting a molecular marker of a rice cold-tolerant gene in identifying cold tolerance of rice seedlings, wherein the molecular marker of the rice cold-tolerant gene is an InDel molecular marker, located at positions -307 to -364 of the promoter region of the rice cold-tolerant gene LTSS9a at the seedling stage, and the nucleotide sequence is shown in SEQ ID No:
1. The identifier of the rice cold-tolerant gene LTSS9a at the seedling stage is LOC_Os09g21710.
2. The use according to claim 1, characterized in that The forward primer and the reverse primer of the primer pair are shown as SEQ ID No: 2 and SEQ ID No: 3, respectively.
3. A method for identifying cold tolerance of rice seedlings, characterized in that: The following steps are involved: S1. Extract genomic DNA of the sample to be tested; S2. Using the genomic DNA described in step S1 as a template, PCR amplify the molecular marker described in claim 1 using a primer pair to obtain a PCR product, wherein the forward primer and the reverse primer of the primer pair are shown as SEQ ID No: 2 and SEQ ID No: 3, respectively; S3. Performing agarose gel electrophoresis on the PCR product obtained in step S2, and determining the cold tolerance of the rice variety based on the electrophoresis results.
4. The method for identifying cold tolerance of rice seedlings according to claim 3, wherein: In step S2, the PCR amplification system includes 5 μL 2×PCR Mix, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL template DNA and 3 μL water; The PCR amplification program was as follows: preheating at 95°C for 3 min; 34 cycles of 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s; and a final extension at 72°C for 5 min.
5. The method for identifying cold tolerance of rice seedlings according to claim 3, wherein: In step S3, perform 5% agarose gel electrophoresis at 350-380V for 15-20 min.
6. The method for identifying cold tolerance of rice seedlings according to claim 3, wherein: In step S3, if the obtained band is a lower band with a length of 58 bp, it is determined to be a cold-tolerant rice variety; if the obtained band is an upper band with a length of 75 bp, it is determined to be a cold-sensitive rice variety.
7. Use of the method for identifying cold tolerance of rice at the seedling stage according to any one of claims 3 to 6 in screening or assisting in screening of cold-tolerant rice varieties.