High-effect wheat stripe rust resistance site and KASP marker developed by high-effect wheat stripe rust resistance site

Abstract

The invention discloses a high-effect wheat stripe rust resistance site and a KASP marker developed by the high-effect wheat stripe rust resistance site. Specifically, the invention discloses a molecular marker (SEQ ID NO: 4) for identifying or assisting in identifying the stripe rust resistance character of wheat, and a primer composition for amplifying or detecting the KASP molecular marker. The invention further discloses a method for identifying or assisting in identifying the stripe rust resistance character of wheat. Experiments show that wheat with stripe rust resistance can be rapidly and accurately screened by using the molecular marker and the detection primer thereof, and the molecular marker and the detection primer thereof can be applied to identification and auxiliary identification of wheat with stripe rust resistance and stripe rust resistance molecular marker auxiliary breeding of wheat. The molecular marker closely linked with the wheat stripe rust resistance gene QTL and the primer of the molecular marker provide a good tool for wheat stripe rust resistance molecular marker assisted breeding, and play an important role in wheat stripe rust resistance breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and relates to a high-effect wheat stripe rust resistance locus and a KASP marker developed therefrom, and specifically to the identification of a newly discovered wheat stripe rust resistance QTL (Quantitative Trait Locus) and the application of a linked KASP (Kompetitive Allele-Specific PCR) marker thereto. Background Art

[0002] Wheat stripe rust is an airborne fungal disease caused by Puccinia striiformis West.f.sp.tritici (Pst), which mainly infects wheat leaves, and can also infect almost all above-ground nutritional organs such as wheat sheaths, spikes, stems, husks and wheat awns. In my country, except for spring wheat in Northeast China, almost all wheat-producing areas are facing the threat of wheat stripe rust. Historically, these areas have experienced many outbreaks of wheat stripe rust, causing huge losses to the economy and production. Controlling the epidemic of wheat stripe rust has always been an arduous task. Chemical control can reduce the losses caused by stripe rust, but it is costly and long-term use can cause pollution to the environment. Therefore, breeding varieties resistant to wheat stripe rust is considered to be the most economical, safe and effective strategy.

[0003] In recent years, 89 stripe rust resistance genes have been reported to be distributed on 20 chromosomes other than chromosome 1A. In addition, more than 300 quantitative trait loci (QTLs) for stripe rust resistance have been identified, with the most resistance loci in the B genome. Due to the rapid mutation of wheat stripe rust fungi, resistance genes are prone to lose resistance, and some genes may be linked to undesirable traits. Therefore, the number of effective genes that can be used to improve wheat stripe rust resistance is relatively limited. Therefore, finding new stripe rust resistance genes (QTLs) and developing molecular markers associated with them is of great significance for breeding. At present, KASP (Kompetitive Allele Specific PCR) marker technology has been widely used in SNP site detection in various crops such as wheat, rice, and corn, eliminating the electrophoresis step and achieving high-throughput genotyping. Using the genotype data generated by the wheat SNP chip, combined with QTL positioning and genome-wide association studies (GWAS), the relevant SNPs can be converted into KASP markers and directly used in molecular marker-assisted breeding to improve breeding efficiency. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to identify or assist in identifying wheat stripe rust resistance traits. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0005] In order to solve the above technical problems, the present invention first provides a molecular marker for identifying or assisting in identifying the stripe rust resistance trait of wheat, and the nucleotide sequence of the molecular marker can be SEQ ID NO:4.

[0006] The molecular marker may be a tightly linked KASP molecular marker used for screening wheat stripe rust resistance gene QTL, and the name may be KASP-7BL-YR.

[0007] The wheat stripe rust resistance gene QTL is located at 714.2MB of chromosome 7B, named as QYR.GAAS-7BL, and can explain 11.8%-44.2% of the phenotypic variation.

[0008] The KASP molecular marker Kasp-7BL-YR was developed based on a SNP site, the genomic location of which is at 713988566bp on chromosome 7B of wheat, and the polymorphism of the SNP site is A or C. The physical location of the SNP site is determined based on the whole genome sequence of wheat, the version number of which is iwgsc refseqv2.1

[0009] The 51st nucleotide (m) of the KASP molecular marker KASP-7BL-YR (SEQ ID NO: 4) is A or C.

[0010] The present invention also provides PCR primers, which can be primer compositions used to amplify or detect the molecular markers.

[0011] Furthermore, the primer composition includes a forward primer A having a nucleotide sequence of positions 22-45 of SEQ ID NO:1, a forward primer B having a nucleotide sequence of positions 22-46 of SEQ ID NO:2, and a reverse primer C having a nucleotide sequence of SEQ ID NO:3.

[0012] Furthermore, the 5' ends of the forward primer A and the forward primer B may be connected to different fluorescent label sequences.

[0013] Furthermore, the fluorescent tag sequence can be combined with a specific fluorescent dye (such as FAM, HEX, VIC).

[0014] Furthermore, the fluorescent tag sequence may be a FAM fluorescent tag sequence (positions 1-21 of SEQ ID NO: 1) and a HEX fluorescent tag sequence (positions 1-21 of SEQ ID NO: 2).

[0015] Furthermore, the primer composition includes a forward primer A having a nucleotide sequence of SEQ ID NO:1, a forward primer B having a nucleotide sequence of SEQ ID NO:2, and a reverse primer C having a nucleotide sequence of SEQ ID NO:3.

[0016] The present invention also provides a kit for identifying or assisting in identifying wheat stripe rust resistance traits, wherein the kit comprises any one of the PCR primers described herein.

[0017] Furthermore, the kit may also include reagents required for KASP (Kompetitive Allele-Specific PCR) detection.

[0018] Furthermore, the kit may also include a nucleic acid extraction reagent, a DNA polymerase (such as Taq DNA polymerase, Tth DNA polymerase, Vent DNA polymerase, and Pfu DNA polymerase, etc.), dNTPs, Mg 2+ solution (such as MgSO4 or MgCl2 solution), PCR buffer (such as Tris-HCl) or more.

[0019] The nucleic acid extraction reagent is well known to those skilled in the art and is used to extract nucleic acids from the sample to be tested. For example, the nucleic acid extraction reagent may include a lysing solution (such as any one or more of guanidine isothiocyanate, guanidine hydrochloride and trisodium citrate), lysozyme, proteinase K, a washing solution (such as ethanol and / or guanidine salt) and / or an eluent (such as TE buffer), etc.

[0020] The various reagent components of the kit may be present in separate containers, or may be pre-combined in whole or in part into a reagent mixture.

[0021] The components of the kit may be provided in the form of a solution, such as an aqueous solution. In the case of being in the form of an aqueous solution, the concentration or content of these components can be easily determined by those skilled in the art according to different needs. For example, for storage purposes, the concentration of the components may be present in a higher form, and when in working state or use, the concentration may be reduced to the working concentration by diluting the above-mentioned higher concentration solution.

[0022] Further, the kit may also include a readable carrier having a method for simultaneously detecting multiple microorganisms. The readable carrier may be a kit specification sheet (e.g., a printed specification sheet) for practicing the method of the present invention or a computer-readable medium (e.g., a floppy disk, a CD, etc.) on which information has been recorded.

[0023] The present invention also provides the use of the molecular marker, any of the PCR primers described herein, or the kit in any of the following:

[0024] A1) Application in identification or auxiliary identification of wheat stripe rust resistance traits;

[0025] A2) Application in screening or assisting screening of wheat resistant to stripe rust;

[0026] A3) Application in molecular marker-assisted breeding of wheat for resistance to stripe rust.

[0027] The present invention also provides the use of any of the PCR primers described herein in preparing a product having at least one of the following functions:

[0028] B1) detecting the molecular marker;

[0029] B2) Identify or assist in identifying wheat stripe rust resistance traits;

[0030] B3) Screening or assisting in the screening of wheat resistant to stripe rust;

[0031] B4) Molecular marker-assisted breeding for wheat resistance to stripe rust.

[0032] The present invention also provides a method for identifying or assisting in identifying wheat stripe rust resistance traits, the method comprising the following steps:

[0033] C1) using the wheat genomic DNA to be tested as a template, performing PCR amplification using any of the PCR primers described herein to obtain a PCR product, and collecting a fluorescent signal;

[0034] C2) determining the genotype of the wheat to be tested according to the fluorescent signal, and identifying or assisting in identifying the stripe rust resistance trait of the wheat according to the genotype.

[0035] In the above method, the stripe rust resistance trait of wheat can be identified or auxiliary identified according to the genotype: the stripe rust resistance of wheat with genotype CC is higher than that of wheat with genotype AA.

[0036] Furthermore, the determining of the genotype of the wheat to be tested may specifically be determining whether the genotype at 713988566 bp on chromosome 7B of the wheat to be tested is CC or AA.

[0037] Furthermore, the reaction conditions for PCR amplification may be 94°C for 15 min; 94°C for 20 s, 63-55°C for 1 min (1°C decrease per cycle), for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles.

[0038] Furthermore, the reaction system for PCR amplification can be as follows: each 4 μl reaction system can be as follows: 0.048 μl PrimerMix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl), the ratio of Primer Mix is: 12% HEX primer, 12% FAM primer, 30% Common primer.

[0039] Furthermore, if the amplified product of the wheat to be tested is separated to the red side, its genotype is CC, and if the amplified product of the wheat to be tested is separated to the blue side, its genotype is AA.

[0040] Funo is native to Albania and has good resistance to wheat stripe rust. Its resistance has been maintained for nearly a hundred years. Therefore, it is of great significance to analyze the genetic mechanism of resistance of Funo and to explore important stripe rust resistance genes. The present invention uses Funo and Huixianhong to construct a recombinant inbred line (RIL) population including 389 families. The genetic map constructed using the 50K chip was used to perform QTL analysis on the stripe rust resistance of the RIL population, and a QTL that is stable under multiple environmental conditions was detected, located near 714.0Mb of chromosome 7B, and named QYR.gaas-7BL, which can explain 14.7%-31.7% of the phenotypic variation. The KASP marker Kasp-7BL-YR developed based on it can be used for molecular marker detection, providing a new tool for wheat stripe rust resistance breeding.

[0041] Experiments show that the molecular marker Kasp-7BL-YR and its detection primers of the present invention can be used to quickly and accurately screen wheat with stripe rust resistance traits, and can be applied to the identification and auxiliary identification of wheat with stripe rust resistance traits and the molecular marker-assisted breeding of wheat with stripe rust resistance. The molecular marker and primers closely linked to the QTL of wheat stripe rust resistance gene developed by the present invention provide a good tool for molecular marker-assisted breeding of wheat with stripe rust resistance, and play an important role in wheat stripe rust resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 The genotyping results of 111 wheat varieties using KASP marker Kasp-7BL-YR (red is Afu genotype CC, blue is Huixianhong genotype AA, and green is heterozygous AC). DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0044] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0045] Example 1. Discovery of a stripe rust resistance gene QTL in wheat material Afu and acquisition of its KASP marker

[0046] 1. Acquisition of phenotype

[0047] The Afu / Huixianhong RIL population was planted in Chengdu, Sichuan and Tianshui, Gansu in 2021-2022 and 2023-2024. A completely randomized block design was used with three replicates, single-row plots, 1m row length, 0.3m row width, and 30 seeds were evenly sown in each row. Field management was carried out according to local practices. The RIL population was identified for resistance in the adult stage using the current popular mixed strains of stripe rust in my country. The maximum disease severity (MDS) of the disease index showed continuous changes in the field, which was a typical quantitative trait inheritance. The modified CTAB method (Murray et al., 1980) was used to extract genomic DNA from young leaves of 389 families, and the DNA concentration was determined using a NanoDrop2000c spectrophotometer. The DNA sample was adjusted to a standard concentration of 50ng / ul, and then the DNA quality was tested using 0.8% agarose gel, and SNP typing was performed on the qualified DNA. SNP analysis was performed using a 12K SNP chip developed by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences and Affymetrix Axiom.

[0048] 2. Construction of linkage map

[0049] After removing markers with heterozygous and missing rates greater than 10% between parents, Icimapping V4.1 was used to remove redundant markers, and then clusters were formed based on the genetic distance between markers and chromosome position information to construct a high-density genetic map.

[0050] 3. QTL Analysis

[0051] IciMapping 4.1ICIM-ADD method was used for QTL analysis, with an LOD value of 2.5. QYR.gaas-7BL was located on chromosome 7B at 714.2 Mb, which could explain 14.7-31.7% of the phenotypic variation under different environmental conditions. A KASP marker for identifying wheat stripe rust resistance was developed at this location (713.8 Mb): Kasp-7BL-YR, and the genotypes of 111 wheat varieties were detected.

[0052] The KASP marker Kasp-7BL-YR was developed based on a SNP site, the genomic position of which is at 713988566 bp on chromosome 7B of wheat, and the polymorphism of the SNP site is A or C. The physical position of the SNP site is determined based on the whole genome sequence of wheat, and the version number of the whole genome sequence of wheat is iwgsc refseqv2.1.

[0053] Example 2: Development of KASP molecular marker specific primers

[0054] Based on the SNP sites found in Example 1, KASP molecular marker specific primers were designed, and the sequences are shown in Table 1.

[0055] Table 1. KASP primer sequence list for detecting stripe rust resistance QTL QYR.gaas-7BL

[0056]

[0057] Note: The underlined sequence GAAGGTGACCAAGTTCATGCT is the tag sequence A (FAM), and the underlined sequence GAAGGTCGGA GTCAACGGATT is the tag sequence B (HEX).

[0058] The SNP flanking sequence developed by the present invention, i.e., the nucleotide sequence of the KASP molecular marker Kasp-7BL-YR containing the SNP site is as follows:

[0059] 5'-TTGTCAGAGGCTACACCAGCTTCGGGTGTTTGAGCAATCCAAGAAGGTATmGTCACACAGTAACTCCAGCCT GTTTGAGGGTTATGTGGCCAGACGGTGTT-3' (SEQ ID NO: 4).

[0060] The nucleotide at position 51 (m) of SEQ ID NO:4 is A or C.

[0061] Example 3: Application of KASP molecular marker Kasp-7BL-YR in identifying wheat stripe rust resistance

[0062] In order to verify the reliability and accuracy of the KASP marker Kasp-7BL-YR, 111 wheat varieties (see Table 2) were selected for verification, and the steps were as follows:

[0063] 111 wheat varieties from different sources were planted in Pixian County, Sichuan and Tianshui, Gansu in 2014-2015 and 2015-2016. A completely randomized block design was used with three replicates, single-row plots, 1m long and 0.3m wide, and 30 seeds were evenly sown in each row. Field management was carried out according to local practices. The resistance of RIL populations in the adult stage was identified using the current popular mixed strains of stripe rust in my country, and the maximum disease severity (MDS) was recorded. The genomic DNA of young leaves of 111 families was extracted using the modified CTAB method. When the severity of stripe rust in susceptible varieties reached 80%, the severity of stripe rust in the test materials was investigated, and the investigation was conducted every other week until the stripe rust stopped. The maximum data investigated was used as the MDA.

[0064] KASP amplification requires HEX, FAM and a reverse common primer (Common). Using the extracted wheat genomic DNA as a template, PCR amplification was performed using primer A (FAM primer, SEQ ID NO: 1), primer B (HEX primer, SEQ ID NO: 2), and primer C (Common primer, SEQ ID NO: 3). The KASP labeled PCR amplification system, each 4 μl reaction system is as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl), Master Mix purchased from LGC Company, Primer Mix ratio: 12% HEX primer, 12% FAM primer, 30% Common primer, primers synthesized by Shanghai Shenggong Company. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler) with the following program: 94°C for 15 min; 94°C for 20 s, 63-55°C for 1 min (1°C drop for each cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 32 cycles. The PCR amplification product was placed in an autofocus fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data was imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0065] The 111 wheat varieties (Table 2) were genotyped, i.e., whether the nucleotide at position 713988566 of chromosome 7B of the wheat genome was A or C was detected. The specific judgment principle was as follows: if the amplified product of the wheat to be tested was separated to the red side, its genotype was CC; if the amplified product of the wheat to be tested was separated to the blue side, its genotype was AA.

[0066] The CC genotype indicates that the nucleotide type of the SNP site in the wheat genome is homozygous for C; the AA genotype indicates that the nucleotide type of the SNP site in the wheat genome is homozygous for A. Wheat varieties resistant to stripe rust are obtained based on the CC genotype.

[0067] All experimental materials were detected using the KASP molecular marker Kasp-7BL-YR. The results are shown in Table 2 and Figure 1 , it can be seen that the molecular marker can clearly separate the two genotypes. Among the 111 wheat varieties, 58 varieties showed the Afu genotype CC (red), with a stripe rust MDS of 37.5; 48 varieties showed the Huixianhong genotype AA (blue), with a stripe rust MDS of 43.5; statistical tests showed that the gene effect of Kasp-7BL-YR reached a significant difference (P<0.05).

[0068] Table 2. Genotype detection results and stripe rust resistance of 111 wheat varieties

[0069]

[0070]

[0071]

[0072]

[0073] CC is the Af genotype; AA is the Huixianhong genotype.

[0074] Table 3. Stripe rust resistance of 111 natural varieties of QYR.caas-7BL

[0075]

[0076]

[0077] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A molecular marker for identifying or assisting in identifying wheat stripe rust resistance, characterized in that: The nucleotide sequence of the molecular marker is SEQ ID NO:

4.

2. PCR primers, which are primer compositions for amplifying or detecting the molecular markers according to claim 1.

3. The PCR primer according to claim 2, characterized in that The primer composition comprises a forward primer A having a nucleotide sequence of positions 22-45 of SEQ ID NO:1, a forward primer B having a nucleotide sequence of positions 22-46 of SEQ ID NO:2, and a reverse primer C having a nucleotide sequence of SEQ ID NO:

3.

4. The PCR primer according to claim 3, characterized in that The 5' ends of the forward primer A and the forward primer B are connected to different fluorescent label sequences.

5. The PCR primer according to any one of claims 2 to 4, characterized in that: The primer composition comprises a forward primer A having a nucleotide sequence of SEQ ID NO:1, a forward primer B having a nucleotide sequence of SEQ ID NO:2, and a reverse primer C having a nucleotide sequence of SEQ ID NO:

3.

6. A kit for identifying or assisting in identifying wheat stripe rust resistance traits, characterized in that: The kit comprises the PCR primers described in any one of claims 2-5.

7. Use of the molecular marker according to claim 1, the PCR primer according to any one of claims 2 to 5, or the kit according to claim 6 in any of the following: A1) Application in identification or auxiliary identification of wheat stripe rust resistance traits; A2) Application in screening or assisting screening of wheat resistant to stripe rust; A3) Application in molecular marker-assisted breeding of wheat for resistance to stripe rust.

8. Use of the PCR primers according to any one of claims 2 to 5 in the preparation of a product having at least one of the following functions: B1) detecting the molecular marker according to claim 1; B2) Identify or assist in identifying wheat stripe rust resistance traits; B3) Screening or assisting in the screening of wheat resistant to stripe rust; B4) Molecular marker-assisted breeding for wheat resistance to stripe rust.

9. A method for identifying or assisting in identifying wheat stripe rust resistance, characterized in that: The method comprises the following steps: C1) using the wheat genomic DNA to be tested as a template, performing PCR amplification using the PCR primers described in any one of claims 2 to 5 to obtain a PCR product, and collecting a fluorescent signal; C2) determining the genotype of the wheat to be tested according to the fluorescent signal, and identifying or assisting in identifying the stripe rust resistance trait of the wheat according to the genotype.

10. The method according to claim 9, characterized in that According to the genotype identification or auxiliary identification of the stripe rust resistance of wheat, the stripe rust resistance of wheat with a genotype of CC is higher than that of wheat with a genotype of AA.

Images