Probe, freeze-drying reagent, lateral flow chromatography test strip, kit and method for detecting DNase activity

Abstract

The invention provides a probe, a freeze-drying reagent, a lateral flow chromatography test strip, a kit and a method for detecting DNase activity, and relates to the technical field of biology. Based on an antigen-antibody reaction and an immunochromatography technology, a DNA probe of which the 5'end is labeled with 6-carboxyl fluorescein and the 3 'end is labeled with biotin is adopted as a substrate, and when a sample to be detected contains DNase and is mixed with the substrate, the DNase can specifically recognize and cut a phosphodiester bond on the DNA probe, so that DNA fragmentation is caused. The test strip is inserted into the reacted reagent, when a sample does not contain DNase, the DNA probe is not subjected to enzyme digestion and is fixed on the quality control line to be combined with streptavidin, a red strip appears on the quality control line, and a test strip detection line does not develop color; when DNase exists in a sample, the DNA probe is subjected to enzyme digestion and is fixed on the detection line to be combined with the second antibody, and a red strip appears on the detection line.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a probe, a lyophilized reagent, a lateral flow chromatography test strip, a kit and a method for detecting DNase activity. Background Art

[0002] Deoxyribonuclease (DNase) can be divided into endonucleases and exonucleases. Endonucleases cut phosphodiester bonds inside the DNA chain, such as DNase I, which can randomly hydrolyze phosphodiester bonds inside double-stranded or single-stranded DNA, usually requiring divalent metal ions as cofactors. Under appropriate pH and temperature conditions, DNA is cut into oligonucleotide fragments to produce fragments with 5'-phosphate ends and 3'-hydroxyl ends. Exonucleases cut nucleotides one by one from the ends of the DNA chain.

[0003] In the field of molecular biology, the detection of DNase activity or residue is crucial. For example, during the RNA extraction process, if there is DNase residue, it may degrade the DNA in the sample, affecting the judgment of RNA purity and subsequent experiments, such as RT-PCR. In the production of recombinant proteins, DNase residues may affect the stability and activity of the protein. In addition, for enzyme preparations and biological products, the detection of DNase activity or residue is a key link in quality control. There are currently a variety of detection technologies, each with its own characteristics and limitations.

[0004] The detection technology based on gel electrophoresis is judged by the electrophoretic behavior of DNA in the gel. When active DNase is present, the electrophoretic bands are tailed, blurred or weakened. It is low-cost and simple in equipment. It can visually observe the integrity of DNA and process multiple samples, but its sensitivity is limited, it is difficult to detect low-level activity or residues, and it can only be qualitative. There are many factors that affect the band changes, and the detection is time-consuming, which is not suitable for rapid detection.

[0005] Radioactive labeled substrate detection method uses radioactive isotopes to label DNA substrates, and detects radioactive fragments after DNase cleavage to reflect activity. It has high sensitivity and can measure extremely low levels of activity. However, this method involves radioactive substances, requires special protection and regulations, is troublesome to dispose of waste, and the substrate is expensive and requires special instruments, which greatly increases costs.

[0006] Fluorescently labeled substrate detection method uses fluorescent dye to label DNA substrate, and detects activity by fluorescence signal changes during DNase degradation. It has high sensitivity, simple operation, and high-throughput detection, but it is easily affected by environmental fluorescence interference and leads to false results. There are many factors that affect the signal change, and quantitative interpretation is complicated.

[0007] Based on the ELISA detection technology, DNA is fixed on the ELISA plate, and after DNase degradation, the product is detected with specific antibodies and quantitatively analyzed. It has strong specificity, accurate and stable results, and can be semi-quantitative or quantitative, but the operation is cumbersome, the multi-step reaction is prone to errors, the process is long, and it relies on high-quality antibodies. The preparation cost is high and the difficulty is great, which affects the reliability of the results.

[0008] In summary, the prior art lacks a simple, accurate, efficient and low-cost method for detecting DNase activity. Summary of the invention

[0009] The purpose of the present application is to provide a probe, a lyophilized reagent, a lateral flow chromatography test strip, a kit and a method for detecting DNase activity, aiming to solve the problems existing in the existing DNase activity detection methods.

[0010] To achieve the above objectives, the present application provides a probe for detecting DNase activity, wherein the probe is a single-stranded DNA of 20-80 nucleotides, the 5' end of the probe is labeled with 6-carboxyfluorescein (6-FAM), and the 3' end of the probe is labeled with biotin.

[0011] The number of nucleotides in the probe may be 20, 30, 40, 50, 60, 70, 80 or any value between 20 and 80, and the nucleotide sequence of the probe may be an artificially designed sequence or a natural sequence.

[0012] In some embodiments, the probe is used at a concentration of 0.5-1 pmol / reaction, and the total volume of each test reaction in this application is 20 μL;

[0013] Preferably, the probe is used at a concentration of 0.5 pmol / reaction.

[0014] The present application also provides a lyophilized reagent for detecting DNase activity, comprising the above-mentioned probe for detecting DNase activity.

[0015] In some embodiments, 10× DNA reaction buffer and 2× lyophilization protectant are also included;

[0016] The 10× DNA reaction buffer comprises Tris-HCl, MgCl2, CaCl2 and Tween-20;

[0017] The 2× lyophilization protective agent includes trehalose and bovine serum albumin;

[0018] Preferably, the 10× DNA reaction buffer comprises 500 mM Tris-HCl, 100 mM MgCl2, 50 mM CaCl2 and 1% by volume Tween-20;

[0019] Preferably, the pH value of the 10× DNA reaction buffer is 7.5;

[0020] Preferably, the 2× lyophilization protective agent comprises 4%-10% by mass of trehalose and 6%-8% by mass of bovine serum albumin;

[0021] Preferably, the 2× lyophilization protectant comprises 6% by mass of trehalose and 8% by mass of bovine serum albumin.

[0022] The present application also provides a method for preparing the above-mentioned lyophilized reagent for detecting DNase activity, comprising:

[0023] The probe, the 10× DNA reaction buffer, the 2× lyophilization protectant and enzyme-free water are mixed and then freeze-dried to obtain the lyophilized reagent;

[0024] Preferably, the freeze-drying process includes: pre-freezing, sublimation drying and analytical drying;

[0025] The pre-freezing temperature is -60°C to -50°C, and the maintenance time is 120 minutes;

[0026] The sublimation drying temperature is -30°C to -20°C, the heating time from the pre-freezing temperature to -30°C is 30 minutes, the -30°C maintenance time is 180 minutes, the heating time from -30°C to -20°C is 30 minutes, and the -20°C maintenance time is 180 minutes;

[0027] The analytical drying temperature is 20° C. to 30° C., the heating time from -20° C. to the analytical drying temperature is 60 minutes, and the maintaining time is 180 minutes.

[0028] The present application also provides a lateral flow chromatography test strip for detecting DNase activity, comprising a bottom plate, a sample pad, a conjugate pad, a nitrocellulose membrane, and a water-absorbing pad;

[0029] The nitrocellulose membrane is fixed with a quality control line and a detection line, the quality control line is coated with streptavidin (for binding to biotin), and the detection line is coated with goat anti-rabbit IgG antibody; the conjugate pad is fixed with rabbit anti-6-carboxyfluorescein antibody (for binding to 6-carboxyfluorescein).

[0030] In some embodiments, the rabbit anti-6-carboxyfluorescein antibody is labeled by covalent coupling to red latex microspheres to form a rabbit anti-6-carboxyfluorescein antibody microsphere complex, and the microsphere complex is bound to the conjugate pad;

[0031] Preferably, the particle size of the red latex microspheres is 200 nm;

[0032] Preferably, the concentration of the streptavidin is 1 mg / mL; the concentration of the goat anti-rabbit IgG antibody is 1 mg / mL.

[0033] The present application also provides a kit for detecting DNase activity, comprising the above-mentioned probe for detecting DNase activity, or comprising the above-mentioned lyophilized reagent for detecting DNase activity, and comprising the above-mentioned lateral flow chromatography test strip for detecting DNase activity.

[0034] The present application also provides a method for detecting DNase activity, comprising:

[0035] Adding DNase or a sample to be detected into the above-mentioned freeze-dried reagent solution for detecting DNase activity to react and obtain a detection solution;

[0036] The lateral flow chromatography test strip for detecting DNase activity is inserted into the detection solution, and the DNase activity or whether the sample to be detected contains DNase is determined based on the quality control line and the detection line.

[0037] In some embodiments, the total reaction volume of the reaction is 20 μL, and if it is less than 20 μL, it is supplemented with enzyme-free water;

[0038] Preferably, the reaction temperature is 37°C and the reaction time is 30 min;

[0039] Preferably, the detection solution is supplemented to 60 μL by adding 40 μL of pure water diluent.

[0040] Compared with the prior art, the beneficial effects of this application include:

[0041] The method for detecting DNase activity provided by the present application is based on specific antigen-antibody reaction and immunochromatography technology, using a DNA probe labeled with 6-carboxyfluorescein at the 5' end and biotin at the 3' end as a substrate. When the sample to be tested contains DNase and is mixed with the substrate, an enzymatic reaction is carried out under suitable conditions. During this process, DNase will specifically recognize and cut the phosphodiester bond on the DNA probe, resulting in DNA fragmentation. Insert the test strip into the reagent after the reaction. When the sample does not contain DNase, the DNA probe will not be cleaved by enzymes, but will be fixed on the quality control line and combined with streptavidin. A red strip will appear on the quality control line, and the test strip detection line will not show color; when there is DNase in the sample, the DNA probe will be cleaved by enzymes and will be fixed on the detection line and combined with the secondary antibody, and a red strip will appear on the detection line. When all DNA probes in the sample are cleaved by enzymes, the quality control line will not show color.

[0042] The present application uses an immunoassay strip to identify whether the probe has been enzymatically degraded. Compared with traditional fluorescent probes, it can detect samples that are fluorescent in themselves and has a wider range of applications.

[0043] This application uses test strips to interpret the results, which has low sample requirements, simple operation, short interpretation time, accurate results, high sensitivity, low price, no need for large equipment, and can achieve rapid on-site testing.

[0044] The reaction reagent of the present application is a freeze-dried reagent, which is simpler to operate than a liquid reagent and does not require a reagent preparation step. Only the sample reagent needs to be added. At the same time, the freeze-dried reagent is more stable in storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope of the present application.

[0046] Figure 1 Schematic diagram of the process for detecting DNase activity of Example 1;

[0047] Figure 2 This is a diagram of the probe screening results of this application;

[0048] Figure 3 This is a graph showing the probe concentration optimization results for this application;

[0049] Figure 4 This is a graph showing the screening results of the 10× DNA reaction buffer of this application;

[0050] Figure 5 This is a diagram of the screening results of the lyoprotectant of this application;

[0051] Figure 6 This is a graph showing the optimization results of the 2× freeze-drying protective agent trehalose concentration in this application;

[0052] Figure 7 This is a graph showing the optimization results of the concentration of 2× lyophilization protectant bovine serum albumin in this application;

[0053] Figure 8 This is a diagram of the screening results of the 2× lyophilized protective agent of this application;

[0054] Fig. 9 This is a graph showing the detection limit of the kit for detecting DNase activity of the present application;

[0055] Fig.10 This is a graph showing the reproducibility of the kit for detecting DNase activity of the present application;

[0056] Fig.11 This is a graph showing the stability results of the kit for detecting DNase activity of the present application. DETAILED DESCRIPTION

[0057] As used herein:

[0058] "Prepared from" is synonymous with "comprising." As used herein, the terms "comprising," "including," "having," "containing," or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a composition, process, method, article, or apparatus that comprises the listed elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, process, method, article, or apparatus.

[0059] The conjunction "consisting of excludes any unspecified element, step, or component. If used in a claim, this phrase renders the claim closed-ended so that it does not include materials other than those described, except for conventional impurities associated therewith. When the phrase "consisting of" appears in a clause of the body of a claim rather than immediately following the subject matter, it limits only the elements described in that clause; other elements are not excluded from the claim as a whole.

[0060] When an amount, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper preferred values ​​and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pairing of any range upper limit or preferred value with any range lower limit or preferred value, regardless of whether the range is disclosed separately. For example, when a range of "1 to 5" is disclosed, the described range should be interpreted as including ranges "1 to 4", "1 to 3", "1 to 2", "1 to 2 and 4 to 5", "1 to 3 and 5", etc. When a numerical range is described in this article, unless otherwise stated, the range is intended to include its end values ​​and all integers and fractions within the range.

[0061] The embodiments of the present application will be described in detail below in conjunction with specific examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present application and should not be considered as limiting the scope of the present application. If specific conditions are not specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0062] (1) The main reagents used in the examples of this application are shown in Table 1 below.

[0063] Table 1 Reagent information

[0064] Reagent name Reagent Part Number Manufacturer Mannitol A600335 Bioengineering Glycine A422881 Bioengineering Trehalose A422870 Bioengineering BSA A610903 Bioengineering 1M Tris-HCl, pH 7.5 B548124 Bioengineering <![CDATA[MgCl2]]> A601336 Bioengineering <![CDATA[CaCl2]]> A501330 Bioengineering Tween-20 A600560 Bioengineering DNaseⅠ B618252 Bioengineering Rabbit anti-FAM antibody D261672 Bioengineering Streptavidin A610492 Bioengineering Goat anti-rabbit IgG antibody D111018 Bioengineering

[0065] (2) The main materials used in the examples of this application are shown in Table 2 below.

[0066] Table 2 Material information

[0067]

[0068]

[0069] (3) The main experimental instruments used in the examples of this application are shown in Table 3 below.

[0070] Table 3 Experimental instrument information

[0071] Instrument Name Instrument Model Manufacturer Mini Metal Bath G100517 Bioengineering Film Spraying Instrument HM3030 Shanghai Gold Label Strip cutting machine ZQ2002 Shanghai Gold Label Freeze Dryer Pilot2-4M BoYiKang

[0072] The probes used in the examples of this application were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0073] Example 1 Method for detecting DNase activity

[0074] See also Figure 1 The method for detecting DNase activity of the present application comprises the following steps:

[0075] 1. Add DNase or sample to the reaction tube containing the freeze-dried reagent of the probe for detecting DNase activity of the present application. The total reaction volume is 20 μL. If it is less than 20 μL, add enzyme-free water to make up.

[0076] 2. After vortexing and mixing, spin for a few seconds and place at 37℃ for 30 minutes. The reaction time can be extended appropriately.

[0077] 3. After the reaction is completed, add 40 μL of pure water to the reaction product to make up to 60 μL and mix well. Insert the sample pad end of the lateral flow chromatography test strip for detecting DNase activity of the present application into 60 μL of liquid, and the liquid level is not higher than the marked line.

[0078] 4. Record the test results in the interpretation area within 5 minutes after starting chromatography.

[0079] When there is a band in the detection area (T), it means that there is DNase in the sample, and the enzyme activity can be roughly judged based on the depth of the band.

[0080] Example 2 Design and screening of probes for detecting DNase activity

[0081] First, the following probes were designed and synthesized, and screening was performed based on the source and length of the probe sequences, and several probes of different sources and lengths were designed.

[0082] 1. Artificially designed nucleotide sequence probes

[0083] (1) SEQ ID NO.1: FAM 5’-ACTGACCGCGTATCCGTTCGGGT CATAAGAAGACAATCTGCAGGCATCCAGCCGTAGGGC-3’Biotin, full length 60bp;

[0084] (2) SEQ ID NO.2: FAM 5’-ACTGACCGCGTATCCGTTCGGGT CATAAGAAGACAATCTGCAGGCATCCAGCCGTAGGGCGTTCAGCAG AATCGTCAGGC-3’Biotin, full length 80bp;

[0085] (3) SEQ ID NO.3: FAM 5’-AAGTCTGCATGCAAGCATGCACG TTTGTACGTACCTACGTACGTACGTACGTACGCCGTAGCTAGCTACG GTTACGTAGT-3’Biotin, full length 80bp;

[0086] (4) SEQ ID NO.4: FAM 5’-AAGTCTGCATGCAAGCATGCACG TTTGTACGTACCTACGTACGTACGTACGTACGCCGTA-3’Biotin, full length 60bp;

[0087] (5) SEQ ID NO.5: FAM 5’-AAGTCTGCACGCAAGCAGGCACG TTTGGACGTACCTACGT-3’Biotin, full length 40bp.

[0088] 2. Natural nucleotide sequence probes

[0089] (6) SEQ ID NO.6: FAM 5’-ATACAGCTTTGGTGCCACCTGCGT GAAGAAGTGTCCCCGTAATTATGTGGTGACAGATCA-3’Biotin, full length 60bp;

[0090] (7) SEQ ID NO.7: FAM 5’-ATACAGCTTTGGTGCCACCTGCGT GAAGAAGTGTCCCCGTAATTATGTGGTGACAGATCACGGCTCGTGC GTCCGAGCCT-3’Biotin, full length 80bp;

[0091] (8) SEQ ID NO.8: FAM 5'-ACCTGCGTGAAGAAGTGTCCCCG TAATTATGTGGTGACAG-3'Biotin, full length 40bp;

[0092] (9) SEQ ID NO.9: FAM 5'-ATTCCAGCCCACATTGGATTCATC AGCATTTGGACCAATAGCCCACAGCTGAGAATGTGGAATACCTAAG GATAGCACCG-3'Biotin, full length 80bp;

[0093] (10) SEQ ID NO.10: FAM 5'-ATTCCAGCCCACATTGGATTCA TCAGCATTTGGACCAATAGCCCACAGCTGAGAATGTGG-3'Biotin, full length 60bp;

[0094] (11) SEQ ID NO. 11: FAM 5'-ATTCCAGCCCACATTGGATTCA TCAGCATTTGGACCAATA-3'Biotin, full length 40bp.

[0095] The six natural nucleotide sequence probes are all derived from the epidermal growth factor receptor (EGFR) gene of Homo sapiens (human).

[0096] Then, according to the detection scheme of Example 1, 0.5 pmol or more of the probe was added to each test, and the detection of 0.005 U / reaction DNase was tested. At the same time, enzyme-free water was used as a negative control. The results are as follows: Figure 2 shown.

[0097] from Figure 2 It can be seen from the results that when the negative control results are normal, the probes of SEQ ID NO.1 to SEQ ID NO.11 can all detect 0.005U / reaction DNase, indicating that the probes can be artificially designed nucleotide sequences or natural nucleotide sequences, and can be used with a length between 40bp and 80bp. Among them, the detection line (T) of SEQ ID NO.6 has the darkest band and the quality control line (C) is the lightest, so it has the best detection effect for 0.005U / reaction DNase and is used as a probe for subsequent experiments.

[0098] Example 3 Screening of freeze-dried reagents for detecting DNase activity

[0099] 1. Determination of probe concentration

[0100] Using SEQ ID NO.6 as the test probe, different probe input amounts (0.25pmol / 0.5pmol / 1pmol / 2pmol) were used in each test to test DNases of different concentration gradients (0.01U / reaction, 0.001U / reaction, 0.0005U / reaction and 0.0001U / reaction, and enzyme-free water as a negative control).

[0101] The results are as follows Figure 3 As shown, when the probe was added at 0.25pmol / reaction, a false positive occurred. When 2pmol / reaction was added, the sensitivity was poor, and only 0.001U / reaction was detected. Both 0.5pmol / reaction and 1pmol / reaction could detect 0.0005U / reaction without false positives, but the band of 0.0005U / reaction was weak at 1pmol / reaction, so the probe input amount was preferably 0.5pmol / reaction.

[0102] 2. Optimization of 10× DNA reaction buffer

[0103] First, in this experimental example, two 10× DNA reaction buffers were prepared according to Table 4, and then 2 μL of 10× DNA reaction buffer was added to each 20 μL reaction system, and 0.5 pmol SEQ ID NO.6 was used as the test probe to test the detection of DNase at different concentration gradients (0.01 U / reaction, 0.001 U / reaction and 0.0005 U / reaction, and enzyme-free water was used as a negative control).

[0104] Table 4 Compositions of two 10× DNA reaction buffers

[0105]

[0106] The results are as follows Figure 4 As shown, Buffer ① can detect to 0.001U / reaction, but the band is weak, Buffer ② can detect to 0.0005U / reaction, and the band is obvious. The detection effect of Buffer ② is obviously better than that of Buffer ①. Therefore, Buffer ② was determined as the final 10× DNA reaction buffer for subsequent experiments.

[0107] 3. Optimization of 2× lyophilization protectant

[0108] First, the lyoprotectant components were screened.

[0109] 10 μL of 4 2× lyophilized protective agents (8% by mass trehalose, 8% by mass sucrose, 8% by mass bovine serum albumin and 8% by mass glycine, prepared with water, respectively) were added to each 20 μL reaction system, so that the final concentration of the lyophilized protective agent was 4%. 2 μL of 10× DNA reaction buffer ② was added, and 0.5 pmol of SEQ ID NO.6 was used as the test probe to test different concentration gradients of DNase (0.01U / reaction, 0.001U / reaction, 0.0005U / reaction, 0.0001U / reaction, and enzyme-free water was used as a negative control).

[0110] The results are as follows Figure 5 As shown, the final concentration of trehalose and bovine serum albumin of 4% by weight has the best effect.

[0111] Further, trehalose and bovine serum albumin were selected and their added concentrations were screened.

[0112] 2× trehalose solutions were prepared with water with concentrations of 4%, 6%, 8% and 10% by mass, respectively. 10 μL of the above 2× trehalose solution was added to every 20 μL reaction system, and then 2 μL of 10× DNA reaction buffer was added②. Different concentration gradients of DNase (0.01U / reaction, 0.001U / reaction, 0.0005U / reaction, 0.00025U / reaction, 0.0001U / reaction) were tested using 0.5 pmol / reaction SEQ ID NO.6 as the test probe, and enzyme-free water was used as a negative control.

[0113] The results of different concentrations of trehalose are as follows Figure 6 As shown, the overall sensitivity is consistent. From the perspective of high concentration detection effect, trehalose with a final concentration of 3% by mass has the best effect.

[0114] Prepare 2× bovine serum albumin solution with water, with concentration of 6% and 8% by mass. Add 10 μL of the above 2× bovine serum albumin solution to each 20 μL reaction system, and then add 2 μL of 10× DNA reaction buffer ②, and test different concentration gradients of DNase (0.01U / reaction, 0.001U / reaction, 0.0005U / reaction, 0.00025U / reaction) with 0.5 pmol SEQID NO.6 as the test probe, and use enzyme-free water as a negative control.

[0115] Results of different bovine serum albumin Figure 7 As shown, the overall detection effect is consistent. From the 0.01U / reaction test group, the quality control line C of bovine serum albumin with a final concentration of 4% by mass is shallow, so bovine serum albumin with a final concentration of 4% by mass is selected.

[0116] Furthermore, the combination formula of 2× lyophilized protective agent was optimized, and three kinds of 2× lyophilized protective agents were prepared with water, including ①6% mass percentage of trehalose, ②8% mass percentage of bovine serum albumin, ③6% mass percentage of trehalose and 8% mass percentage of bovine serum albumin, and 10 μL of the above 2× lyophilized protective agent was added to each 20 μL reaction system, and then 2 μL of 10× DNA reaction buffer ② was added, and 0.5 pmol / reaction SEQ ID NO.6 was used as the test probe, and the amount was supplemented to 20 μL with water, and the reagent was lyophilized according to the lyophilization procedure shown in Table 5 of this application, and the detection effect after lyophilization was compared. After the reagents were lyophilized with three lyophilized protective agents, different concentration gradients of DNase (0.01U / reaction, 0.001U / reaction, 0.0005U / reaction, 0.00025U / reaction) were tested, and enzyme-free water was used as a negative control.

[0117] The results are as follows Figure 8 As shown, ③ a final concentration of 3% by mass of trehalose and 4% by mass of bovine serum albumin can detect 0.00025U / reaction without false positives, and has a high sensitivity. Therefore, 6% by mass of trehalose and 8% by mass of bovine serum albumin are selected as the preferred 2× lyoprotectant formulation.

[0118] Example 4 Kit for detecting DNase activity

[0119] 1. Preparation of lyophilized reagent for detecting DNase activity

[0120] (1) Reaction Buffer Preparation: First, prepare 10× DNA reaction buffer, which includes 500 mM Tris-HCl, 100 mM MgCl2, 50 mM CaCl2 and 1% by volume Tween-20, and adjust the pH value to 7.5.

[0121] (2) Preparation of lyophilization protective agent: 2× lyophilization protective agent was prepared with water, which included 6% by weight of trehalose and 8% by weight of bovine serum albumin.

[0122] (3) Lyophilization system composition: Prepare the lyophilized liquid reagent by adding 1 μL of DNA probe (0.5 μM), 2 μL of 10× DNA reaction buffer, 10 μL of 2× lyophilization protectant, and 7 μL of enzyme-free water per tube. Dispense into eight tubes and place on a metal ice plate.

[0123] (4) Freeze-drying program: Before preparing the freeze-dried reagent, turn on the freeze dryer and precool it to -55°C. After the reagent is prepared, place the metal ice plate containing the reagent on the freeze dryer plate layer, close the box, and set the freeze-drying program as shown in Table 5 below.

[0124] Table 5 Freeze-drying procedure

[0125]

[0126] (5) After freeze-drying, turn on the laboratory dehumidifier. When the humidity drops below 20%, start packaging the freeze-dried reagents. After the eight-tube tubes are covered, they are divided into aluminum foil bags, and desiccant is added. Vacuum, seal, and store at -20°C.

[0127] 2. Preparation of lateral flow chromatography test strips for detecting DNase activity

[0128] The chromatographic test strip includes a bottom plate, a nitrocellulose membrane, a conjugation pad, a sample pad, absorbent paper and a protective sticker (optional). A quality control line and a detection line are fixed on the nitrocellulose membrane, the quality control line is coated with streptavidin (1 mg / mL), and the detection line is coated with goat anti-rabbit IgG antibody (1 mg / mL). The conjugation pad is soaked in a conjugation pad treatment solution and dried. Rabbit anti-FAM antibody is covalently coupled to red latex microspheres to form a rabbit anti-FAM antibody microsphere complex, and the red microspheres have a particle size of 200 nm. The sample pad is soaked in a sample pad treatment solution and dried. The nitrocellulose membrane, conjugation pad, sample pad, absorbent paper and a protective sticker (optional) are sequentially adhered to the bottom plate to obtain a lateral flow chromatography test strip for detecting DNase activity.

[0129] The preparation method of the above test strip is as follows:

[0130] 1. Activation of latex microspheres and labeling of conjugates

[0131] (1) Prepare labeling activation buffer (1 L): 50 mM MES buffer, pH = 5.5-6.5.

[0132] (2) Prepare labeling coupling buffer (1 L): 50 mM MES buffer, pH = 6.5-7.5.

[0133] (3) Prepare labeling storage buffer (1 L): 50 mM boric acid-borax buffer, 20 g sucrose, 10 g casein, 1 mL Proclin-300, pH = 7.0-8.0.

[0134] (4) Add 0.9 mL of pure water into the activation container.

[0135] (5) Add 100 μL of microspheres to the activation container, mix well, and ultracentrifuge at 20,000 rpm / min in an ultracentrifuge for 10 minutes, and discard the supernatant.

[0136] (6) Add 1 mL of labeling activation buffer to the precipitate, disperse by ultrasonication, and stir until completely mixed.

[0137] (7) Add 0.5 mg NHS to the activation container and stir until completely mixed. Immediately add 0.5 mg EDC and stir until completely mixed. Stir and react for 10-20 minutes. After the reaction is completed, ultracentrifuge at 20,000 rpm / min in an ultracentrifuge for 10 minutes and discard the supernatant.

[0138] (8) Add 1 mL of labeling coupling buffer to the precipitate, disperse by ultrasonication, and stir until completely mixed.

[0139] (9) Add 0.4 mg of rabbit anti-FAM antibody to the activated microsphere solution, stir until completely mixed, and ultrasonically disperse for 1-2 minutes. Then react while stirring for 1-3 hours.

[0140] (10) After the coupling reaction time is over, add 100 μL of 10% BSA solution to the above solution, mix thoroughly and sonicate for 1 minute, then react with stirring for more than 2 hours.

[0141] (11) After the blocking reaction time is over, the above reaction solution is ultracentrifuged at 20,000 rpm / min in an ultracentrifuge for 10 minutes, and the supernatant is discarded. Then, 1 mL of the labeled storage buffer is added, ultrasonically dispersed, and stirred until completely mixed. Store in an environment of 2-8°C.

[0142] 2. Preparation of Sample Pad

[0143] The sample pad treatment solution includes (1L, pH = 7.0-8.0): 50mM phosphate buffer, 50g sucrose, 50g sodium chloride, 2g casein, 5mL Tween 20, 5mL Triton-100, 1mL Proclin-300. The sample pad is cut into 1.5cm×30cm specifications, soaked in the sample pad treatment solution for 1 minute, then taken out and spread on a drying net, and placed in a constant temperature drying oven for more than 12 hours (45°C).

[0144] 3. Preparation of the Conjugate Pad

[0145] The conjugate pad treatment solution includes (1L, pH = 7.0-8.0): 50mM phosphate buffer, 50g sucrose, 2g casein, 2g BSA, 1mL Proclin-300. Cut the blank conjugate pad into 30cm×1.1cm strips, soak them in the conjugate pad treatment solution for 1 minute, then take them out and spread them on a drying net, and put them in a constant temperature drying oven to dry for more than 12 hours (45°C).

[0146] The rabbit anti-FAM antibody latex solution prepared in step 1 was diluted 5 times with the labeling storage buffer, and then sprayed using a film scribing instrument with a spray volume of 5 μL / cm. After spraying, it was placed in a constant temperature drying oven for more than 12 hours (45° C.).

[0147] 4.NC membrane coating

[0148] Prepare coating buffer (1L, pH=7.0-8.0), including 50mM phosphate buffer and 20g sucrose. Dilute streptavidin to 1mg / mL with coating buffer, and dilute goat anti-rabbit IgG antibody to 1mg / mL with coating buffer, then use a film stripper, set the film stripping volume to 1μL / cm for film stripping. After film stripping, place in a constant temperature drying oven and dry for more than 12 hours (45°C).

[0149] 5.Assembly and cutting of test strips

[0150] Tear off the film on the bottom plate, and paste the NC membrane, conjugate pad, sample pad, absorbent paper and protective film (optional), with 1-2mm overlap between adjacent parts. Use a cutter to cut the test paper into strips with a width of 3mm.

[0151] Example 5 Detection limit of the kit for detecting DNase activity

[0152] DNaseⅠ (1U / μL) was diluted with enzyme-free water to 0.01U / μL, 0.001U / μL, 0.0005U / μL, and 0.00025U / μL, and the mixture was prepared so that 1μL of diluted DNase+19μL of water was added. 20μL of each mixture was added to the freeze-drying system, and the kit of Example 4 was used to perform the detection method according to the procedure of Example 1.

[0153] The results are as follows Fig. 9 As shown, the kit for detecting DNase activity of the present application can detect up to 0.00025U / reaction, but the band is relatively shallow. Therefore, the detection limit of the kit is 0.0005U / reaction.

[0154] Example 6 Repeatability of the kit for detecting DNase activity

[0155] To illustrate the repeatability of the product, the same batch of freeze-dried reagents was used to test 0.0005U / reaction, and repeated 10 times. DNaseⅠ (1U / μL) was diluted to 0.0005U / μL with enzyme-free water, and 1μL of diluted DNase+19μL of water was prepared. 20μL was added to the freeze-dried system, and the detection method of Example 1 was followed.

[0156] The results are as follows Fig.10 As shown, 0.0005U / reaction can be detected 100%, with good repeatability.

[0157] Example 7 Stability of the kit for detecting DNase activity

[0158] The kits of the same batch were placed at 42°C for 7 / 14 / 30 days, and different concentration gradients of DNase (0.01U / reaction, 0.001U / reaction, 0.0005U / reaction, 0.0002U / reaction) were tested respectively, and enzyme-free water was used as a negative control. DNase I (1U / μL) was diluted with enzyme-free water to 0.01U / μL, 0.001U / μL, 0.0005U / μL, 0.0002U / μL, and 1μL of diluted DNase + 19μL of water was prepared, and 20μL was taken and added to the freeze-dried system, and the detection method according to Example 1 was operated.

[0159] The results are as follows Fig.11 As shown, the results of the heat treatment at 42° C. are consistent with those of the non-heat treatment, and the detection limit is still 0.0005 U / reaction. The kit for detecting DNase activity of the present application has good stability.

[0160] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.

[0161] In addition, those skilled in the art will appreciate that, although some embodiments herein include certain features included in other embodiments but not other features, the combination of features of different embodiments is meant to be within the scope of the present application and form different embodiments. For example, in the above claims, any one of the claimed embodiments may be used in any combination. The information disclosed in this background technology section is intended only to deepen the understanding of the overall background technology of the present application and should not be regarded as an admission or in any form of implication that the information constitutes prior art known to those skilled in the art.

Claims

1. A probe for detecting DNase activity, characterized in that: The probe is a single-stranded DNA of 20-80 nucleotides, the 5' end of the probe is labeled with 6-carboxyfluorescein, and the 3' end of the probe is labeled with biotin.

2. The probe for detecting DNase activity according to claim 1, characterized in that The probe is used at a concentration of 0.5-1 pmol / reaction; Preferably, the probe is used at a concentration of 0.5 pmol / reaction.

3. A freeze-dried reagent for detecting DNase activity, characterized in that: The invention comprises the probe for detecting DNase activity as described in claim 1 or 2.

4. The freeze-dried reagent for detecting DNase activity according to claim 3, characterized in that: Also included are 10× DNA reaction buffer and 2× lyoprotectant; The 10× DNA reaction buffer comprises Tris-HCl, MgCl2, CaCl2 and Tween-20; The 2× lyophilization protective agent includes trehalose and bovine serum albumin; Preferably, the 10× DNA reaction buffer comprises 500 mM Tris-HCl, 100 mM MgCl2, 50 mM CaCl2 and 1% by volume Tween-20; Preferably, the pH value of the 10× DNA reaction buffer is 7.5; Preferably, the 2× lyophilization protective agent comprises 4%-10% by mass of trehalose and 6%-8% by mass of bovine serum albumin; Preferably, the 2× lyophilization protectant comprises 6% by mass of trehalose and 8% by mass of bovine serum albumin.

5. A method for preparing a freeze-dried reagent for detecting DNase activity according to claim 3 or 4, characterized in that: include: The probe, the 10× DNA reaction buffer, the 2× lyophilization protectant and enzyme-free water are mixed and then freeze-dried to obtain the lyophilized reagent; Preferably, the freeze-drying process includes: pre-freezing, sublimation drying and analytical drying; The pre-freezing temperature is -60°C to -50°C, and the maintenance time is 120 minutes; The sublimation drying temperature is -30°C to -20°C, the heating time from the pre-freezing temperature to -30°C is 30 minutes, the -30°C maintenance time is 180 minutes, the heating time from -30°C to -20°C is 30 minutes, and the -20°C maintenance time is 180 minutes; The analytical drying temperature is 20° C. to 30° C., the heating time from -20° C. to the analytical drying temperature is 60 minutes, and the maintaining time is 180 minutes.

6. A lateral flow chromatography test strip for detecting DNase activity, characterized in that: Including base plate, sample pad, conjugate pad, nitrocellulose membrane, absorbent pad; A quality control line and a detection line are fixed on the nitrocellulose membrane, the quality control line is coated with streptavidin, and the detection line is coated with goat anti-rabbit IgG antibody; and the conjugate pad is fixed with rabbit anti-6-carboxyfluorescein antibody.

7. The lateral flow chromatography test strip for detecting DNase activity according to claim 6, characterized in that: The rabbit anti-6-carboxyfluorescein antibody is labeled to red latex microspheres by covalent coupling to form a rabbit anti-6-carboxyfluorescein antibody microsphere complex, and the microsphere complex is bound to the conjugate pad; Preferably, the particle size of the red latex microspheres is 200 nm; Preferably, the concentration of the streptavidin is 1 mg / mL; the concentration of the goat anti-rabbit IgG antibody is 1 mg / mL.

8. A kit for detecting DNase activity, characterized in that: The invention comprises the probe for detecting DNase activity as described in claim 1 or 2, or the freeze-dried reagent for detecting DNase activity as described in claim 3 or 4, and the lateral flow chromatography test strip for detecting DNase activity as described in claim 6 or 7.

9. A method for detecting DNase activity, characterized in that: include: Adding DNase or a sample to be detected into the freeze-dried reagent solution for detecting DNase activity according to claim 3 or 4 to react and obtain a detection solution; Insert the lateral flow chromatography test strip for detecting DNase activity according to claim 6 or 7 into the detection solution, and judge the DNase activity or whether the sample to be detected contains DNase according to the strips of the quality control line and the detection line.

10. The method for detecting DNase activity according to claim 9, characterized in that: The total reaction volume of the reaction was 20 μL, and if it was less than 20 μL, it was supplemented with enzyme-free water; Preferably, the reaction temperature is 37°C and the reaction time is 30 min; Preferably, the detection solution is supplemented to 60 μL by adding 40 μL of pure water diluent.

Images