Camptotheca acuminate CaTTG1 transcription factor and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and discloses a camptotheca acuminate CaTTG1 transcription factor and application thereof. The nucleotide sequence of the camptotheca acuminate CaTTG1 transcription factor is as shown in SEQ ID NO.1, and the amino acid sequence of the polypeptide translated from the camptotheca acuminate CaTTG1 transcription factor is as shown in SEQ ID NO.2. The CaTTG1 can promote the expression of a key enzyme gene in a camptothecin biosynthetic pathway, and HPLC (High Performance Liquid Chromatography) result analysis shows that the maximum camptothecin content in camptothecin leaves is 533 mu g / g and is 1.9 times that of a control group.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to a camptotheca acuminata CaTTG1 transcription factor and an application thereof. Background Art

[0002] Camptotheca acuminata is a tree species unique to my country. It belongs to the genus Camptotheca of the family Cyperaceae. It is a perennial subtropical deciduous broad-leaved tree. Its aliases include Dryopteris wood and Qianzhang tree. Camptotheca acuminata belongs to the genus Camptotheca of the family Cyperaceae. It is a tall deciduous tree unique to my country and a fast-growing and high-yielding excellent tree species. Camptotheca acuminata contains an alkaloid with anti-cancer effects - Camptothecin. Camptothecin has multiple pharmacological effects, mainly including anti-cancer, anti-inflammatory, analgesic, immunomodulatory and neuroprotective. Among them, anti-cancer effect is one of the most significant and important pharmacological effects of Camptothecin. Studies have found that the epidermal hairs on young leaves are the main accumulation site of Camptothecin. Therefore, the regulation of Camptotheca acuminata epidermal hairs is of great significance for regulating the synthesis of Camptothecin.

[0003] A protein containing a WD40 domain is called a WD40 protein, which constitutes a large protein family. The WD40 domain is generally composed of multiple WD40 repeats, often in the form of a β-propeller domain. WD40repeat refers to a repeating unit consisting of 44 to 60 amino acid residues, with a GH (Gly-His) dipeptide at its n-terminus and a WD (Trp-Asp) dipeptide at its C-terminus. WD40repeat (WDR) is composed of a four-stranded antiparallel β-fold, and its folding stability is maintained by a hydrogen bond network between amino acid residues. WDR proteins are involved in the production of plant epidermal hairs and root hairs. In plants, the WDR protein TTG1 is an important protein closely related to the development of root hairs and epidermal hairs. The functions of TTG1 are conserved in different plants, such as regulating the initiation of trichomes, the formation of root hairs, the biosynthesis of flavonoids, and the secretion of seed coat mucilage. TTG1 has been found to play a regulatory role in many aspects such as plant growth and development, secondary metabolism, and plant response to environmental stimuli, and its mechanism of action has also been widely studied. Summary of the invention

[0004] In order to overcome the deficiencies of the prior art, the present invention provides a camptotheca CaTTG1 transcription factor and its application. The present invention provides a new high-quality drug source for producing camptothecin with broad-spectrum anti-cancer efficacy, which has important theoretical significance and potential application value.

[0005] The above object of the present invention is achieved through the following technical solution: a Camptotheca acuminata CaTTG1 transcription factor, whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] Another object of the present invention is to protect the polypeptide translated from the above-mentioned Camptotheca acuminata CaTTG1 transcription factor, whose amino acid sequence is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to protect a recombinant expression transformation strain, which is obtained by constructing the above nucleotide sequence into an expression vector and transferring the recombinant expression vector into Agrobacterium.

[0008] Another object of the present invention is to protect a method for increasing the camptothecin content in Camptotheca acuminata by using the above-mentioned CaTTG1 transcription factor, the steps of which are as follows:

[0009] 1. The transcriptome database of Camptotheca acuminata was analyzed and the coding sequence of the Camptotheca acuminata CaTTG1 gene was cloned from the Camptotheca acuminata cDNA library.

[0010] 2. The CaTTG1 gene is operably connected to an expression regulatory sequence to form a plant overexpression vector containing the CaTTG1 gene.

[0011] 3. Transform the plant overexpression vector containing the CaTTG1 gene into Agrobacterium to obtain an Agrobacterium strain having the plant overexpression vector.

[0012] 4. Use the Agrobacterium strain constructed in step 3 to transform the shoot apical meristem of Camptotheca acuminata, and then detect the expression level of the CaTTG1 gene by qRT-PCR. The shoot apical meristem of Camptotheca acuminata with a gene expression level higher than that of the wild type is the Camptotheca acuminata leaf overexpressing CaTTG1.

[0013] 5. Determine the camptothecin content of the Camptotheca acuminata leaves overexpressing CaTTG1 obtained in step 4, thereby obtaining Camptotheca acuminata with increased camptothecin content.

[0014] Wherein, the step 3 adopts Agrobacterium-mediated transformation, and the Agrobacterium is the GV3101 strain.

[0015] Furthermore, the plant expression vector used in step 2 is a modified vector, comprising a CaMV promoter and a NOS terminator, a multiple cloning site, a replication origin and a kanamycin resistance site.

[0016] Furthermore, the qRT-PCR detection method in step 4 is: designing CaTTG1 upstream and downstream specific primers, and detecting by qRT-PCR that the leaves of Camptotheca acuminata with CaTTG1 expression levels higher than that of the wild type are plants that overexpress CaTTG1.

[0017] Furthermore, in step 5, the density of epidermal hairs of Camptotheca acuminata leaves is observed under a confocal microscope to select Camptotheca acuminata with increased Camptothecin content.

[0018] In one embodiment of the present invention, qRT-PCR is used to detect the expression of the CaTTG1 gene, epidermal hairs and key enzyme genes in the camptothecin biosynthesis pathway in the acuminata overexpressing CaTTG1. The qRT-PCR detection method is as follows: extracting total RNA from plants identified as overexpressed by qRT-PCR, quantifying it to 0.5 μg, and reverse transcribing it into cDNA; designing quantitative primers for the key enzyme genes and internal reference genes in the CaTTG1 and camptothecin biosynthesis pathway, and performing quantitative PCR analysis using the same amount of cDNA as a template; using Methods The expression of related genes was analyzed.

[0019] In one embodiment of the present invention, a confocal microscope is used to observe the density of epidermal hairs. The confocal microscope method is as follows: When a leaf is placed under 360nm UV light, the secretory ducts and glandular hairs of Camptotheca acuminata exhibit blue-green autofluorescence, and the color of the camptothecin standard under a fluorescence microscope and the color of camptothecin in thin layer chromatography also exhibit the same blue-green color, so it is believed that camptothecin is mainly accumulated in the epidermal hairs. The number of epidermal hairs can be judged by the number of fluorescence, and then Camptotheca acuminata with a high camptothecin content can be screened.

[0020] In one embodiment of the present invention, in step 5, the content of camptothecin in the camptotheca overexpressing CaTTG1 is determined by high performance liquid chromatography, and the high performance liquid chromatography is as follows: 20 μL of crude camptothecin extract is taken from each strain overexpressing CaTTG1 and injected into a high performance liquid chromatograph. The chromatographic conditions used are: the chromatographic column uses a C-18 reverse phase silica gel column, acetonitrile: water = 35:65 (V:V) as the mobile phase, the column temperature is set to 30°C, the flow rate is 1 mL / min, and the detection wavelength is 254 nm.

[0021] The beneficial effects of the present invention compared with the prior art are:

[0022] The present invention discloses a metabolic engineering method for increasing the camptothecin content in Camptotheca acuminata by using a CaTTG1 transcription factor. The present invention clones a CaTTG1 transcription factor from Camptotheca acuminata, constructs a subcellular localization vector thereof, constructs a plant overexpression and inhibition expression vector, genetically transforms the shoot apex meristem of Camptotheca acuminata, and obtains Camptotheca acuminata leaves overexpressing CaTTG1, and uses qRT-PCR to analyze the expression of key enzyme genes in the camptothecin synthesis pathway in the strain overexpressing CaTTG1; the present invention's CaTTG1 can promote the expression of key enzyme genes in the camptothecin biosynthesis pathway, and HPLC results show that the camptothecin content in Camptotheca acuminata leaves is as high as 533 μg / g, which is 1.9 times that of the control group. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0024] Figure 1 This is a schematic diagram of the expression level of CaTTG1 detected by fluorescent real-time quantitative PCR in leaves of the tree overexpressing the CaTTG1 gene in an embodiment of the present invention, showing that the expression level of the CaTTG1 gene is increased;

[0025] Figure 2 This is a schematic diagram of the density of Camptotheca acuminata epidermal hairs observed under a cofocal microscope in an implementation case of the present invention.

[0026] Figure 3 This is a schematic diagram of the expression levels of epidermal hair synthesis genes CaEGL3, CaGIS2, CaMYB23, CaTCL1b, CaTTG1b, and CaGIS1 detected by fluorescent real-time quantitative PCR in leaves of Camptotheca acuminata overexpressing the CaTTG1 gene in an embodiment of the present invention, showing that the expression levels of CaEGL3, CaTTG1b, and CaGIS1 genes are significantly increased;

[0027] Figure 4 This is a schematic diagram of the expression levels of camptothecin synthesis genes Ca7DLS, CaSTR, Ca7DLGT, CaG80, and CaCYC1 detected by fluorescent real-time quantitative PCR in leaves of Camptotheca acuminata overexpressing the CaTTG1 gene in an embodiment of the present invention, showing that the expression levels of the Ca7DLS, CaG80, and CaCYC1 genes are significantly increased;

[0028] Figure 5 This is a schematic diagram of detecting the content of camptothecin in leaves of Camptotheca acuminata overexpressing the CaTTG1 gene by HPLC in an example of the present invention, showing that camptothecin increased in the overexpression strain. DETAILED DESCRIPTION

[0029] The present invention is described in detail below by specific examples, but the protection scope of the present invention is not limited. Unless otherwise specified, the experimental methods used in the present invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can be obtained from commercial channels.

[0030] Example 1: Cloning of Camptotheca acuminata CaTTG1 gene

[0031] A small amount of Camptotheca acuminata shoot apex meristem was taken, frozen with liquid nitrogen, and quickly ground with a mortar, added to a 1.5 mL Eppendorf (EP) centrifuge tube containing lysis solution, and after sufficient shaking, total RNA was extracted according to the instructions of the TIANGEN kit. The RNA quality was tested by agarose gel electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0032] 2. Cloning of Camptotheca acuminata CaTTG1 gene

[0033] The extracted total RNA was used as a template and then reverse transcribed to synthesize cDNA; gene-specific primers were designed according to the sequence of the CaTTG1 gene, as shown in Table 1, and the CaTTG1 gene was amplified from the total cDNA by PCR amplification and sequenced.

[0034] Table 1 PCR primers

[0035] Primer name Primer sequence (5'-3') CaTTG1-F7 (SEQ ID NO. 3) TCTTCCGATCTCTCTCCTTC CaTTG1-R1250 (SEQ ID NO. 4) GCAAACACACAACCAAGATC

[0036] Through the above steps, the full-length coding sequence of the transcription factor in Camptotheca acuminata was obtained as shown in SEQ ID NO.1 and the protein coding sequence was deduced as shown in SEQ ID NO.2, wherein the start codon is ATG and the stop codon is TAG.

[0037] Example 2: Construction of a plant overexpression vector containing the CaTTG1 gene

[0038] The CaTTG1 gene was constructed on the plant expression vector pBI121-GD. To facilitate the construction of the expression vector, the primers were introduced with restriction sites for double restriction digestion by Xba I and Kpn I. The primers are shown in Table 2

[0039] Table 2 PCR primers for constructing pBI121-GD-CaTTG1 vector

[0040]

[0041] In this embodiment, the transcription factor CaTTG1 involved in regulating epidermal hairs and camptothecin synthesis is operably linked to the expression regulatory sequence, and a plant overexpression vector pBI121-GD-CaTTG1 containing the CaTTG1 gene is constructed. This expression vector can be used to increase the density and number of epidermal hairs of Camptotheca acuminata and improve the camptothecin content through metabolic engineering strategies.

[0042] Example 3: Agrobacterium-mediated genetic transformation of CaTTG1 overexpression vector into the shoot apical meristem of Camptotheca acuminata to obtain leaves of Camptotheca acuminata overexpressing CaTTG1

[0043] 1. Obtaining Agrobacterium engineered bacteria containing overexpression of CaTTG1 gene

[0044] The plant expression vector containing the CaTTG1 gene in Examples 2 and 3 was transformed into Agrobacterium (such as GV3101, a biological material available on the market) by Agrobacterium-mediated method, and PCR verification was performed.

[0045] 2. Agrobacterium-mediated genetic transformation of CaTTG1 gene into tree stem apical meristem

[0046] 2.1 Pre-culture of explants

[0047] Take healthy and tough Camptotheca acuminata branches, keep only the buds on the branches, place them on B5 medium for pre-culture, culture them under light at 25°C for about a month, and wait for the explants to grow fresh tender stems. Take the explants out of the bud culture medium, cut off the tender buds in a sterile environment and insert them into the rooting medium. Wait for them to take root, and culture them again for about a month to obtain rooted Camptotheca acuminata seedlings. When the Camptotheca acuminata seedlings grow to a height of about 10 cm, move them to sterile nutrient soil. Healthy sterile Camptotheca acuminata seedlings will be obtained in about 4 months.

[0048] 2.2 Co-cultivation of Agrobacterium and explants

[0049] (1) Take 200 μL of successfully transformed and verified Agrobacterium culture medium and add it to 50 mL of LB liquid medium containing inducer and antibiotics. Shake at 180 rpm at 28°C until the OD600nm reaches 0.6-0.8.

[0050] (2) Take 50 mL of bacterial solution and add it to 50 mL centrifuge tubes in two portions. Centrifuge at 6000 rpm for 5 min and remove the supernatant.

[0051] (3) Add 10 mL of freshly prepared infection solution and resuspend the precipitate.

[0052] (4) Shake at 180 rpm, 28°C, for 3 h to start infecting the shoot apical meristem of Camptotheca acuminata.

[0053] (5) Use a syringe with a needle to draw up the prepared infection solution and gently inject it into the meristem of the stem tip of the plant.

[0054] 2.3 Culture of shoot apical meristem of Camptotheca acuminata

[0055] After 14 days of growth under 16 h light intensity and 25 °C temperature, new leaves were collected.

[0056] Example 4: Detection of the expression of related genes in leaves of Camptotheca acuminata overexpressing CaTTG1 using qRT-PCR

[0057] Culture of the shoot apical meristem of Camptotheca acuminata

[0058] The first part is to take healthy and tough Camptotheca acuminata branches, keep only the buds on the branches, place them on B5 culture medium for pre-culture, and culture them under light conditions at 25°C for about one month until the explants grow fresh tender stems. The explants are taken out of the bud culture medium, and the tender buds are cut off in a sterile environment and inserted into the rooting culture medium. After they take root, they are cultured again for about one month to obtain rooted Camptotheca acuminata seedlings. When the Camptotheca acuminata seedlings grow to a height of about 10 cm, they are moved to sterile nutrient soil. Healthy sterile Camptotheca acuminata seedlings are obtained in about 4 months.

[0059] The second part is to obtain the leaves of the Acuminata spp. Weigh the weight of the EP tube without RNAse, record it and set it aside. Put the leaves in a clean grinding dish, pour liquid nitrogen and quickly grind them into powder. Quickly put the ground samples into the EP tube without RNAse and freeze them in liquid nitrogen. After collecting the samples, weigh the samples of the liquid phase group to obtain the fresh weight of the samples. Store the collected samples at -80℃.

[0060] 3. qRT-PCR detection of leaves of Camptotheca acuminata overexpressing CaTTG1

[0061] RNA was extracted from leaves of the tree overexpressing CaTTG1 and then reverse transcribed into cDNA. qRT-PCR was used to analyze the expression of CaTTG1 gene, epidermal hair synthesis gene,

[0062] The transcriptional expression levels of CaEGL3, CaGIS2, CaMYB23, CaTCL1b, CaTTG1b, CaGIS1 and camptothecin biosynthesis genes Ca7DLS, CaSTR, Ca7DLGT, CaG80, and CaCYC1 (primers are shown in Table 3) were detected. The results of qRT-PCR analysis showed that in the leaves of the overexpressed CaTTG1 gene, the expression levels of CaTTG1, epidermal hair synthesis genes CaEGL3, CaTTG1b, CaGIS1 and camptothecin biosynthesis genes Ca7DLS, CaG80, and CaCYC1 were increased (see Figure 1 , 3, 4)

[0063] Table 3 qRT-PCR primers

[0064]

[0065]

[0066]

[0067] Example 5: Determination of Camptothecin Content in Leaves of Camptotheca acuminata Overexpressing CaTTG1 by HPLC

[0068] 1. Extraction of Camptothecin from Camptotheca acuminata Leaves

[0069] The above-mentioned leaves of the camptothecin tree dried to constant weight were taken out, ground into powder, 0.1g of powder was weighed and loaded into a 50mL centrifuge tube; about 20mL of chromatographically pure methanol was added, the centrifuge tube cap was tightly closed, and sealed with a sealing film, vortexed for 3min to mix, and then placed in an ultrasonic water bath for extraction for 1 hour, and then the sonicated mixture was placed in a 50°C oven and allowed to stand overnight; the next day, centrifuged at 12,000rpm for 10min in a centrifuge, the supernatant was taken after centrifugation, and the supernatant was evaporated to dryness using a vacuum rotary evaporator, and the evaporation temperature was set to 70°C. After the evaporation was completed, it was redissolved with chromatographically pure methanol, and the final volume was 2mL, and then filtered, and the filtration was filtered with a 0.22μm organic phase filter membrane. The crude extract of camptothecin obtained after filtration was stored at -20°C for later use.

[0070] 2. HPLC determination of camptothecin in Camptotheca acuminata leaves

[0071] First, prepare the camptothecin standard and make a standard curve. The camptothecin standard is prepared as follows: weigh 1 mg of camptothecin standard on an analytical balance and place it in a small beaker. Add 10 mL of methanol to the beaker, then ultrasonicate the small beaker in a water bath in an ultrasonicator for 10-20 minutes. After complete dissolution, the standard solution has a final concentration of 100 μg / mL. When measuring the standard, dilute it to multiple different concentration gradients to make a standard curve.

[0072] Take 20 μL of the camptothecin crude extract and inject it into a high performance liquid chromatograph. The chromatographic column used is a C-18 reverse phase silica gel column (Symmetry Shield TM C18, 5 μm, 250x4.6 mm, Waters); the chromatographic conditions are: mobile phase acetonitrile: water = 35:65; column temperature 30°C; flow rate is set to 1 mL / min; detection wavelength is set to 220 nm. After the detection is completed, the peak area of ​​the camptothecin component of each sample is recorded in the HPLC, and the peak area is substituted into the above standard curve, and the calculated result is the camptothecin content in the sample.

[0073] In the present invention, in terms of total yield, compared with the control, the camptothecin content in the leaves of the overexpressed CaTTG1 was significantly increased. HPLC analysis showed that the highest camptothecin content in the leaves of the camptothecin plant was 533 μg / g, which was 1.9 times that of the control group.

[0074] The above-described embodiments are only preferred embodiments of the present invention, but not all feasible embodiments of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A Camptotheca acuminata CaTTG1 transcription factor, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

2. The polypeptide translated from the Camptotheca acuminata CaTTG1 transcription factor according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

3. A recombinant expression transformation strain, characterized in that: The recombinant expression transformation strain is obtained by constructing the nucleotide sequence shown in SEQ ID NO.1 into an expression vector and transforming the recombinant expression vector into Agrobacterium.

4. A method for increasing the camptothecin content in Camptotheca acuminata, characterized in that: Using the Camptotheca acuminata CaTTG1 transcription factor as claimed in claim 1, the steps are as follows: S1. The transcriptome database of Camptotheca acuminata was analyzed, and the coding sequence of the Camptotheca acuminata CaTTG1 gene was cloned from the Camptotheca acuminata cDNA library. S2. The CaTTG1 gene is operably connected to an expression regulatory sequence to form a plant overexpression vector containing the CaTTG1 gene. S3. Transform Agrobacterium with the plant overexpression vector containing the CaTTG1 gene to obtain an Agrobacterium strain having the plant overexpression vector. S4. Using the Agrobacterium strain constructed in step S3 to transform the shoot apical meristem of Camptotheca acuminata, and then detecting the expression level of the CaTTG1 gene by qRT-PCR. The shoot apical meristem of Camptotheca acuminata with a gene expression level higher than that of the wild type is the Camptotheca acuminata leaf overexpressing CaTTG1. S5. Determine the camptothecin content of the Camptotheca acuminata leaves overexpressing CaTTG1 obtained in step S4, thereby obtaining Camptotheca acuminata with increased camptothecin content.

5. The method for increasing the camptothecin content in Camptotheca acuminata according to claim 4, characterized in that: The plant expression vector used in step S2 is a modified vector, which contains a CaMV promoter and a NOS terminator, a multiple cloning site, a replication origin and a kanamycin resistance site.

6. The method for increasing the camptothecin content in Camptotheca acuminata according to claim 4, characterized in that: The step S3 is carried out by Agrobacterium-mediated transformation, and the Agrobacterium is the GV3101 strain.

7. The method for increasing the camptothecin content in Camptotheca acuminata according to claim 4, characterized in that: The qRT-PCR detection method in step S4 is: designing CaTTG1 upstream and downstream specific primers, and detecting by qRT-PCR that the expression level of CaTTG1 in the leaves of Camptotheca acuminata is higher than that of the wild type is a plant that overexpresses CaTTG1.

8. The method for increasing the camptothecin content in Camptotheca acuminata according to claim 4, characterized in that: In the step S5, the density of hairs on the leaf epidermis of Camptotheca acuminata is observed by confocal microscopy to select Camptotheca acuminata with increased Camptothecin content.

9. The method for increasing the camptothecin content in Camptotheca acuminata according to claim 8, characterized in that: The specific steps of confocal microscopy observation are as follows: the leaves are placed under 360nm UV light, and the secretory ducts and glandular hairs of Camptotheca acuminata show blue-green autofluorescence, and the color of the camptothecin standard under the fluorescence microscope and camptothecin in thin layer chromatography also show the same blue-green color. Therefore, it is believed that camptothecin is mainly accumulated in the epidermal hairs, and the number of epidermal hairs is judged by the amount of fluorescence, thereby screening Camptotheca acuminata with high camptothecin content.

Images