Neurospora crassa and application of Neurospora crassa in preparation of red fungus bean curd

Abstract

The invention belongs to the technical field of microorganisms and food fermentation, and discloses neurospora crassa and application thereof in preparation of red fungus bean curd. The Neurospora crassa ZK is preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on October 21, 2024, and the preservation number of the Neurospora crassa ZK is GDMCC No: 65602. The neurospora crassa ZK is obtained through simple separation and screening, has the advantages of being high in reproductive capacity and high in growth speed, and has the advantages of being short in fermentation time and improving taste when being used for preparing the red fungus bean curd.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and food fermentation, and particularly relates to a strain of Neurospora crassa and application thereof in preparing red fungus tofu. Background Art

[0002] Neurospora crassa (N.crassa) is a multicellular filamentous fungus widely distributed in the soil and grass plants in nature. It is particularly easy to grow on corn cobs and cottonseed hulls. The most important biological activity of this fungus is its strong ability to produce carotenoids. It can also effectively decompose cellulose and is a fermentation strain for preparing red fungus tofu. In nature, N.crassa strain resources are very rich, but the red fungus tofu produced by different N.crassa strains have different tastes and cannot be used for industrial production of red fungus tofu with stable quality, bright color and fine quality.

[0003] Patent CN 114395490 A discloses a strain of Neurospora crassa W3, which improves its ability to degrade biomass materials through ARTP mutagenesis, and can grow normally with insoluble / soluble lignin as the only carbon source. However, it has not been verified that it has the advantages of strong reproductive ability and fast growth rate, nor has it been verified that it has the characteristics of short fermentation time and improved taste when used to prepare red fungus tofu. Summary of the invention

[0004] In view of the shortcomings and deficiencies of the above prior art, the primary purpose of the present invention is to provide a strain of Neurospora crassa.

[0005] Another object of the present invention is to use the above Neurospora crassa as a fermentation strain in the preparation of red fungus tofu.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A strain of Neurospora crassa N.crassa ZK, whose classification name is Bacillus subtilis, was deposited in Guangdong Provincial Microbiological Culture Collection Center (GDMCC) on October 21, 2024, and the deposit number is: GDMCCNo:65602.

[0008] The isolation and screening steps of Neurospora crassa ZK are as follows:

[0009] (1) A large number of samples were collected from Guizhou red fungus tofu, and an appropriate amount of red fungus tofu was weighed and placed in PDB liquid culture medium (the culture medium formula was: potato extract powder 6.0 g / L, glucose 20.0 g / L, pH 5.6, and the rest was water) and cultured at 28°C.

[0010] (2) Select an appropriate amount of bacteria from the PDB liquid culture medium, inoculate it into the solid culture medium using the five-point inoculation method, and culture it at 28°C for 24 hours. Then open the lid and humidify it for 24 hours.

[0011] (3) Take the strain with relatively long mycelium in the solid culture medium, put it into PDB liquid culture medium, repeat the above steps (1) and (2) to obtain Neurospora crassa ZK.

[0012] The selected N.crassa ZK strains were numbered and stored in glycerol tubes at -80°C for long-term storage and at 4°C for temporary storage.

[0013] The use of the Neurospora crassa as a fermentation strain in the preparation of red fungus tofu comprises the following steps:

[0014] (1) Activation of N. crassa ZK

[0015] Neurospora crassa ZK was inoculated into potato dextrose agar (PDA) medium for culture, and the spore powder produced was collected and preserved;

[0016] (2) Preparation of red mushroom tofu

[0017] The sterilized fresh bean dregs are filtered, fried, and then inoculated with the spore powder of step (1) for fermentation and culture to obtain fermented red fungus tofu.

[0018] Furthermore, the culturing in step (1) refers to culturing in an incubator at a temperature of 26 to 30° C. for 36 to 48 hours.

[0019] Furthermore, the spore powder storage in step (1) refers to storage in a refrigerator at 0-8°C.

[0020] Furthermore, the filtration in step (2) refers to filtration using a 10-40 mesh screen.

[0021] Furthermore, the frying in step (2) refers to frying until the moisture content is 70% to 80%.

[0022] Furthermore, the inoculation amount of the spore powder in step (2) is 0.2-2 wt.%.

[0023] Furthermore, in step (2), the fermentation culture temperature is 26-30° C., and the humidity is 70%-80%.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) The Neurospora crassa ZK screened by the present invention has strong reproductive ability, fast growth rate, short fermentation time, and the characteristic of adhering to the wall for growth.

[0026] (2) The present invention uses Neurospora crassa ZK to develop bean dregs into food, thereby obtaining healthy food materials with delicious taste, delicate taste, and extremely high content of soluble dietary fiber, small molecule protein peptides and carotenoids. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figures 1 to 3 This is a microscopic observation picture of the morphology of the Neurospora crassa ZK strain obtained in the present invention.

[0028] Figure 4 This is a diagram of the culture growth morphology of Neurospora crassa ZK.

[0029] Figure 5 This is the electrophoresis gel image of the ITS site amplification identified by electrophoresis of the PCR product of Neurospora crassa ZK.

[0030] Figure 6 This is a diagram of the Sanger sequencing peak results of some of Neurospora crassa ZK.

[0031] Figure 7 This is the phylogenetic tree of Neurospora crassa ZK obtained from the ITS region sequence.

[0032] Figure 8 Genome circle map for taxonomic identification of Neurospora crassa ZK.

[0033] Fig. 9 Graph showing the results of free amino acid (FAAs) content detection of red mushroom tofu (IT), fresh bean dregs (FO) and traditional red mushroom tofu (CM) obtained in the examples of the present invention.

[0034] Fig.10 Graph showing the results of volatile flavor compounds (VFCs) content detection of red mushroom tofu (IT), fresh bean dregs (FO) and traditional red mushroom tofu (CM) obtained in the examples of the present invention.

[0035] Fig.11 This is a graph showing the color change measurement results of the red mushroom tofu obtained in the example of the present invention. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0037] Example 1

[0038] 1. Isolation and screening of Neurospora crassa ZK

[0039] The applicant collected a large number of samples from Guizhou red fungus tofu and used an innovative method to isolate and screen the N.crassa ZK strain. The specific isolation and screening methods are as follows:

[0040] (1) Weigh an appropriate amount of red fungus tofu and place it in PDB liquid culture medium (whose formula is 6.0 g / L potato extract powder, 20.0 g / L glucose, pH 5.6, and the rest is water) and culture it at 28°C.

[0041] (2) Select an appropriate amount of bacteria from the PDB liquid culture medium, inoculate it into the solid culture medium using the five-point inoculation method, and culture it at 28°C for 24 hours. Then open the lid and humidify it for 24 hours.

[0042] (3) Take the strain with relatively long mycelium in the solid culture medium, place it in PDB liquid culture medium, and repeat the above steps (1) and (2).

[0043] The selected N.crassa ZK strains were numbered and stored in glycerol tubes at -80°C for long-term storage and at 4°C for temporary storage.

[0044] 2. Morphological observation of Neurospora crassa ZK

[0045] Inoculate the preserved strains onto PDA plates and culture at 28°C for 2 days. Add 1 drop of lactic acid phenol cotton blue dye on the slide, pick up a small amount of fungal hyphae with a dissecting needle and place them on the dye drop, disperse the hyphae with a cell dissecting needle, cover with a coverslip, and examine with a low-power or high-power microscope. Figures 1 to 3 As shown, the obtained strain has loose and long hyphae with septa, branches and multiple cores; asexual reproduction forms conidia, which are generally oval in shape, forming branch chains at the top of aerial hyphae, and the conidia are orange or pink. Figure 4 As shown. It can be seen that the obtained strain has the characteristics of adherent growth. After 48 hours, the colony forms abundant aerial hyphae, which spread from the edge to the center until the entire culture medium is filled. The hyphae are initially crystal root-like, then grow and intertwine, and finally form loose flocs on the PDA culture medium.

[0046] 3. Classification and identification of the complete genome of Neurospora crassa ZK

[0047] 1. Principle of the method

[0048] 1.1 Detection Platform

[0049] A 96-channel fully automated ABI 3730xL genetic analyzer was used.

[0050] 1.2 Detection principle

[0051] A DNA barcode sequence refers to a relatively short, standard, variable, easily amplified DNA fragment that can represent the species in an organism. The fragment must have sufficient variability to distinguish different species, and must also be relatively conservative to reflect the relationship between species. It also makes it possible to design universal primers suitable for the detection of multiple species. Currently, the DNA barcode fragments for microbial identification mainly include: 16SrDNA (bacteria) or 26SrDNA (yeast) or ITS (fungi) fragments.

[0052] The DNA barcode fragments corresponding to different bacterial species are amplified by PCR, and their DNA sequences are obtained using the gold standard sequencing method - Sanger sequencing, and then compared and analyzed in the NCBI database. Generally, if the sequence similarity reaches more than 97%, it can be considered to be the same species.

[0053] 2. Experimental Procedure

[0054] Sample sorting and verification → nucleic acid extraction and testing → PCR amplification → PCR product sequencing → sequencing data quality control → database comparison and identification.

[0055] 3. Instruments and Reagents

[0056] 3.1 Experimental Instruments

[0057] Small centrifuge, model D1008E, manufacturer DRAGONLAB;

[0058] Ultramicro-spectrophotometer, model NanoDrop 8000, manufacturer ThermoScinentific;

[0059] PCR instrument, model Veriti 96-Well Thermal Cycler, manufacturer Applied Biosystem;

[0060] Electrophoresis apparatus, model DYY-6C, manufacturer: Beijing Liuyi;

[0061] UV analyzer, model GelDoc TM XR + , manufacturer BIO-RAD;

[0062] Sequencer, model 3730xL DNA Analyzer, manufacturer: Applied Biosystem.

[0063] 3.2 Experimental reagents and consumables

[0064] 2×Taq PCR Master Mix, manufactured by GeneTech;

[0065] 96-well PCR plate, manufactured by Axygen;

[0066] Universal primers, manufactured by TianYi;

[0067] POP-7 TM Polymer, manufacturer Applied Biosystem;

[0068] 3730 Running Buffer (10X), manufactured by Applied Biosystem.

[0069] 4. Experimental Procedure

[0070] 4.1 Primer synthesis

[0071] Amplification primers ITS1 (TCCGTAGGTGAACCTGCGG (SEQ ID No: 1)) / ITS4 (TCCTCCGCTTATTGATATGC (SEQ ID No: 2)) were designed.

[0072] 4.2 PCR amplification system and amplification procedure are shown in Table 1 below.

[0073] Table 1. ITS site PCR amplification system and amplification program

[0074]

[0075] 4.3 PCR product electrophoresis identification

[0076] In order to ensure the specificity of PCR amplification, after the PCR amplification is completed, 2 μL of PCR product is taken for agarose gel electrophoresis (1% concentration), and the specificity of the amplified product of each sample is determined by the band pattern of the PCR product. Figure 5 As shown (a. PCR amplification gel image, b. Marke).

[0077] 4.4 Sanger sequencing

[0078] The good PCR products whose electrophoresis bands meet the theoretical target size were sent for Sanger sequencing, and the sequencing platform was ABI's 3730xL DNA Analyzer sequencer. The test results are as follows:

[0079] (SEQ ID No: 3).

[0080] 4.5 Raw data quality control and splicing

[0081] Export the raw data in .ab1 format from the ABI 3730xL instrument, import it into Chromas analysis software, perform quality control of the sequencing peak graph, and export the corresponding sequence file in .seq format. If bidirectional sequencing is performed, use SeqMan analysis software for splicing, and save the splicing results in the corresponding text file .txt format. Some sequencing peak graph results are shown in Figure 6 shown.

[0082] 4.6 Sequence Alignment and Identification

[0083] The well-sequenced spliced ​​sequences were compared in the nt / nr database of NCBI, sorted by score, and the one with the highest score and the best match was provided as the identification result. The comparison results showed that the matching sequence NCBI accession number was KY617041.1, the coverage rate was 100%, and the identification value was 100. The phylogenetic tree obtained from the ITS region sequence is as follows Figure 7 As shown, the genome circle diagram is as follows Figure 8 As shown. The fungus was identified as Neurospora crassa. Neurospora crassa is also called Neurospora crassa. The strain was sent to Guangdong Provincial Microbiological Culture Collection Center (GDMCC) for preservation on October 21, 2024.

[0084] 4. Application of Neurospora crassa ZK as a fermentation strain in the preparation of red fungus tofu

[0085] 1. Activation of Neurospora crassa

[0086] N.crassa ZK was inoculated into potato dextrose agar (PDA) and cultured in an incubator at a constant temperature of 28°C for 36 to 48 hours, during which the growth state was continuously observed. After the culture was completed, the spore powder produced was collected and stored in a refrigerator at 4°C for subsequent use.

[0087] 2. Preparation of Red Mushroom Tofu

[0088] After the fresh bean dregs are sterilized, they are filtered through a 20-mesh sieve. Then they are fried in an iron pan until the moisture content is 75%. 200g of the fried bean dregs are taken, 1wt% of the inoculated Neurospora crassa spore powder is taken, stirred evenly, and placed in a small storage basket (14.5*14.5*5.5cm) with flannel. The mixture is placed in a constant temperature and humidity incubator at 28°C and 75% humidity for culture to obtain fermented red fungus tofu.

[0089] The qualities of the red mushroom tofu (IT), fresh bean curd dregs (FO) and traditional red mushroom tofu (CM) obtained in this example were measured respectively.

[0090] 1) Determination of free amino acid content: Dissolve the sample in 50mL 0.01N HCL, shake for 30min, and then filter. Mix about 2ml of the filtrate with 15% sulfosalicylic acid at a ratio of 1:1 (v / v) and let stand at 4°C for 15min. Then centrifuge at 10,000rpm (RCF=10615g) for 15min at room temperature. Filter the supernatant through a 0.45μm PES membrane, inject it into a 2.5ml sample bottle, and test it with an automatic amino acid analyzer. The test results are as follows: Figure 7 shown.

[0091] Free amino acids are one of the important factors affecting the taste of red mushroom tofu. Principal component analysis was used to evaluate the differences in free amino acids in fresh okara and two red mushroom tofu samples. According to the results of principal component analysis, fresh okara (FO), traditional red mushroom tofu (CM) and the red mushroom tofu (IT) of the present invention were clustered separately, indicating that different production methods have a significant effect on the free amino acid composition of red mushroom tofu. Fresh okara contains more bitter amino acids (such as arginine). After the fermentation method, the content of umami amino acids and sweet amino acids increases, and the content of bitter amino acids decreases, indicating that fermentation has a positive effect on the taste characteristics of red mushroom tofu. In the fermented red mushroom tofu, the content of glutamic acid increased from 53.48 mg / 100g to 443.61 mg / 100g.

[0092] 2) Determination of volatile flavor compounds (VFCs): Headspace solid phase microextraction combined with high performance gas chromatography mass spectrometry (SPME-GCMS) was used to determine the volatile compounds of fresh okara and two types of red fungus tofu. The samples were crushed using a food grinder (HXPB9322, AUX, Zhejiang, China), and 3 g of the crushed sample was placed in a 20 ml headspace bottle, and solid phase microextraction (SPME) was used to extract the volatile substances. The operation was as follows: the headspace bottle was kept at 30 °C for 30 min to reach equilibrium, and the volatiles were extracted for 30 min using a SPME fused silica fiber with 50 / 30 μm divinylbenzene / carboxyl / polydimethylsiloxane (Supelco, Bellefonte, PA, USA). 1 mg / ml 2,4,6-trimethylpyridine was selected as the internal standard. Volatile flavor substances were analyzed using GC-MS equipped with a DB-WAX column (30 m × 0.25 mm, 25 μm, J&W Scientific, Folsom, CA, USA). Temperature program: initially set to 40 °C for 6 min, then increased to 100 °C at a rate of 6 °C / min, and then increased to 220 °C at a rate of 10 °C / min (maintained for 7 min). Helium (purity greater than 99.99%) was used as a carrier gas and flowed continuously at a rate of 1.0 mL / min. Mass spectrometry conditions were as follows: detector interface temperature, 280 °C; ion source temperature, 200 °C; mass range 35-350 m / z; ionization energy, 70 eV. Volatile components were identified by comparing the experimental mass spectra with the mass spectra in the NIST Chemical Web Book (https: / / webbook.nist.gov / chemistry / ). Results with a similarity of more than 87% were selected, and the relative percentages of volatile compounds were calculated by area normalization. The content of volatile compounds was determined based on the ratio of the chromatographic peak area of ​​the detected compound to that of the internal standard 2,4,6-trimethylpyridine and was expressed in μg / g. Figure 8 shown.

[0093] There are 5 aldehydes in fresh okara samples, including hexanal (381.08±242.65μg / g), 2-hexenal (92.31±12.47μg / g), (E)-2-heptenal (53.94±17.16μg / g), (2E)-2-octenal (262.65±85.84μg / g) and (2E)-2-decenal (91.66±26.32μg / g), all of which have a grassy smell and OVA>1; therefore, it can be inferred that these aldehyde volatile compounds are the main source of beany odor in fresh okara, especially hexanal, which has a strong grassy smell. After fermentation, all aldehydes in okara can no longer be detected to contain other characteristic volatile flavor compounds, and the two red fungus tofu have their own flavor characteristics. Specifically, ethanol (alcohol flavor), 3-hexanol (whiskey flavor), 2-hexanol (wine flavor and broccoli flavor), 1-hexanol (herbal flavor and spicy flavor) and acetic acid (sour flavor and spicy flavor) give the traditional red fungus tofu (CM) a unique sour and alcohol flavor. 2-hexanol (wine flavor and broccoli flavor), 1-octanol (lemon flavor), phenylethyl alcohol (rose and bread flavor) and caproic acid (cheese and fruit flavor) make the red fungus tofu (IT) of the present invention form a light and pleasant floral flavor.

[0094] 3) Color change measurement method: The color of food will affect people's willingness to buy and eat. Color changes are usually caused by changes in the physical structure and chemical composition of food. Use a colorimeter to observe the color of red fungus tofu. The results are as follows: Fig.11 As shown in the figure, the color change of red mushroom tofu is mainly related to the spore content produced by ZK. ZK has a strong asexual reproduction ability, and the most abundant pigment in the spores is β-carotene.

[0095] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A strain of Neurospora crassa ZK was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number: GDMCC No: 65602.

2. Use of the Neurospora crassa strain according to claim 1 as a fermentation strain in the preparation of red fungus tofu.

3. The use of a strain of Neurospora crassa as a fermentation strain in preparing red fungus tofu according to claim 2, characterized in that: The application method comprises the following steps: (1) Activation of N. crassa ZK The Neurospora crassa ZK was inoculated into potato dextrose agar medium for cultivation, and the spore powder produced was collected and preserved; (2) Preparation of red mushroom tofu The sterilized fresh bean dregs are filtered, fried, and then inoculated with the spore powder of step (1) for fermentation and culture to obtain fermented red fungus tofu.

4. The use of a strain of Neurospora crassa as a fermentation strain in preparing red fungus tofu according to claim 3, characterized in that: The culturing in step (1) refers to culturing in an incubator at a temperature of 26 to 30° C. for 36 to 48 hours.

5. The use of a strain of Neurospora crassa as a fermentation strain in preparing red fungus tofu according to claim 3, characterized in that: The spore powder storage in step (1) refers to storage in a refrigerator at 0-8°C.

6. The use of a strain of Neurospora crassa as a fermentation strain in preparing red fungus tofu according to claim 3, characterized in that: The filtration in step (2) refers to filtration using a 10-40 mesh screen.

7. The use of a strain of Neurospora crassa as a fermentation strain in preparing red fungus tofu according to claim 3, characterized in that: The frying in step (2) refers to frying until the moisture content is 70% to 80%.

8. The use of a strain of Neurospora crassa as a fermentation strain in the preparation of red fungus tofu according to claim 3, characterized in that: The inoculation amount of the spore powder in step (2) is 0.2-2wt.%.

9. The use of a strain of Neurospora crassa as a fermentation strain in preparing red fungus tofu according to claim 3, characterized in that: The temperature of the fermentation culture in step (2) is 26-30° C., and the humidity is 70%-80%.

Images