Programmable prokaryotic microorganism automatic cracking control system and application

Abstract

The invention discloses a programmable prokaryotic microorganism automatic cracking control system and application. In the system, the promoter Tac-lysis is an extremely-hypotonic promoter before being started, the number of conduction target basic components is variable, and the conduction sgRNA promoter and the excitation sgRNA promoter can adopt various combinations with adjustable relative expression intensity, so that the starting time of microbial cracking can be controlled by changing the number of the conduction target basic components, and in addition, the starting time of microbial cracking can be controlled by changing the number of the conduction target basic components. And the target editing efficiency and the downstream gene activation expression time can be precisely regulated and controlled by adjusting the expression intensity ratio of the promoter for conducting the sgRNA to the promoter for exciting the sgRNA. The system has good robustness and programmability, gene expression can be dynamically regulated and controlled according to the growth and fermentation process of prokaryotic microorganism thalli, and finally automatic splitting decomposition of the thalli after set functions are completed is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and bioengineering, and specifically relates to a programmable prokaryotic microorganism automatic lysis control system and application. Background Art

[0002] In current industrial production, the process of synthesizing natural products using microbial fermentation is becoming more and more common and mature. Compared with animals and plants, microorganisms have fast growth and metabolism, easy genetic manipulation, and simple nutrient requirements. Using microorganisms as cell factories and rapidly synthesizing natural products using relatively cheap and readily available raw materials can significantly shorten the synthesis cycle, save land and natural resources, reduce the use of acids, alkalis and organic solvents, and greatly improve economic benefits on the basis of protecting the environment. However, in the current production process, there is no simple and spontaneous control scheme for the crushing and extraction of products after using microorganisms to synthesize products. At the same time, before using the crude enzyme solution extracted from microorganisms for biochemical synthesis, additional steps are required to crush the cultured microorganisms. This not only makes the process more complicated, but also brings additional production costs. In addition, in recent years, there have been more and more studies on the targeted treatment of diseases such as cancer using bacterial therapy (Harimoto, T., Hahn, J., et al. 2022, Nature Biotechnology, 40, 8, 1259–1269.). How to control the bacteria to automatically lyse and release drugs after targeting the disease site in vivo is also an important research problem.

[0003] The gene expression process of normal organisms is often regulated by a multi-component system in the cell, which is a relatively complex process. Currently, a large number of gene regulation tools have been used to control the expression of target genes. The most common method includes the use of some induction systems that interact with transcription factors, such as IPTG, arabinose and tetracycline. However, the use of such an induction system for gene expression control also requires artificial intervention with external inducers, which will also have an adverse effect on the normal growth and metabolism of microbial cells and greatly increase production costs. Summary of the invention

[0004] In view of the deficiencies of the prior art, the object of the present invention is to provide a programmable prokaryotic microorganism automatic lysis control system and application. In this system, the promoter Tac-lysis is an extremely low osmotic promoter before it is turned on, the number of basic components of the transduction target is variable, and the transduction sgRNA promoter and the stimulating sgRNA promoter can adopt various combinations with adjustable relative expression intensity. Therefore, the start time of microbial lysis can be controlled by changing the number of basic components of the transduction target, and the promoter expression intensity ratio of the transduction sgRNA and the stimulating sgRNA can be adjusted to accurately control the target editing efficiency and the downstream gene activation expression time. The system has good robustness and programmability.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] In the first aspect of the present invention, the present invention discloses a gene timing expression control element, the overall sequence of which is shown as follows:

[0007] 5'-CGTTATGCGAGCCGATGATGCTT-TATCAA-CTGACG-[AGCTAACTGCT GTCACT]×n-AGC-TGG-3', n=1,2,3...;

[0008] Among them, CGTTATG-CGAGCCGATGATGCTT-TATCAA is the nucleotide sequence of Tac-lysis promoter, recorded as SEQ ID NO.1; TGCTTTATCAACTGACGAGC is the nucleotide sequence of the excitation target, recorded as SEQ ID NO.2; AGCTAACTGCTGTCACT is the nucleotide sequence of the basic component of the conduction target, recorded as SEQ ID NO.3; AGCTAACTGCTGTCACTAGCTGG is the nucleotide sequence of the initial conduction target, recorded as SEQ ID NO.4;

[0009] The initial transduction target and the transduction target share a common sgRNA, called the transduction sgRNA, and the nucleotide sequence of the transduction sgRNA is shown in SEQ ID NO.5; the sgRNA used by the excitation target is called the excitation sgRNA, and the nucleotide sequence of the excitation sgRNA is shown in SEQ ID NO.6.

[0010] In some specific examples of the present invention, the ratio of the expression intensity of the promoter of the conductive sgRNA to the promoter of the stimulating sgRNA is 1:1 to 1:0.33.

[0011] In some specific examples of the present invention, the promoter of the conducting sgRNA is J23119, and the promoter of the stimulating sgRNA is J23110.

[0012] In some specific examples of the present invention, the promoter of the conducting sgRNA is J23119, and the promoter of the stimulating sgRNA is J23119.

[0013] In a second aspect of the present invention, the present invention discloses a programmable prokaryotic microbial timed lysis system, comprising: a pCDF-BioAutolysis plasmid and a pACYC-ABE8e (dCas9) plasmid, wherein:

[0014] The pCDF-BioAutolysis plasmid is obtained by the following method: cloning the above-mentioned gene timing expression regulatory element into the pCDFDuet-1 plasmid to obtain the pCDF-Fuze-n plasmid; then cloning the ΦX174E gene and the above-mentioned conductive sgRNA into the pCDF-Fuze-n plasmid to obtain the pCDF-Fuze-n-ΦX174E plasmid; finally, cloning the human lysozyme gene LYZ and the exogenous target gene / gene cluster into the pCDF-Fuze-n-ΦX174E plasmid to finally obtain the pCDF-BioAutolysis plasmid;

[0015] The pACYC-ABE8e (dCas9) plasmid was obtained by the following method: ABE8e (dCas9) and the above-mentioned stimulating sgRNA were cloned into pACYCDuet-1 to obtain the pACYC-ABE8e (dCas9) plasmid.

[0016] In some specific examples of the present invention, the conduction sgRNA is controlled by the J23119 promoter, the human lysozyme gene LYZ is controlled by the J23109 promoter, the ABE8e (dCas9) is controlled by the J23105 promoter, and the stimulating sgRNA is controlled by the J23119 promoter.

[0017] In some specific examples of the present invention, the exogenous target genes / gene clusters include functional genes / gene clusters or regulatory factors in natural product biosynthesis and metabolism pathways, antibiotic biosynthesis and metabolism pathways, disease treatment-related drug synthesis pathways, drug delivery medical bacterial coat genes, or environmental pollutant degradation pathways.

[0018] In the third aspect of the present invention, the present invention also discloses a method for timed automatic lysis of prokaryotic microorganisms, comprising: constructing the pCDF-BioAutolysis plasmid and the pACYC-ABE8e (dCas9) plasmid in the above-mentioned prokaryotic microorganism timed lysis system, and then co-transforming the two into recipient cells, and inoculating the transformed cells into the corresponding culture environment to regulate the automatic expression of the lysis gene ΦX174E at a preset time, so that the cells automatically lyse at the preset time and release human lysozyme, and all prokaryotic microorganisms are lysed through a chain reaction to release the exogenous target gene / gene cluster.

[0019] In the fourth aspect of the present invention, the present invention also discloses the application of the gene timing expression regulatory element, especially in industrial production fermentation, environmental pollutant treatment and medical bacteria targeted drug delivery.

[0020] In the fifth aspect of the present invention, the present invention also discloses the application of the programmable prokaryotic microorganism timed lysis system, especially in industrial production fermentation, environmental pollutant treatment and medical bacteria targeted drug delivery.

[0021] Compared with the prior art, the present invention has the following beneficial technical effects:

[0022] The present invention provides a new gene timing expression regulatory element, wherein the promoter Tac-lysis is an extremely low osmotic promoter before being turned on, and has almost no leakage to downstream gene expression in prokaryotic microorganisms, and restores activity after ABE8e is modified to activate the target; the number of basic components of the transmission target is variable, and the transmission sgRNA promoter and the excitation sgRNA promoter can adopt various combinations with adjustable relative expression intensity. Therefore, the prokaryotic microorganism timing lysis system based on the gene timing expression regulatory element can control the start time of prokaryotic microorganism cell lysis by changing the number of basic components of the transmission target (or the sequence length of the element), and can also adjust the ratio of the promoter expression strength of the transmission sgRNA and the excitation sgRNA to regulate the target editing efficiency and the downstream gene activation expression time. The system has good robustness and programmability.

[0023] The gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to industrial production fermentation. Without any human intervention or external inducer, gene expression can be dynamically regulated according to the growth and fermentation process of the prokaryotic microorganism body. After the fermentation is completed, the cells can be automatically lysed at a fixed time to release the contents, thereby simplifying the process flow, reducing production costs, and having good economic benefits.

[0024] The gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to the treatment of environmental pollutants. After the engineered bacteria have degraded the pollutants, the engineered strains can be lysed at a preset time to avoid interference with the ecological environment, thereby improving the safety of the process of environmental pollutant treatment by the engineered bacteria.

[0025] The gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to the targeted drug delivery of medical bacteria. After the medical bacteria are targeted to the disease site, the bacteria can be automatically lysed at a fixed time and the effective drug components in the cells can be released, which not only improves the drug utilization efficiency to a certain extent, but also reduces the potential risk of bacterial infection. It does not require any external inducer and has superior safety and targeting compared with other synthetic organic carriers and inorganic particle carriers. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the plasmid map of pCDF-BioAutolysis.

[0027] Figure 2 This is the plasmid map of pACYC-J23105-ABE8e (dCas9).

[0028] Figure 3 This is the plasmid map of pCDF-Fuze9-mCherry.

[0029] Figure 4A Various combinations of PsgRNA and SsgRNA with promoters of different relative expression strengths are listed. Figure 4B Given Figure 4A Target editing efficiencies of various combinations of the BioAutolysis system are listed.

[0030] Figure 5 The figure shows the lysis efficiency of the BioAutolysis system with different lengths of transduction targets over time.

[0031] Figure 6 Heat map of the editing efficiency of each target at different times for the BioAutolysis system equipped with two transduction targets.

[0032] Figure 7 This is a heat map of the editing efficiency of each target at different times for the BioAutolysis system equipped with three transduction targets.

[0033] Figure 8 Scanning electron microscopy images of cell morphology changes in different BioAutolysis systems at 10K× resolution.

[0034] Fig. 9Scanning electron microscopy images of cell morphology changes in different BioAutolysis systems at 2K× resolution.

[0035] Fig.10 Schematic diagram of bacterial growth curves of the BioAutolysis system equipped with transduction targets of different lengths and the control system.

[0036] Fig.11A Comparison of the average fluorescence values ​​of Tac-lysis-OFF and Tac-lysis-ON.

[0037] Fig. 11B Comparison of mCherry gene transcription levels in Tac-lysis-OFF and Tac-lysis-ON.

[0038] Fig.12 Schematic diagram of the principle of sequential editing of BioAutolysis target sequences.

[0039] Fig.13 Schematic diagram of the working principle of the BioAutolysis system. DETAILED DESCRIPTION

[0040] The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings and specific examples. In the following examples, mCherry is selected as a target protein for exogenous expression and cleavage release in the model organism Escherichia coli of prokaryotic microorganisms for cleavage release. It should be noted that these examples are only used to illustrate the present invention and should not be regarded as limiting the scope of application of the present invention.

[0041] 1. Materials and Reagents

[0042] E. coli DH5α competent cells were purchased from TOLOBIO, E. coli BL21 (DE3) competent cells were purchased from TransGen, plasmid extraction kits were purchased from AXYGEN, PCR product nucleic acid purification kits were purchased from Promega, DNA polymerase Gloria Nova HS2×Master Mix (RK20717) for amplification was purchased from Abclonal, and cloning kit 2×MultiF Seamless Assembly Mix (RK21020) was purchased from ABclonal. pCDFDuet-1 plasmid and pACYCDuet-1 plasmid were purchased from Novagen. pCMV-ABE8e plasmid was used as a fragment template of ABE8e and can be purchased from addgene. The formula of LB liquid medium is: 10g tryptone, 5g yeast extract, 10g NaCl, and 1L deionized water. LB solid medium (LB medium plate) is based on the formula of LB liquid medium and 15g agar is added. Tryptone, sodium chloride, and yeast extract were purchased from OXOID. The concentrations of antibiotics used in the culture of E. coli were as follows: streptomycin 40 μg / ml, chloramphenicol 34 μg / ml, both purchased from Sangon Biotech.

[0043] 2. Gene Sequence Synthesis

[0044] The following gene fragments were commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis: conduction sgRNA fragment, excitation sgRNA fragment, bacterial lysis gene ΦX174E, human lysozyme gene, mCherry gene, Fuze2-lysis gene fragment, Fuze3-lysis gene fragment, and Fuze 9-mCherry gene fragment.

[0045] The nucleotide sequence of the conductive sgRNA fragment is shown in SEQ ID NO.5, which contains the conductive sgRNA and sequences with low homology to other components to facilitate recombination.

[0046] The nucleotide sequence of the stimulating sgRNA fragment is shown in SEQ ID NO. 6. The fragment contains the stimulating sgRNA and sequences with low homology to other components to facilitate recombination.

[0047] The bacterial lysis gene ΦX174E is shown in SEQ ID NO.7, and its 3' end includes a sequence with low homology to other components to facilitate recombination.

[0048] The human lysozyme gene is shown in SEQ ID NO.8, and its 5' end contains the J23109 promoter frame, and its 3' end includes a sequence with low homology to other components to facilitate recombination.

[0049] The mCherry gene is shown in SEQ ID NO.9, and its 5' end contains the J23105 promoter frame, and its 3' end includes a sequence with low homology to other components to facilitate recombination.

[0050] The nucleotide sequences of the Fuze2-lysis, Fuze3-lysis and Fuze9-mCherry gene fragments are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, respectively, and their upstream and downstream contain a sequence with low homology to other components to facilitate recombination.

[0051] The ABE8e fragment is shown in SEQ ID NO. 13, and its 5' end contains the J23105 promoter framework, and its 3' end includes a sequence with low homology to other components to facilitate recombination.

[0052] And, the primers are as follows, synthesized by Beijing Qingke Biotechnology Co., Ltd.:

[0053] The nucleotide sequence of the first primer X174E-F is shown in SEQ ID NO.19, and the nucleotide sequence of the second primer X174E-R is shown in SEQ ID NO.20;

[0054] The nucleotide sequence of the third primer Fuze-F is shown in SEQ ID NO.21, and the nucleotide sequence of the fourth primer Fuze-R is shown in SEQ ID NO.22;

[0055] The nucleotide sequence of the fifth primer pCDF-Fuze-F is shown in SEQ ID NO.23, and the nucleotide sequence of the sixth primer pCDF-Fuze-R is shown in SEQ ID NO.24;

[0056] The nucleotide sequence of the seventh primer Psg-F is shown in SEQ ID NO.25, and the nucleotide sequence of the eighth primer Psg-R is shown in SEQ ID NO.26;

[0057] The nucleotide sequence of the ninth primer pCDF-psg-F is shown in SEQ ID NO.27, and the nucleotide sequence of the tenth primer pCDF-psg-R is shown in SEQ ID NO.28;

[0058] The nucleotide sequence of the eleventh primer Lyz-F is shown in SEQ ID NO.29, and the nucleotide sequence of the twelfth primer Lyz-R is shown in SEQ ID NO.30;

[0059] The nucleotide sequence of the thirteenth primer pCDF-lyz-F is shown in SEQ ID NO.31, and the nucleotide sequence of the fourteenth primer pCDF-lyz-R is shown in SEQ ID NO.32;

[0060] The nucleotide sequence of the fifteenth primer mCherry-F is shown in SEQ ID NO.33, and the nucleotide sequence of the sixteenth primer mCherry-R is shown in SEQ ID NO.34;

[0061] The nucleotide sequence of the seventeenth primer pCDF-mCherry-F is shown in SEQ ID NO.35, and the nucleotide sequence of the eighteenth primer pCDF-mCherry-R is shown in SEQ ID NO.36;

[0062] The nucleotide sequence of the nineteenth primer ABE8e-F is shown in SEQ ID NO.37, and the nucleotide sequence of the twentieth primer ABE8e-R is shown in SEQ ID NO.38;

[0063] The nucleotide sequence of the twenty-first primer pACYC-ABE-F is shown in SEQ ID NO.39, and the nucleotide sequence of the primer pACYC-ABE-R is shown in SEQ ID NO.40;

[0064] The nucleotide sequence of the twenty-third primer Ssg-F is shown in SEQ ID NO.41, and the nucleotide sequence of the twenty-fourth primer Ssg-R is shown in SEQ ID NO.42;

[0065] The nucleotide sequence of the twenty-fifth primer pACYC-ssg-F is shown in SEQ ID NO.43, and the nucleotide sequence of the twenty-sixth primer pACYC-ssg-R is shown in SEQ ID NO.44.

[0066] The nucleotide sequence of the twenty-seventh primer Fuze9-F is shown in SEQ ID NO.45, and the nucleotide sequence of the twenty-eighth primer Fuze9-R is shown in SEQ ID NO.46;

[0067] The nucleotide sequence of the twenty-ninth primer pCDF-Fuze9-mCherry-F is shown in SEQ ID NO.47, and the nucleotide sequence of the thirtieth primer pCDF-Fuze9-mCherry-R is shown in SEQ ID NO.48.

[0068] The nucleotide sequence of the thirty-first primer pCDF-Tac-lysis-OFF-F is shown in SEQ ID NO.49, and the nucleotide sequence of the thirty-second primer pCDF-Tac-lysis-OFF-R is shown in SEQ ID NO.50.

[0069] The nucleotide sequence of the thirty-third primer pCDF-Tac-lysis-ON-F is shown in SEQ ID NO.51, and the nucleotide sequence of the thirty-fourth primer pCDF-Tac-lysis-ON-R is shown in SEQ ID NO.52.

[0070] 3. Construction of system-related plasmids

[0071] 3.1 Construction of pCDF-BioAutolysis plasmid

[0072] The ΦX174E gene was amplified using the X174E-F and X174E-R primer pairs, the Fuze-F and Fuze-R primer pairs were used to amplify the Fuze n-lysis fragment (Fuze2-lysis or Fuze3-lysis), and the pCDFDuet1-1 plasmid fragment was amplified using the pCDF-Fuze-F and pCDF-Fuze-R primer pairs.

[0073] The above amplification used Gloria Nova HS2×Master Mix from ABclonal. The amplification system included: Gloria Nova HS2×Master Mix 25 μL, upstream and downstream primers 1 μL each, template 1 μL, deionized water 22 μL. The PCR program was as follows: (1) 98°C, 5 min; (2) 98°C, 15 s; (3) 60°C, 30 s; (3) 72°C, 2 min 30 s; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 10 min.

[0074] The three PCR products amplified above were cloned in one step using ABclonal's 2×MultiF Seamless Assembly Mix reagent: the amplified fragments were mixed in an equimolar ratio to a total volume of 10 μL, and 10 μL of 2×MultiF Seamless Assembly Mix was added. After ligation in a 50°C water bath for 30 min, 10 μL of the reaction solution was added to TOLOBIO's Escherichia coli DH5α competent cells, ice-bathed for 30 min, heat-shocked in a 42°C water bath for 90 s, 400 μL of liquid LB medium was added, and cultured at 37°C on a shaker at 220 rpm for 2 h. The cells were then plated on an LB medium plate containing streptomycin (40 μg / ml), and cultured inverted at 37°C for 24 h before selection for sequencing. After correct sequencing alignment, the p1 plasmid construction was completed to obtain the p1 plasmid.

[0075] Then, the Psg-F and Psg-R primer pairs were used to amplify the transduction sgRNA fragment, and the pCDF-psg-F and pCDF-psg-R primer pairs were used to amplify the p1 plasmid fragment. The amplification method was exactly the same as the amplification method used in the construction of the p1 plasmid, and each amplified PCR product was cloned in one step using the method exactly the same as that used in the construction of the p1 plasmid. After the sequencing alignment was correct, the p2 plasmid was constructed to obtain the p2 plasmid.

[0076] Next, the human lysozyme gene fragment was amplified using the Lyz-F and Lyz-R primer pairs, and the p2 plasmid fragment was amplified using the pCDF-lyz-F and pCDF-lyz-R primer pairs. The amplification method was exactly the same as that used in the construction of the p1 plasmid, and each amplified PCR product was cloned in one step using the method exactly the same as that used in the construction of the p1 plasmid. After sequencing and alignment, the p3 plasmid was constructed to obtain the p3 plasmid.

[0077] Finally, the mCherry fragment was amplified using the mCherry-F and mCherry-R primer pairs, and the p3 plasmid fragment was amplified using the pCDF-mCherry-F and pCDF-mCherry-R primer pairs. The amplification method was exactly the same as that used in the construction of the p1 plasmid, and each amplified PCR product was cloned in one step using the method exactly the same as that used in the construction of the p1 plasmid. After sequencing and alignment, the plasmid construction was completed to obtain the pCDF-BioAutolysis plasmid. The plasmid map is shown in Figure 1 shown.

[0078] 3.2 Construction of pACYC-J23105-ABE8e (dCas9) plasmid

[0079] The ABE8e fragment was amplified using the ABE8e-F and ABE8e-R primer pair (with the pCMV-ABE8e plasmid as template), and the pACYC-ABE-F and pACYC-ABE-R primer pair was used to amplify the pACYCDuet-1 plasmid fragment.

[0080] The above amplification used Gloria Nova HS2×Master Mix from ABclonal. The amplification system included: Gloria Nova HS2×Master Mix 25 μL, upstream and downstream primers 1 μL each, template 1 μL, deionized water 22 μL. The PCR program was as follows: (1) 98°C, 5 min; (2) 98°C, 15 s; (3) 60°C, 30 s; (3) 72°C, 2 min 30 s; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 10 min.

[0081] The two PCR products amplified above were cloned in one step using ABclonal's 2×MultiF Seamless Assembly Mix reagent: the amplified fragments were mixed in an equimolar ratio to a total volume of 10 μL, and 10 μL of 2×MultiF Seamless Assembly Mix was added. After ligation in a 50°C water bath for 30 min, 10 μL of the reaction solution was added to TOLOBIO's Escherichia coli DH5α competent cells, ice-bathed for 30 min, heat-shocked in a 42°C water bath for 90 s, 400 μL of liquid LB culture medium was added, and cultured at 37°C on a shaker at 220 rpm for 2 h, and then spread on an LB culture medium plate containing chloramphenicol (34 μg / ml). After inverted culture at 37°C for 24 h, the bacteria were selected for sequencing. After the sequencing alignment was correct, the p4 plasmid construction was completed to obtain the p4 plasmid.

[0082] The sgRNA fragment was amplified using the Ssg-F and Ssg-R primer pairs, and the p4 plasmid fragment was amplified using the pACYC-ssg-F and pACYC-ssg-R primer pairs. The amplification method was exactly the same as that used in the construction of the p4 plasmid, and each amplified PCR product was cloned in one step using the method exactly the same as that used in the construction of the p4 plasmid. After sequencing and alignment were correct, the pACYC-J23105-ABE8e (dCas9) plasmid was obtained, as shown in Figure 2 shown.

[0083] 3.3 Construction of pCDF-Fuze9-mCherry plasmid

[0084] The Fuze9-mCherry fragment was amplified using the Fuze9-F and Fuze9-R primer pairs, and the pCDFDuet1-1 fragment was amplified using the pCDF-Fuze9-mCherry-F and pCDF-Fuze9-mCherry-R primer pairs. The amplification method was exactly the same as the amplification method used in the construction of the p1 plasmid. In addition, each amplified PCR product was cloned in one step using a method exactly the same as that used in the construction of the p1 plasmid. After correct sequencing and alignment, the p5 plasmid construction was completed to obtain the p5 plasmid.

[0085] The Psg-F and Psg-R primer pairs were used to amplify the transduction sgRNA fragment, and the p5 plasmid fragment was amplified using the pCDF-psg-F and pCDF-psg-R primer pairs. The amplification method was exactly the same as that used in the construction of the p1 plasmid, and each amplified PCR product was cloned in one step using the method exactly the same as that used in the construction of the p1 plasmid. After sequencing and alignment, the pCDF-Fuze9-mCherry plasmid was constructed, as shown in Figure 3 shown.

[0086] 3.4 Construction of pCDF-Tac-lysis-OFF and pCDF-Tac-lysis-ON plasmids

[0087] The p5 plasmid was amplified using the primer pair pCDF-Tac-lysis-OFF-F and pCDF-Tac-lysis-OFF-R, and the p5 plasmid was amplified using the primer pair pCDF-Tac-lysis-ON-F / pCDF-Tac-lysis-ON-F. The amplification method was exactly the same as that used in the construction of the p1 plasmid, and the linearized fragments pCDF-Tac-lysis-OFF-h and pCDF-Tac-lysis-ON-h were obtained, respectively.

[0088] The amplified linearized fragment pCDF-Tac-lysis-OFF-h (or pCDF-Tac-lysis-ON-h) was cloned in one step using ABclonal's 2×MultiF Seamless Assembly Mix reagent: 5 μL of the amplified fragment was aspirated, and then 5 μL of 2×MultiF Seamless Assembly Mix was added to mix well. After ligation in a 50°C water bath for 30 minutes, 10 μL of the reaction solution was aspirated and added to TOLOBIO's Escherichia coli DH5α competent cells, ice-bathed for 30 minutes, heat-shocked in a 42°C water bath for 90 seconds, 400 μL of liquid LB medium was added, and cultured at 37°C on a shaker at 220 rpm for 2 hours, and then spread on an LB medium plate containing streptomycin (40 μg / ml). After inverted culture at 37°C for 24 hours, the bacteria were selected for sequencing. After correct sequencing alignment, the plasmid construction was completed to obtain pCDF-Tac-lysis-OFF plasmid (or pCDF-Tac-lysis-ON plasmid).

[0089] 4. Plasmid Co-transformation into E. coli

[0090] 200 ng of pCDF-Fuze9-mCherry plasmid and 250 ng of pACYC-J23105-ABE8e (dCas9) plasmid were added to the competent cells of Escherichia coli BL21 (DE3) of Transgen, and ice-bathed for 30 minutes, heat-shocked at 42°C in a water bath for 90 seconds, and ice-bathed for 5 minutes. 400 μL of LB liquid culture medium was added, and cultured at 37°C and 220 rpm for two hours. Then, 200 μL of bacterial liquid was aspirated and spread on LB solid culture medium containing chloramphenicol and streptomycin double antibodies (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml). After inverted culture at 37°C for 12 hours, a single colony was picked and inoculated into 10 mL of LB liquid culture medium, and cultured at 37°C and 220 rpm. Every 24 hours, the cells were subcultured at a volume ratio of 1:1000. At the same time, samples were taken every 24 hours and sent to Qingke Biotechnology for sequencing to detect the target editing efficiency.

[0091] Here, several different combinations of the transducing sgRNA (PsgRNA) promoter and the stimulating sgRNA (SsgRNA) promoter were used, see Figure 4A , specifically listed as follows:

[0092] The PsgRNA promoter is J23119, the SsgRNA promoter is J23119, the promoter expression intensity ratio of PsgRNA to SsgRNA is 1:1, and the last sample is named PS119.

[0093] The PsgRNA promoter is J23119, the SsgRNA promoter is J23101, the promoter expression intensity ratio of PsgRNA to SsgRNA is 1:0.7, and the last sample is named PS101.

[0094] The PsgRNA promoter is J23119*2, the SsgRNA promoter is J23119, the promoter expression intensity ratio of PsgRNA to SsgRNA is 2:1, and the last sample is named P2S119.

[0095] The PsgRNA promoter is J23119, the SsgRNA promoter is None, the promoter expression intensity ratio of PsgRNA to SsgRNA is 1:0, and the last sample is named PS0.

[0096] The PsgRNA promoter is J23119*2, the SsgRNA promoter is None, the promoter expression intensity ratio of PsgRNA to SsgRNA is 2:0, and the last sample is named P2S0.

[0097] The PsgRNA promoter is J23119, the SsgRNA promoter is J23110, the promoter expression intensity ratio of PsgRNA to SsgRNA is 1:0.33, and the last sample is named PS110.

[0098] Among them, the J23119 sequence is shown in SEQ ID NO.14, the J23110 sequence is shown in SEQ ID NO.15, the J23101 sequence is shown in SEQ ID NO.16, the J23109 sequence is shown in SEQ ID NO.17, and the J23105 sequence is shown in SEQ ID NO.18.

[0099] The target editing efficiency obtained by sequencing the samples is as follows Figure 4BAs shown in the figure, it was found that the expression intensity ratio of PsgRNA and SsgRNA promoters can largely affect the editing efficiency of the BioAutolysis system components. The higher the value of PsgRNA promoter intensity / SsgRNA promoter intensity, the higher the editing efficiency of each target in the system, which means that the time for downstream gene activation expression is shorter. When the PsgRNA promoter is J23119 and the SsgRNA promoter is J23110, the entire system can achieve the highest advancement rate; when both the PsgRNA promoter and the SsgRNA promoter are J23119, the editing efficiency of the entire system is the lowest, which means that the action time of the entire system can be extended. This provides us with a new strategy (adjusting the expression intensity ratio of PsgRNA and SsgRNA promoters) to effectively control the target editing efficiency and working time of the entire system, and enhance the robustness and programmability of the system.

[0100] 5. Timed lysis of bacteria

[0101] Experimental group: 200 ng of pCDF-BioAutolysis plasmid and 250 ng of pACYC-J23105-ABE8e (dCas9) plasmid were added to Transgen's Escherichia coli BL21 (DE3) competent cells, ice-bathed for 30 minutes, heat-shocked at 42°C in a water bath for 90 seconds, ice-bathed for 5 minutes, and 400 μL of LB liquid culture medium was added. The cells were cultured at 37°C and 220 rpm on a shaker for two hours. Then, 200 μL of bacterial liquid was aspirated and inoculated into LB liquid culture medium (500 mL) containing chloramphenicol and streptomycin double antibiotics (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), and continuous fermentation culture was carried out at 37°C and 220 rpm.

[0102] Control group: 200 ng of pCDF-BioAutolysis plasmid and 250 ng of p5 plasmid were added to the competent E. coli BL21 (DE3) cells of Transgen, and the cells were placed on ice for 30 minutes, heat-shocked at 42°C in a water bath for 90 seconds, and placed on ice for 5 minutes. 400 μl of LB liquid culture medium was added, and the cells were cultured at 37°C in a shaker at 220 rpm for two hours. Then, 200 μl of the bacterial solution was inoculated into LB liquid culture medium (500 mL) containing chloramphenicol and streptomycin (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), and the cells were continuously fermented and cultured at 37°C with shaking at 220 rpm.

[0103] Among them, in the construction of pCDF-BioAutolysis plasmid, the promoters of the conduction sgRNA and the excitation sgRNA were both J23119. In the experimental group, the Fuze-lysis fragments were Fuze2-lysis containing two conduction targets and Fuze3-lysis containing three conduction targets, respectively, recorded as Fuze2 group and Fuze3 group. In the control group, the Fuze-lysis fragment was Fuze2-lysis containing two conduction targets. In addition, the BioAutolysis system was not used in the control group. The p5 plasmid used did not contain the conduction sgRNA, and the promoter could not be modified to activate the expression of the lytic gene ΦX174E. Therefore, the control group did not contain the control lytic gene ΦX174E expression excitation device.

[0104] During the fermentation and cultivation of the above-mentioned bacteria, a portion of the sample was taken every 12 hours, and the sampled bacterial solution was centrifuged at 12000rpm and the supernatant was taken. The mCherry fluorescence values ​​of 200 μl of the supernatant and 200 μl of the uncentrifuged sampled bacterial solution were respectively detected using an ELISA instrument (absorption light 587nm, excitation light 610nm); at the same time, the sequencing service of Qingke Biotechnology Co., Ltd. was used to detect the editing of related targets; a portion of the sample was taken every 24 hours, fixed with 2.5% glutaraldehyde at 4°C for 12 hours and freeze-dried, and the bacterial outer wall morphology was detected using a scanning electron microscope (SEM); samples were taken every 4 hours, and the bacterial growth curve was detected using a spectrophotometer.

[0105] The mCherry fluorescence release rate was used as the lysis rate to characterize the detection results of the experimental group Fuze2 group (labeled as Fuze2-lysis), the experimental group Fuze3 group (labeled as Fuze3-lysis) and the control group (labeled as CK). Figure 5 As shown, it can be found that: in the two experimental groups using the BioAutolysis system, the lysis of E. coli has been optimized, among which the Fuze2 group using Fuze2-lysis containing two transduction targets can start lysis after 24 hours and reach a lysis rate of more than 90% after 72 hours; the Fuze3 group using Fuze3-lysis containing three transduction targets is slightly delayed, reaching a lysis rate of about 50% after 72 hours; and the strain in the control group that did not use the BioAutolysis system is difficult to lyse, and its mCherry fluorescence release rate is less than 10%.

[0106] Furthermore, the target editing sequencing results of samples collected at different times (12h, 24h, 36h, 48h, 60h, and 72h) in the Fuze2 group of the experimental group are as follows Figure 6As shown in the figure, it can be seen that the editing efficiency of each push-site and switch-site of the Fuze2 group sample (Fuze2-lysis) gradually increases with time, and the activation target has reached an editing efficiency of 31.9% at 24h, effectively starting the expression of the downstream ΦX174E gene and prompting the cells to start lysis. Correspondingly, the scanning electron microscopy images of the Fuze2 group of the experimental group taken at different times (24h, 48h, 72h) are as follows Figure 8 and Fig. 9 As shown in the Fuze2-lysis column, it can be seen that: at 24 hours, the overall cell morphology of the sample remained intact; at 48 hours, the sample had undergone obvious lysis, a large number of bacterial cell walls were destroyed, and the cell contents were partially released; at 72 hours, the sample had no complete cell morphology and was almost completely lysed into cell fragments, with a large amount of cell contents released.

[0107] Similarly, the target editing sequencing results of samples collected at different times (12h, 24h, 36h, 48h, 60h, 72h) in the Fuze3 group of the experimental group are as follows Figure 7 As shown in the figure, it can be seen that the editing efficiency of each conduction target and activation target of the Fuze3 group sample (Fuze3-lysis) also gradually advances over time, but overall it lags behind Fuze2-lysis. Its activation target has only 5% editing efficiency at 24h, and does not effectively start downstream gene expression, but reaches 23.5% editing efficiency at 72h, effectively starting the expression of the downstream ΦX174E gene and prompting cells to begin lysis. Correspondingly, the scanning electron microscopy of samples taken at different times (24h, 48h, 72h) in the experimental group's Fuze3 group is shown in the figure below. Figure 8 and Fig. 9 As shown in the Fuze3-lysis column, it can be seen that: at 24h, the sample cell morphology was intact and no lysis occurred; at 48h, some bacterial outer walls in the sample were damaged, but the overall cell morphology was still intact; at 72h, the sample underwent obvious lysis, a large number of bacterial outer walls were destroyed, and part of the cell contents were released.

[0108] exist Figure 8 and Fig. 9 The scanning electron micrographs of samples taken at different times (24h, 48h, 72h) in the control group (CK) are also given. It can be seen that at 24h, 48h and 72h, the bacterial cell morphology in the samples remained intact, indicating that effective lysis of the bacteria will not occur without activating the lysis gene.

[0109] It can be found that the target editing sequencing results and scanning electron microscopy results are consistent with the above-mentioned lysis rate results, which means that the BioAutolysis system can control the lysis of bacteria, and the time required for bacterial lysis can be effectively controlled by pre-setting the number of transmission targets.

[0110] In addition, the growth curves of the bacteria in the experimental group Fuze2 and Fuze3 groups and the control group are as follows Fig.10 The results show that: in the early stage of fermentation, the BioAutolysis system did not significantly inhibit the normal growth of bacteria, and was able to ensure that the bacteria could grow normally in the early stage until they completed their intended functions and then started to lyse. This reveals the huge application potential of the system in the fields of industrial fermentation, environmental governance, and drug release.

[0111] VI. Characterization of Promoter Strength

[0112] 200 ng of pCDF-Tac-lysis-OFF plasmid (or pCDF-Tac-lysis-ON plasmid) and 250 ng of pACYC-J23105-ABE8e (dCas9) plasmid were added to the competent cells of E. coli BL21 (DE3) of Transgen, and then placed in an ice bath for 30 minutes, heat-shocked at 42°C in a water bath for 90 seconds, and placed in an ice bath for 5 minutes. 400 μl of LB liquid culture medium was added, and cultured at 37°C with a shaker at 220 rpm for two hours. Then 200 μl of bacterial solution was aspirated and spread on an LB medium plate containing chloramphenicol and streptomycin (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), and incubated at 37°C with an inverted culture for 12 hours. A single colony was picked and inoculated into 10 mL of LB liquid culture medium, and the culture was continuously fermented at 37°C with shaking at 220 rpm. When the bacterial solution OD 600 When it reaches about 1.0, 1 mL of bacterial solution is drawn and fluorescent real-time quantitative PCR is used to detect the difference in the expression level of the mCherry gene. After 24 hours of shaking culture, 200 microliters of bacterial solution are drawn and the mCherry fluorescence value is detected using an ELISA reader (absorption light 587nm, excitation light 610nm). The results show that the average fluorescence value of Tac-lysis-OFF detected by the ELISA reader is 18.98, which is almost the same as the mCherry fluorescence value of Escherichia coli that does not carry the mCherry fluorescent gene, while the average fluorescence value of Tac-lysis-ON is 441.83, and the expression level is significantly increased (such as Fig.11A); The mCherry gene transcription level of Tac-lysis-ON is about 101.5 times that of Tac-lysis-OFF before turning on, which proves that the leakage of mCherry protein expression and transcription level is extremely low before Tac-lysis is turned on (OFF), while after Tac-lysis is turned on (ON), it can effectively start the expression of subsequent genes or gene clusters (as shown in Fig. 11B shown).

[0113] It can be seen that the above embodiment provides a BioAutolysis system for controlling the timed lysis of bacteria. The system has the following characteristics:

[0114] (1) A variable number of transduction targets connects the excitation target and the Tac-lysis promoter to form a gene timing expression regulatory element;

[0115] (2) A protein E gene of bacteriophage X174 (ΦX174E) is connected downstream of the element. The protein expressed by this gene can degrade the cell wall from the inside and promote bacterial lysis;

[0116] (3) Use the J23109 promoter to control the constitutive expression of human lysozyme (LYZ), which can degrade the peptidoglycan on the bacterial outer wall, thereby promoting bacterial lysis;

[0117] (4) using the J23119 promoter to control the constitutive expression of PsgRNA and SsgRNA, and using the J23105 promoter to control the constitutive expression of ABE8e protein, so as to achieve the timed modification of the regulatory elements described in (1);

[0118] (5) Use J23105 to control the constitutive expression of mCherry protein as a target protein for bacterial lysis, release and detection.

[0119] In the above embodiment, the overall sequence of the gene timing expression regulatory element adopted is expressed as follows: 5'-CGTTATGCGAGCCGATGATGCTT-TATCAA-CTGACG-[AGCTAACTGCTGTC ACT]×n-AGC-TGG-3';

[0120] The overall sequence of the gene timing expression regulatory element adopted can also be written as: 5'-Tac-lysis promoter-excitation target-transduction target basic component × n-AGC-TGG-3', wherein n is the number of the transmission target basic components, n = 1, 2, 3...; the nucleotide sequence of the Tac-lysis promoter is shown in SEQ ID NO.1; the nucleotide sequence of the excitation target is shown in SEQ ID NO.2; the nucleotide sequence of the transmission target basic component is shown in SEQ ID NO.3.

[0121] It can also be written as: 5'-Tac-lysis promoter-excitation target-transduction target basic component × (n-1)-transduction target basic component-AGC-TGG-3', wherein the {transduction target basic component-AGC-TGG} located at the 3' end is regarded as the initial transduction target, and the sequence of the initial transduction target is shown in SEQ ID NO.4.

[0122] Among them, the initial transduction target and the transduction target share the sgRNA, which is called the transduction sgRNA (PsgRNA), and the nucleotide sequence of the transduction sgRNA is shown in SEQ ID NO.5; the sgRNA used for the excitation target is called the excitation sgRNA (SsgRNA), and the nucleotide sequence of the excitation sgRNA is shown in SEQ ID NO.6.

[0123] like Fig.12 As shown, in the above-mentioned gene timing expression regulatory elements, only the initial conduction target can be recognized and edited by ABE8e in the initial state. Then, after the initial conduction target is modified by ABE8e, since the 5' end of the initial conduction target overlaps with the 3' end of the conduction target, the above modification causes the PAM of the conduction target to be activated, and the conduction target is converted into the initial conduction target and then modified, and activates the next conduction target. By analogy, each target in the entire sequence from the 3' end to the 5' end will be activated in sequence, and finally the adenine A in the -35box editing frame of the Tac-lysis promoter is modified to guanine G, so that the Tac-lysis promoter is activated, thereby achieving the purpose of regulating the expression of downstream genes.

[0124] like Fig.13 As shown, the process of using the BioAutolysis system to control the timed automatic lysis of bacteria is as follows:

[0125] Stage 1: ABE8e binds to PsgRNA to form ribonucleoprotein (RNP), first editing the transduction target and sequentially opening the downstream targets;

[0126] Stage 2: After a predetermined time, ABE8e combined with SsgRNA targets the activated target, modifies the Tac-lysis promoter and turns it on, initiates ΦX174E expression and degrades the bacterial cell wall;

[0127] Stage 3: The degraded bacterial cells will release human lysozyme expressed in the cells to lyse the surrounding bacteria, and further release more LYZ to act on more bacterial cells, forming a chain reaction to promote the lysis of the entire bacterial community;

[0128] Stage 4: After the chain reaction is completed, all bacteria in the solution will turn into cell debris and release the target protein mCherry into the solution.

[0129] It can be seen that the present invention provides a new gene timing expression control element, which has an extremely low osmotic promoter Tac-lysis, has almost no leakage to downstream gene expression in the bacterium, and restores activity after ABE8e is modified to activate the target; it has a variable number of basic components of the transduction target and various combinations of the transduction sgRNA promoter and the stimulating sgRNA promoter that can adjust different relative expression intensities. Therefore, the prokaryotic microbial timing lysis system (BioFuze based Microbial Autolysis System, referred to as BioAutolysis) based on the gene timing expression control element can control the start time of microbial cell lysis by changing the number of basic components of the transduction target (or the sequence length of the element), and can also adjust the ratio of the expression intensity of the promoters of the transduction sgRNA and the stimulating sgRNA to regulate the target editing efficiency and the downstream gene activation expression time. The system has good robustness and programmability, and can dynamically regulate gene expression according to the growth and fermentation process of the bacterium, and finally realize the automatic timing lysis of the bacterium after completing the set function. In addition, the constituent elements such as the exogenous target gene (cluster) can be pre-programmed according to the actual situation to achieve a better application effect.

[0130] Therefore, the above-mentioned gene timed expression regulatory element / prokaryotic microorganism timed lysis system can provide a safer and simpler solution for applications such as extraction of microbial industrial fermentation products, treatment of microbial environmental pollution, and medical bacterial targeted drug delivery.

[0131] For example, the above-mentioned gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to industrial production fermentation. Without any human intervention or external inducer, the cells can be automatically lysed at a fixed time after the fermentation is completed to release the contents, including but not limited to: terpene compounds, flavonoid compounds, alkaloids, vitamins, proteins, etc., thereby simplifying the process flow, reducing production costs, and having good economic benefits.

[0132] For another example, the above-mentioned gene timed expression regulatory element / prokaryotic microorganism timed lysis system can be applied to the treatment of environmental pollutants. After the engineered bacteria have degraded the pollutants, the engineered strains can be lysed at a preset time to avoid interference with the ecological environment, thereby improving the safety of the engineered bacteria environmental pollutant treatment process.

[0133] For another example, the above-mentioned gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to the targeted drug delivery of medical bacteria. After the medical bacteria are targeted to the disease site, the bacteria can be automatically lysed at a fixed time and the intracellular effective drug components can be released, including but not limited to: paclitaxel, ecteinascidin, doxorubicin, bisabolene, mitomycin, vinblastine or tyrosine kinase inhibitors, etc. In this way, the drug utilization efficiency is improved to a certain extent, and the potential risk of bacterial infection is reduced. No external inducer is required, and it has more superior safety and targeting than other synthetic organic carriers and inorganic particle carriers.

[0134] In addition, the above is only one embodiment of the present invention and is not intended to limit the present invention. Any adjustments, improvements, equivalent replacements, etc. made within the design spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A gene timing expression control element, characterized in that: Its overall sequence is represented as follows: 5'-CGTTATGCGAGCCGATGATGCTT-TATCAA-CTGACG-[AGCTAACTGCTGTC ACT]×n-AGC-TGG-3', n=1,2,3...; Among them, CGTTATG-CGAGCCGATGATGCTT-TATCAA is the nucleotide sequence of Tac-lysis promoter, recorded as SEQ ID NO.1; TGCTTTATCAACTGACGAGC is the nucleotide sequence of the excitation target, recorded as SEQ ID NO.2; AGCTAACTGCTGTCACT is the nucleotide sequence of the basic component of the conduction target, recorded as SEQ ID NO.3; AGCTAACTGCTGTCACTAGCTGG is the nucleotide sequence of the initial conduction target, recorded as SEQ ID NO.4; The initial transduction target and the transduction target share a common sgRNA, called the transduction sgRNA, and the nucleotide sequence of the transduction sgRNA is shown in SEQ ID NO.5; the sgRNA used by the excitation target is called the excitation sgRNA, and the nucleotide sequence of the excitation sgRNA is shown in SEQ ID NO.

6.

2. The gene timing expression control element according to claim 1, characterized in that: The ratio of the expression intensity of the promoter of the conductive sgRNA to the promoter of the stimulating sgRNA is 1:1 to 1:0.

33.

3. The gene timing expression control element according to claim 1 is characterized in that The promoter of the conductive sgRNA is J23119, and the promoter of the stimulating sgRNA is J23110.

4. The gene timing expression control element according to claim 1, characterized in that: The promoter of the conductive sgRNA is J23119, and the promoter of the stimulating sgRNA is J23119.

5. A programmable prokaryotic microorganism timed lysis system, comprising: pCDF-BioAutolysis plasmid and pACYC-ABE8e (dCas9) plasmid, wherein, The pCDF-BioAutolysis plasmid is obtained by the following method: cloning the gene timing expression control element according to any one of claims 1 to 4 into the pCDFDuet-1 plasmid to obtain the pCDF-Fuze-n plasmid; then cloning the ΦX174E gene and the conductive sgRNA according to any one of claims 1 to 4 into the pCDF-Fuze-n plasmid to obtain the pCDF-Fuze-n-ΦX174E plasmid; finally, cloning the human lysozyme gene LYZ and the exogenous target gene / gene cluster into the pCDF-Fuze-n-ΦX174E plasmid to finally obtain the pCDF-BioAutolysis plasmid; The pACYC-ABE8e (dCas9) plasmid is obtained by the following method: ABE8e (dCas9) and the stimulating sgRNA as described in any one of claims 1 to 4 are cloned into pACYCDuet-1 to obtain the pACYC-ABE8e (dCas9) plasmid.

6. The programmable prokaryotic microorganism timed lysis system according to claim 5, characterized in that: The conduction sgRNA is controlled by the J23119 promoter, the human lysozyme gene LYZ is controlled by the J23109 promoter, the ABE8e (dCas9) is controlled by the J23105 promoter, and the excitation sgRNA is controlled by the J23119 promoter.

7. The programmable prokaryotic microorganism timed lysis system according to claim 5 or 6, characterized in that: The exogenous target genes / gene clusters include functional genes / gene clusters or regulatory factors in natural product anabolic pathways, antibiotic anabolic pathways, disease treatment-related drug synthesis pathways, drug delivery medical bacterial coat genes, or environmental pollutant degradation pathways.

8. A method for timed automatic lysis of prokaryotic microorganisms, comprising: Construct the pCDF-BioAutolysis plasmid and the pACYC-ABE8e (dCas9) plasmid in the prokaryotic microorganism timed lysis system as described in any one of claims 5 to 7, then co-transform the two into recipient cells, and inoculate the transformed cells into the corresponding culture environment. After a preset time, the cells automatically lyse to release human lysozyme, and all prokaryotic microorganisms are lysed by chain reaction to release the exogenous target gene / gene cluster.

9. Use of the gene timing expression regulatory element according to any one of claims 1 to 4, especially in industrial production fermentation, environmental pollutant treatment and medical bacteria targeted drug delivery.

10. Use of the programmable prokaryotic microorganism timed lysis system as claimed in any one of claims 5 to 7, especially in industrial production fermentation, environmental pollutant treatment and medical bacteria targeted drug delivery.

Images