SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of the SNP molecular marker, and belongs to the field of molecular marker-assisted breeding of aquatic animals. The genome DNA of the muscular tissue of the litopenaeus vannamei to be detected is extracted as a template, the gene is subjected to PCR amplification and sequencing, the genotype of the molecular marker SNP1-3 is determined, and the molecular marker SNP1-3 is used as the SNP molecular marker for seed selection, so that the aim of quickly screening litopenaeus vannamei individuals with obvious growth advantages in the early stage is fulfilled. According to the molecular marker related to the growth traits of the litopenaeus vannamei, the breeding period can be greatly shortened, the fine breed breeding process of the litopenaeus vannamei is accelerated, the breeding efficiency is improved, and the breeding cost is reduced.

Description

Technical Field

[0001] The invention belongs to the field of molecular marker-assisted breeding of aquatic animals, and in particular relates to a SNP molecular marker related to growth traits of Penaeus vannamei and an application thereof. Background Art

[0002] Vannamei shrimp, also known as white shrimp, is native to the tropical waters of the Pacific coast of America. It has many advantages such as delicious meat, rich nutrition, high meat yield, strong adaptability, low nutritional requirements, and fast growth. It is recognized as one of the excellent breeding varieties in the world. The imported Vannamei shrimp broodstock are all hybrids, and the second generation will have serious trait separation, slow growth, low survival rate, and poor stress resistance.

[0003] In response to the problems in the shrimp farming industry, Chinese researchers have actively carried out shrimp breeding work and have made considerable progress. At the same time, due to the rapid development of genetic improvement technology for aquatic animals, the introduction of modern molecular breeding technology has brought revolutionary changes to the breeding of shrimp. Compared with traditional breeding, molecular marker-assisted breeding can directly select individuals with desired markers at the DNA level, thereby shortening the breeding cycle and improving accuracy. Among them, SNP, as the third-generation molecular marker, has shown broad application prospects in the selective breeding of shrimp due to its large number, wide distribution, good stability, easy scale and automated detection.

[0004] Sugar is an important energy source for Penaeus vannamei, and sugar in feed has an important impact on its growth. The PK gene (Pyruvate kinase) belongs to the pyruvate kinase family, converting phosphoenolpyruvate and ADP into ATP and pyruvate. It is one of the main rate-limiting enzymes in glycolysis, and glycolysis is the basic metabolic pathway for sugar decomposition and energy supply. At present, the research on the related functions of PK gene is mainly on mammals, while there are few related studies on Penaeus vannamei. Summary of the invention

[0005] Studies have shown that the PK gene plays a core role in the energy metabolism of Penaeus vannamei. The present invention screened the molecular markers SNP1-3 located on the PK gene and significantly correlated with the growth traits of Penaeus vannamei through Sanger sequencing technology, providing a theoretical basis for the development and application of molecular markers related to the growth traits of Penaeus vannamei.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention provides a SNP molecular marker related to the growth traits of Penaeus vannamei, wherein the SNP molecular marker is at least one of SNP1, SNP2 and SNP3;

[0008] The molecular marker SNP1 is located at 409 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base is C or T;

[0009] The molecular marker SNP2 is located at 466 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base is C or T;

[0010] The molecular marker SNP3 is located at 579 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base is T or A.

[0011] Furthermore, the dominant genotype of the SNP1 is the CC genotype; the dominant genotype of the SNP2 is the CC genotype; and the dominant genotype of the SNP3 is the TT genotype.

[0012] The present invention also provides a detection primer, the nucleotide sequence of the primer pair is shown as SEQ ID NO.2 and SEQ ID NO.3.

[0013] The present invention also provides an application of a detection primer in preparing a product for detecting growth traits related to Penaeus vannamei.

[0014] Furthermore, the product is a test kit.

[0015] Furthermore, the product is to determine the genotype of the SNP molecular marker by extracting the genomic DNA of the tested Litopenaeus vannamei for PCR amplification and purifying and sequencing the PCR amplification product;

[0016] When the genotype of molecular marker SNP1 is TT, the individual is selected as the reserve parent for breeding; when the genotype of molecular marker SNP2 is TT, the individual is selected as the reserve parent for breeding; when the genotype of molecular marker SNP3 is AA, the individual is selected as the reserve parent for breeding; when the haplotype combination genotype of molecular markers SNP1-3 is TT TTAA, the individual is selected as the reserve parent for breeding.

[0017] Furthermore, the method for using the product comprises the following steps:

[0018] (1) DNA extraction: Take the individual Penaeus vannamei to be tested and collect its tissues for genomic DNA extraction;

[0019] (2) PCR amplification: performing PCR amplification on the detection primers described in claim 3 and the DNA template described in step (1) to obtain a PCR amplification product;

[0020] (3) purifying and sequencing the PCR amplification product to obtain a sequenced gene sequence;

[0021] (4) Determine the genotype of the SNP molecular marker based on the sequencing results, and select individuals with genotypes that have advantages in growth traits for breeding.

[0022] Furthermore, the total volume of the PCR amplification reaction system is 25 μL, including 8.5 μL of ddH2O; 12.5 μL of 2×Accurate Taq premix; 1 μL of 10 mM upstream primer; 1 μL of 10 mM downstream primer; and 2 μL of DNA template.

[0023] Furthermore, the reaction procedure of the PCR amplification is: s1, pre-denaturation at 94°C for 10 min; s2, denaturation at 94°C for 1 min, annealing at 58°C for 1 min, extension at 72°C for 1 min, and 35 cycles; s3, extension at 72°C for 10 min.

[0024] The present invention also provides a method for evaluating the growth traits of Penaeus vannamei, wherein the genotype of the molecular marker SNP1-3 of the Penaeus vannamei to be tested is obtained by detection, and then the growth performance thereof is evaluated by the genotype;

[0025] The molecular marker SNP1 is located at 409 bp of the nucleotide sequence shown in SEQ ID NO.1, the base of the molecular marker is C or T, and the vannamei shrimp individuals whose genotype of the molecular marker SNP1 is TT are selected for retention;

[0026] The molecular marker SNP2 is located at 466 bp of the nucleotide sequence shown in SEQ ID NO.1, the base of the molecular marker is C or T, and the vannamei shrimp individuals whose genotype of the molecular marker SNP2 is TT are selected for retention;

[0027] The molecular marker SNP3 is located at 579 bp of the nucleotide sequence shown in SEQ ID NO.1, the base of the molecular marker is T or A, and the vannamei shrimp individuals whose genotype of the molecular marker SNP3 is AA are selected for retention.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention screens SNP molecular markers on the PK gene related to the growth traits of Penaeus vannamei through Sanger sequencing technology, and provides a method for using the relevant molecular markers in the selection and breeding of Penaeus vannamei. The relevant molecular markers and the method for using them can be applied to the selection and breeding of new varieties of Penaeus vannamei fast-growing lines, which can greatly shorten the breeding cycle and reduce the breeding cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the electrophoresis diagram of the PCR product of the PK gene of Penaeus vannamei in Example 1;

[0031] Figure 2 The peak diagrams of sequencing of three genotypes CC, CT and TT of the PK gene SNP1 of Penaeus vannamei in Example 1;

[0032] Figure 3 The peak diagrams of sequencing of three genotypes CC, CT and TT of the PK gene SNP2 of Penaeus vannamei in Example 1;

[0033] Figure 4 The peak diagrams of sequencing of three genotypes TT, TA and AA of the PK gene SNP3 of Penaeus vannamei in Example 1;

[0034] Figure 5 This is a diagram showing the linkage disequilibrium analysis results of three SNP molecular markers of the PK gene of Penaeus vannamei in Example 1; DETAILED DESCRIPTION

[0035] In order to better illustrate the present invention, the following embodiments are listed. Obviously, the described embodiments are only a part of the present invention, not all embodiments. Based on the embodiments in the present invention, other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0036] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0037] Example 1 Mining of SNP Molecular Markers Related to Growth Traits of Litopenaeus vannamei PK Gene

[0038] 1. Collection of phenotypic data related to growth traits of Penaeus vannamei

[0039] The experimental juvenile Penaeus vannamei shrimps selected in this embodiment were from Fujian Dongfang Liyang Seedlings Breeding Co., Ltd. After 6 months of outdoor culture, 100 juvenile Penaeus vannamei shrimps were randomly selected for growth index determination and muscle tissue sample collection. The growth indexes measured included the weight (g), total length (cm), body length (cm), cephalothorax length (cm) and meat yield (%) of each Penaeus vannamei shrimp. The muscle tissue samples of each Penaeus vannamei shrimp collected were stored in anhydrous ethanol for later use.

[0040] 2. Obtaining genomic DNA of Penaeus vannamei

[0041] The genomic DNA of muscle tissue of the above 100 Litopenaeus vannamei was extracted using a marine animal tissue DNA extraction kit (Beijing Tiangen). The specific extraction method was referred to the kit instructions. After passing the quality inspection, the DNA was stored in a -80°C refrigerator.

[0042] 3. PCR amplification and sequencing of the PK gene in mixed pools of Litopenaeus vannamei

[0043] According to the base sequence of the PK gene of Litopenaeus vannamei (NCBI Gene symbol: LOC113828831), the following primers (as shown in Table 1) were designed using Primer Premier 5.0 software. The primers were synthesized by Guangzhou Tianyi Huiyuan Biotechnology Co., Ltd.

[0044] Table 1 Primer sequences

[0045]

[0046] 1 μL of each of the 100 genomic DNA samples of Penaeus vannamei was taken and mixed to prepare a mixed DNA sample. The mixed DNA sample was used as a template for mixed pool PCR amplification. The PCR reaction system (25 μL) consisted of: 8.5 μL of ddH2O; 12.5 μL of 2×Accurate Taq premix; 1 μL of 10 mM upstream primer; 1 μL of 10 mM downstream primer; 2 μL of DNA template. The sequences of the upstream and downstream primers are shown in Table 1.

[0047] The PCR amplification procedure was as follows: a. 94°C pre-denaturation for 10 min; b. 35 cycles of chain reaction, including: 94°C denaturation for 1 min, 58°C annealing for 1 min, and 72°C extension for 1 min; c. 72°C final extension for 10 min.

[0048] The obtained PCR products were detected by 1.5% agarose gel electrophoresis. Figure 1 As shown, lane M is DL1000 DNAMaker, and lanes 1-7 are amplified fragments.

[0049] After the PCR product passes the quality inspection, Sanger sequencing is performed, and SeqMan software is used to observe whether there are overlapping peaks in the sequencing peak graph. Figure 2-4 shown.

[0050] 4. Screening of SNP Molecular Markers of PK Gene in Litopenaeus vannamei

[0051] This mixed pool sequencing revealed three overlapping peaks, which means there are three SNP molecular markers in total.

[0052] The first overlapping peak is located at 409 bp of the nucleotide sequence shown in SEQ ID NO.1, located at the 158th base on the 7th-8th intron of the PK gene, where C mutated to T, i.e., I(7-8)-158, recorded as SNP1;

[0053] The second overlapping peak is located at 466 bp of the nucleotide sequence shown in SEQ ID NO.1, located at the 215th base on the 7th-8th intron of the PK gene, where C mutated to T, i.e., I(7-8)-215, recorded as SNP2;

[0054] The third overlapping peak is located at 579 bp of the nucleotide sequence shown in SEQ ID NO.1, located at the 328th base on the 7th-8th intron of the PK gene, where T mutates to A, namely I(7-8)-328, recorded as SNP3.

[0055] SEQ ID NO.1 shows the PK gene sequence amplified by PCR, SEQ ID NO.2 and SEQ ID NO.3 show the upstream and downstream primer sequences, and the underlined positions show three mutated SNP molecular markers.

[0056] >SEQ ID NO.1:

[0057] CACAGGTTGGTAAGCCAGTCATT(SEQ ID NO.2)TGTGCTACCCAGATGTTGGAATCCATGGTG AAGAAGCCCCGTCCCACACGTGCTGAAGTGTCTGATGTGGGTAATGCTATCCTTGATGGTGCTGACTGTGTCATGCTGTCTGGTGAAACTGCTAAGGGAGGCTACCCTCTTGTTTGTGTACGAACCATGGCCAACA TTGCACGTGAAGCTGAAGCTGCAATTTGGCACAAGCAACTCTTCACTGAGCTGTCTCAGCAGGTAATGTTGAAGATATGTATTTTCACTTCAAAATTTGGATATGCTTATGCCTTGACCCAGTCACGCCGGGTACAT TTTGTAGCCAAAATAAAAAAATCTGGGCGGCTACAAAATCGGCGGGCGAAGCTTCCCCGGAGTCTGTCCGCCCGCCCGGCCG C(T) GCGCTGCTGCTGCGTCGGGGCGCAGCCCCGAGACAGCATCACACTGGC GGGCCGCC C(T) GGCAATGTTTTATTTTTTCCGGTGTCTCATATATGTGACACCTGGGACGAATGGGTTAA CATTATGGAGTATTGTATAAATAGACCTGATAGTAGCTTAACTAGCAAACCAAT T(A)TGAGATTGTCTG ACTAGCCATATTTAGTTTAAAGAAAGAAAGAATATATAGAAGGAGAGTAGATAGAAGAATAGTAGATA GATAGAAGAAATTGAAAAAAATCCATTGATACACCATTGAGAAATGTTTATGATCATACAGTTGATAAC TATCTCTTATATAGAGAAATTACTCTTTATTTCTAGG(SEQ ID NO.3)TCCATCTGCCTACTGACTCAACA

[0058] Example 2 In-depth analysis of SNP molecular markers related to growth traits of PK gene in Litopenaeus vannamei

[0059] 1. Single-sample PCR amplification and sequencing of PK gene of Litopenaeus vannamei

[0060] PCR amplification was performed using 100 genomic DNAs of Penaeus vannamei extracted in Example 1 as templates. The PCR reaction primers, PCR reaction conditions and system composition were the same as in Example 1. After the PCR products passed the quality inspection, Sanger sequencing was performed to determine the genotypes of the three SNP molecular markers of each Penaeus vannamei. The gene frequency and genotype frequency of the three SNP molecular marker alleles were calculated using Excel software, and the χ 2 Popgen32 software was used to calculate genetic heterozygosity (H).

[0061] The results showed that the molecular marker SNP1 had three genotypes, among which the CC genotype had 40 tails and a genotype frequency of 0.4; the CT genotype had 30 tails and a genotype frequency of 0.3; the TT genotype had 30 tails and a genotype frequency of 0.3; the gene frequencies of alleles C and T were 0.55 and 0.45 respectively. The gene frequency of allele C was higher than that of allele T, and it was a dominant gene in the population.

[0062] The molecular marker SNP2 has three genotypes, among which the CC genotype has 40 tails and the genotype frequency is 0.4; the CT genotype has 30 tails and the genotype frequency is 0.3; the TT genotype has 30 tails and the genotype frequency is 0.3; the gene frequencies of alleles C and T are 0.55 and 0.45 respectively. The gene frequency of allele C is higher than that of allele T, and it is a dominant gene in the population.

[0063] The molecular marker SNP3 has three genotypes, among which the TT genotype has 40 tails and the genotype frequency is 0.4; the TA genotype has 30 tails and the genotype frequency is 0.3; the AA genotype has 30 tails and the genotype frequency is 0.3; the gene frequencies of alleles T and A are 0.55 and 0.45 respectively. The gene frequency of allele T is higher than that of allele A, and it is a dominant gene in the population.

[0064] The genetic heterozygosity (H) of molecular markers SNP1-3 was 1.9802 (>0.5), which was highly polymorphic; 2 The test results showed that the χ 2 The values ​​are all in χ 2 > 2 0.01(k-1) , P < 0.01, which means that the population of Penaeus vannamei is not in Hardy-Weinberg equilibrium. The genotype frequency and gene frequency distribution of the three SNP molecular markers of the PK gene of Penaeus vannamei are shown in Table 2.

[0065] Table 2 Population genetic characteristics of three SNP molecular markers of PK gene in Litopenaeus vannamei

[0066]

[0067]

[0068] Note: 2 0.05 (df ​​= 2) = 5.99, χ 2 0.01 (df=2)=9.21.

[0069] 2. Association analysis between SNP molecular markers of PK gene and growth trait phenotype data of Litopenaeus vannamei

[0070] SPSS26.0 software was used to perform association analysis on the genotypes of the three SNP molecular markers of 100 Litopenaeus vannamei in Example 1 and their corresponding growth trait phenotype data.

[0071] The results showed that the weight (g), total length (cm), body length (cm), cephalothorax length (cm) and meat yield (%) of the shrimp with the molecular marker SNP1 genotype of TT were significantly higher than those with the genotypes of CC and CT. The weight (g), total length (cm), body length (cm), cephalothorax length (cm) and meat yield (%) of the shrimp with the molecular marker SNP2 genotype of TT were significantly higher than those with the genotypes of CC and CT. The weight (g), total length (cm), body length (cm), cephalothorax length (cm) and meat yield (%) of the shrimp with the molecular marker SNP3 genotype of AA were significantly higher than those with the genotypes of TT and TA. The results of the correlation analysis between the growth phenotypic data of the shrimp and the three SNP molecular markers of the PK gene are shown in Table 3, and the results are expressed as mean ± standard deviation.

[0072] Table 3 Association analysis between growth traits of Litopenaeus vannamei and SNP markers of PK gene

[0073]

[0074] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0075] The following inference can be made: in the selective breeding of growth traits of Penaeus vannamei, Penaeus vannamei individuals with genotype of PK gene molecular marker SNP1 as TT, genotype of SNP2 as TT, and genotype of SNP3 as AA should be selected as reserve parents for breeding.

[0076] 3. Association analysis between haplotype combinations of PK gene molecular markers and growth trait phenotype data of Litopenaeus vannamei

[0077] Haploview software was used to perform linkage disequilibrium analysis on the genotypes of the three SNP molecular markers. Figure 5 As shown; SPSS26.0 software was used to perform association analysis on the three SNP molecular marker haplotype combinations of 100 vannamei shrimp in Example 1 and their corresponding growth trait phenotype data.

[0078] The results showed that the three SNP molecular markers formed a haplotype domain, and there were three haplotypes with biological statistical significance (n≥3), namely H1H1 (CC CC TT), H1H2 (CT CT TA) and H2H2 (TT TTAA). Among them, the weight (g), total length (cm), body length (cm), cephalothorax length (cm) and meat yield (%) of the H2H2 haplotype Penaeus vannamei individuals were significantly higher than those of the H1H1 and H1H2 haplotype individuals. The results of the correlation analysis between the growth phenotypic data of Penaeus vannamei and the PK gene haplotype are shown in Table 4, and the results are expressed as mean ± standard deviation.

[0079] Table 4 Association analysis between growth traits of Litopenaeus vannamei and haplotypes of SNP molecular markers of PK gene

[0080]

[0081] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0082] The following inference can be made: In the selective breeding of growth traits of Penaeus vannamei, Penaeus vannamei individuals with a genotype of TT TTAA for the three molecular marker haplotype combination of the PK gene should be selected as reserve parents for breeding.

[0083] Example 3 Verification of SNP molecular markers associated with growth traits of Litopenaeus vannamei PK gene

[0084] In order to further verify the inference obtained in Example 2, 50 Penaeus vannamei shrimps were randomly selected from the population of Penaeus vannamei cultured in Example 1 for determination of growth trait-related indicators, DNA extraction and PCR amplification, sequencing to determine the genotype of the three SNP molecular markers of each Penaeus vannamei shrimp, and then correlation analysis was performed using SPSS26.0 software. The specific operation method was the same as that of Examples 1 and 2.

[0085] The results showed that the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of the vannamei shrimp with the molecular marker SNP1 genotype of TT were significantly higher than those of the individuals with the genotypes of CC and CT. The weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of the vannamei shrimp with the molecular marker SNP2 genotype of TT were significantly higher than those of the individuals with the genotypes of CC and CT. The weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of the vannamei shrimp with the molecular marker SNP3 genotype of AA were significantly higher than those of the individuals with the genotypes of TT and TA. The results of the correlation analysis between the growth phenotypic data of vannamei shrimp and the three SNP molecular markers of the PK gene are shown in Table 5, and the results are expressed as mean ± standard deviation.

[0086] Table 5 Association analysis between growth traits of Litopenaeus vannamei and SNP molecular markers of PK gene

[0087]

[0088]

[0089] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0090] In addition, the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of the H2H2 haplotype Penaeus vannamei were significantly higher than those of the H1H1 and H1H2 haplotypes. The results of the correlation analysis between the growth phenotypic data of Penaeus vannamei and the PK gene haplotype are shown in Table 6, and the results are expressed as mean ± standard deviation.

[0091] Table 6 Association analysis between growth traits of Litopenaeus vannamei and haplotypes of SNP molecular markers of PK gene

[0092]

[0093] Note: The same index in the same column with completely different letters indicates significant difference (P<0.05); the index without letters indicates no significant difference (P>0.05).

[0094] In summary, the experimental results of Example 3 can verify the inference obtained in Example 2, that is, in the selective breeding of growth traits of Penaeus vannamei, Penaeus vannamei individuals with a genotype of TT TTAA of the three SNP molecular marker haplotype combination of the PK gene should be selected as reserve parents for breeding.

[0095] Example 4 Application of SNP molecular markers related to growth traits of PK gene of Litopenaeus vannamei

[0096] This embodiment provides a method for quickly screening out individuals of Penaeus vannamei with obvious growth advantages by using the molecular markers described in Examples 1-3 in the early stage of breeding of Penaeus vannamei. The specific steps include:

[0097] 1. Extraction of genomic DNA of Penaeus vannamei to be tested:

[0098] In order to avoid the death of the tested Penaeus vannamei, a small amount of swimming feet and tail fan tissues of Penaeus vannamei can be cut to extract the genomic DNA of Penaeus vannamei. The specific extraction method refers to the instructions of the Marine Animal Tissue DNA Extraction Kit (Beijing Tiangen). The obtained DNA is stored in a -80℃ refrigerator after passing the quality inspection.

[0099] 2. Identification of the SNP molecular marker genotype of the PK gene of Penaeus vannamei to be tested:

[0100] Using the DNA of Penaeus vannamei to be tested as a template, and using the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 in Example 1 as upstream and downstream primers, PCR amplification was performed according to the PCR reaction system and reaction procedure in Example 1. After the PCR product passed the quality inspection, Sanger sequencing was performed to determine the genotype of the molecular marker SNP1-3.

[0101] 3. Selection of Penaeus vannamei individuals with growth advantages:

[0102] When the three SNP molecular marker haplotype combination genotype of the tested Penaeus vannamei individual is TT TTAA, the individual can be retained as a Penaeus vannamei individual with excellent growth traits.

[0103] Example 5 A kit for screening individuals of Penaeus vannamei with excellent growth traits using molecular markers

[0104] The kit consists of:

[0105] 1. Primer pair: PK-F: CACAGGTTGGTAAGCCAGTCATT (SEQ ID NO. 2);

[0106] PK-R: TGTTGAGTCAGTAGGCAGATGGA (SEQ ID NO. 3);

[0107] 2. Reaction system (25 μL): ddH2O 8.5 μL; 2×Accurate Taq premix 12.5 μL; 10 mM upstream primer 1 μL; 10 mM downstream primer 1 μL; DNA template 2 μL.

[0108] 3. The method of using the kit is the same as in Example 4.

[0109] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with growth traits of Penaeus vannamei, characterized in that: The SNP molecular marker is at least one of SNP1, SNP2, and SNP3; The molecular marker SNP1 is located at 409 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base is C or T; The molecular marker SNP2 is located at 466 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base is C or T; The molecular marker SNP3 is located at 579 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base is T or A.

2. The SNP molecular marker according to claim 1, characterized in that: The dominant genotype of the SNP1 is the CC genotype; the dominant genotype of the SNP2 is the CC genotype; and the dominant genotype of the SNP3 is the TT genotype.

3. A detection primer, characterized in that The nucleotide sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. Use of the detection primer as claimed in claim 3 in preparing a product for detecting growth traits related to Penaeus vannamei.

5. The use according to claim 4, characterized in that The product is a test kit.

6. The use according to claim 4, characterized in that The product is to determine the genotype of the SNP molecular marker by extracting the genomic DNA of the tested Litopenaeus vannamei for PCR amplification and purifying and sequencing the PCR amplification product; When the genotype of molecular marker SNP1 is TT, the individual is selected as the reserve parent for breeding; when the genotype of molecular marker SNP2 is TT, the individual is selected as the reserve parent for breeding; when the genotype of molecular marker SNP3 is AA, the individual is selected as the reserve parent for breeding; when the haplotype combination genotype of molecular markers SNP1-3 is TT TTAA, the individual is selected as the reserve parent for breeding.

7. The use according to claim 6, characterized in that The method of using the product comprises the following steps: (1) DNA extraction: Take the individual Penaeus vannamei to be tested and collect its tissues for genomic DNA extraction; (2) PCR amplification: performing PCR amplification on the detection primers described in claim 3 and the DNA template described in step (1) to obtain a PCR amplification product; (3) purifying and sequencing the PCR amplification product to obtain a sequenced gene sequence; (4) Determine the genotype of the SNP molecular marker based on the sequencing results, and select individuals with genotypes that have advantages in growth traits for breeding.

8. The use according to claim 7, characterized in that The total volume of the PCR amplification reaction system is 25 μL, including 8.5 μL of ddH2O; 12.5 μL of 2×Accurate Taq premix; 1 μL of 10 mM upstream primer; 1 μL of 10 mM downstream primer; and 2 μL of DNA template.

9. The use according to claim 7, characterized in that The reaction procedure of the PCR amplification is: s1, pre-denaturation at 94°C for 10 min; s2, denaturation at 94°C for 1 min, annealing at 58°C for 1 min, extension at 72°C for 1 min, and 35 cycles; s3, extension at 72°C for 10 min.

10. A method for evaluating the growth traits of Penaeus vannamei, characterized in that: The genotype of the molecular marker SNP1-3 of the tested Litopenaeus vannamei is obtained by detection, and then the growth performance is evaluated by the genotype; The molecular marker SNP1 is located at 409 bp of the nucleotide sequence shown in SEQ ID NO.1, the base of the molecular marker is C or T, and the vannamei shrimp individuals whose genotype of the molecular marker SNP1 is TT are selected for retention; The molecular marker SNP2 is located at 466 bp of the nucleotide sequence shown in SEQ ID NO.1, the base of the molecular marker is C or T, and the vannamei shrimp individuals whose genotype of the molecular marker SNP2 is TT are selected for retention; The molecular marker SNP3 is located at 579 bp of the nucleotide sequence shown in SEQ ID NO.1, the base of the molecular marker is T or A, and the vannamei shrimp individuals whose genotype of the molecular marker SNP3 is AA are selected for retention.

Images