Molecular marker closely linked to the major qtl locus for ear row number and its application

Abstract

The application discloses a molecular marker closely linked to a main QTL site of ear row number of corn and application thereof. The molecular marker is closely linked to a main QTL site qPsa1 of ear row number significantly increased in the process of domestication of big reed into corn, is located at 270911250 of the first chromosome of the V4 genome of corn, and has genotypes of CC, TT or CT. By using the molecular marker PSA1 KASP, excellent allelic variations of qPsa1 in a new corn variety or strain of're-domestication' or 'domestication from scratch' can be selected, so that the workload of breeding screening can be greatly reduced, the breeding cycle is shortened, and the breeding process of corn with more ear row numbers is accelerated.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology and genetic breeding, and particularly relates to a molecular marker closely linked to a maize-switchgrass ear row domestication major QTL site qPsa1 and application thereof. BACKGROUND

[0002] In the evolution process of crops from wild ancestors to local varieties and modern cultivars, two stages of domestication and selection are experienced. Domestication makes the cultivated species of crops have more seeds, larger fruits or grains than wild ancestors, significantly improves yield, and greatly meets the needs of human beings. With the increasing diversification and individualization of people's food demand, traditional agricultural production methods also bring many challenges. The future goal of food production should be to supply food based on people's individual needs. "Re-domestication" of semi-domesticated crops and "de novo domestication" of new crops provide new solutions to the increasingly serious food problem in the world. The mining and analysis of key functional genes of advantageous traits (high yield, high nutritional value, high-efficiency nitrogen fixation, high water use efficiency, etc.) are also considered as a key step to achieve "re-domestication" and "de novo domestication" of crops. In the process of maize domestication and selection, the change of 5-6 key genes builds the key morphological structure of modern cultivated maize, greatly improves the adaptability and yield of maize, and the domestication of single spike of switchgrass to paired spike of cultivated maize significantly increases the ear row number of maize. So far, the genetic and molecular mechanism of the change from single spike of switchgrass to paired spike of cultivated maize is still unclear. Ear row number is an important constituent factor of maize yield, and is significantly positively correlated with single ear grain yield. Therefore, it is necessary to mine the ear row number gene from the maize domestication process and its favorable alleles.

[0003] Among the currently used molecular markers, SNPs are widely distributed on the genome, and gradually become an ideal marker type in genetic breeding due to their advantages of large number and rich polymorphism. SNP markers can obtain genotypes by resequencing, chip and other methods, among which the competitive allele-specific PCR genotyping method (Kompetitive Allele Specific PCR, KASP) is becoming an important method for SNP genotyping due to its advantages of rapid, accurate and high-throughput. However, there is no method for using KASP molecular markers for molecular breeding of ear row number in the process of maize-switchgrass domestication. Therefore, it is particularly urgent and important to develop molecular markers for ear row number gene and its favorable alleles in the domestication process.

[0004] The team previously used a hybrid derived from a cross between switchgrass and a corn inbred line as a material, identified a mutant with pedicellate spikelet abortion resulting in a significant reduction in ear row number, named Pedicellate spikelet abortion 1 (Psa1). Using chromosome substitution mapping, Psa1 was located on the first chromosome at about 1 Mb interval. Sequence analysis of the interval, according to the sequence difference, KASP molecular markers were developed, and the markers were applied to the materials derived from the cross between switchgrass and corn, which can realize the molecular marker assisted selection of corn with more ear row number in the process of re-domestication or de novo domestication. SUMMARY

[0005] The purpose of the present application is to provide a molecular marker that is tightly linked to the major QTL site qPsa1 of the significant increase in ear row number in the process of domesticating switchgrass into corn, which is a SNP marker located at 270911250 of the first chromosome of the published corn V4 genome, with genotypes CC, TT or CT.

[0006] Another purpose of the present application is to provide an application of a molecular marker that is tightly linked to the major QTL site qPsa1 of the significant increase in ear row number in the process of domesticating switchgrass into corn, by detecting the genotype of the 270911250 base on the first chromosome of the corn B73 genome, the marker assisted selection of high ear row number materials can be realized.

[0007] In order to achieve the above purpose, the present application adopts the following technical measures:

[0008] The reagent for detecting the 270911250 base on the first chromosome of the corn v4 genome is within the protection scope of the present application.

[0009] The reagent for detecting the corn sequence containing the 270911250 base on the first chromosome of the corn v4 genome is also within the protection scope of the present application.

[0010] The primer designed for the 270911250 base on the first chromosome of the corn v4 genome is also within the protection scope of the present application.

[0011] In the above applications, the applicant developed KASP marker PSA1KASP according to the above SNP site, and the primer designed according to the marker is:

[0012] High ear row number allele-specific primer PSA1KASP-F1: AGCTCCCCCTCGATCGTC

[0013] Low ear row number allele-specific primer PSA1 KASP-F2: AGCTCCCCCTCGATCGTT

[0014] Reverse primer PSA1 KASP-R: GATGAAAAGTGCCAAAGAGAT

[0015] The above-mentioned primer needs to be added with a KASP marker universal adapter before use according to the principle of KASP marker development.

[0016] The application also provides application of the above-mentioned primer in corn breeding. When the base at position 270911250 on chromosome 1 of the v4 genome of corn is of the CC genotype, more rows are exhibited, and when it is of the TT genotype, fewer ear rows are exhibited.

[0017] Specific application is application in rapid screening of corn breeding materials with more ear rows.

[0018] Compared with the prior art, the application has the following advantages:

[0019] (1) The molecular marker PSA1 KASP significantly associated with corn ear row number is found for the first time, which provides a reliable molecular marker source for pre-selection of high ear row number materials in the process of "re-domestication" or "domestication from scratch".

[0020] (2) By using the molecular marker PSA1 KASP, excellent allelic variations of qPsa1 in "re-domestication" or "domestication from scratch" corn new varieties or strains can be selected, which can greatly reduce the workload of breeding screening, shorten the breeding cycle, and accelerate the breeding process of corn with more ear rows. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 .qPsa1 fine mapping results, 1: switchgrass; 2: corn; 3: heterozygote; N is the number of single plants;

[0022] Figure 2 .PSA1 KASP genotyping results in high and low ear row number materials, green is the switchgrass haplotype, blue is the corn haplotype, and gray is the negative control with water as a template;

[0023] Figure 3 .PSA1 KASP genotyping results in a separation population, green is the switchgrass haplotype TT, blue is the corn haplotype CC, red is the heterozygote genotype CT, gray is the negative control with water as a template, and black is undetected or blank. DETAILED DESCRIPTION

[0024] The technical solutions described in the present application are conventional technologies in the art if not specifically stated; the reagents or materials described are from commercial channels if not specifically stated. In the present application, the corn genome is referred to B73v4 if not specifically stated.

[0025] Example 1

[0026] Discovery of SNP markers closely linked to the major QTL site qPsa1 of ear row number and establishment of a method

[0027] A BC2-RIL population was constructed by crossing a switchgrass and a corn inbred line, and then continuously backcrossing two generations and selfing multiple generations with the corn as a recurrent parent. A mutant with a pedicellate spikelet abortion leading to a significant reduction in ear row number was derived from the population, which was named Pedicellate spikelet abortion 1 (Psa1). The F2 segregation population was constructed by crossing the material with normal spikelet development (WT) in the population as the female parent with Psa1. The genetic background difference between Psa1 and WT was analyzed using the 56K-SNP corn chip produced by Illumina. After quality control, 40325 high-quality SNP marker information was screened. The fragments from switchgrass were mainly distributed on chromosomes 1, 3, 5, 7, 8, and 10. Molecular markers were developed near the polymorphic SNP sites for single-plant genotype detection of the F2 segregation population, and single-factor variance analysis was performed on the single-plant ear row number. Through analysis, a major QTL was detected on chromosome 1, corresponding to the physical location of 266-271 Mb of the corn reference genome B73. More F2 populations and offspring of different recombination types were used for fine mapping to narrow down the candidate interval to 1M interval (266-271 Mb) on chromosome 1. Figure 1 ). The interval contains 11 genes in the B73 V4 version.

[0028] DNA of Psa1 and WT leaves were extracted, and primers were designed in the candidate interval according to the chip data and the reference genome B73 sequence. The PCR amplification products were sent to Shanghai Biotechnology for first sequencing. High-quality SNP sites were screened for KASP marker development. Sequencing results showed that Psa1 and WT had a C / T variation at position 270911250. And this site was the same as WT in 508 of 510 corn inbred lines (99.61%) materials, all C, and there was no heterozygote. In 184 switchgrass materials, 160 had Psa1 haplotype, and the genotype of this SNP site was CC, TT or CT. The sequences of 100 bp upstream and downstream of the site are as follows: ATCACATTTGAGTCCCAGAGGATTGGGGCGCTTCATTGTACATGGCTTGTGGC TCCTCTCCTTGGTTGAGGATGAATTGACCGAGCTCCCCCTCGATCGTCTCCCGCTTGGTGATCTTGGTCACCTCATCCCCTTCATGTGCGATCTTTAGAACATCCCAAATCTCTTTGGCACTTTTCATCCCTTGCACCTTATTATACT

[0029] According to the KASP (Kompetitive Allele-Specific PCR) molecular marker primer design principle, the KASP molecular marker PSA1KASP was developed, each marker including two competitive forward primers F1 and F2, and one reverse universal primer R, and the primer sequences are as follows:

[0030] PSA1KASP-F1: AGCTCCCCCTCGATCGTC

[0031] PSA1KASP-F2: AGCTCCCCCTCGATCGTT

[0032] PSA1KASP-R: GATGAAAAGTGCCAAAGAGAT

[0033] The above primers need to be added with the universal adapter of KASP marker before use according to the principle of KASP marker development.

[0034] The adapter sequence added before F1 is GAAGGTGACCAAGTTCATGCT , and the adapter sequence added before F2 is GAAGGTCGGAGTCAACGGATT .

[0035] The genotypes of the high ear row number (12 rows) and low ear row number (6 rows) materials obtained by crossing switchgrass and corn were genotyped by using competitive allele-specific PCR technology on the marker. The amplification used a kit for five-primer amplification of mutation system (PAMS), and a 10 uL reaction system was designed according to the PAMS pro SNP Genotyping PCR mix kit instructions: 2xPARMS master mix 5 uL, Allele X primer (10 uM) 0.15 uL, Allele Y primer (10 uM) 0.15 uL, Common R primer (10 uM) 0.4 uL, and corn genomic DNA 10-100 ng. The amplification program was as follows: 94℃ 15 min; 94℃ 20 s, 65-57℃ (Touch-down) 1 min, 10 cycles; 94℃ 20 s, 57℃ 1 min, 30 cycles; collect fluorescence signal once and output genotype results, and the genotype results are shown in Figure 2 The marker can obviously distinguish different haplotypes and correspond to the high and low ear row number one by one.

[0036] Example 2

[0037] The application of the primer designed based on the base at position 270911250 of chromosome 1 of corn in corn ear row number screening breeding, and the steps are as follows:

[0038] To verify the effect of the above-mentioned molecular marker, the genotypes of the segregation population produced by crossing switchgrass and corn inbred line ZZCO1 were identified by using the primer, the population was sown in the test field in spring 2024, the leaf DNA was extracted by using the CTAB method at the two-leaf-one-heart stage, and the amplification method was the same as that described in Example 1. The genotypes of 384 single plants were identified. The genotyping results are shown in Figure 3 The PSA1KASP clearly divides the test population into three genotypes of switchgrass, corn and hybrid. To better identify the ear row number, the phenotype was identified when the female ear was not mature. Combined with genotype and phenotype, it was found that the CC genotype material had 7.09 more ear rows than the TT genotype material (Table 1), which further verified that the developed KASP marker can quickly and effectively identify the material with more ear row number in the population constructed by crossing switchgrass and corn, and has application value in the breeding of corn “re-domestication” or “from scratch domestication” to quickly screen breeding materials with more ear row number.

[0039] Table 1: Genotype and phenotype significance of marker PSA1KASP in corn-switchgrass F2 population

[0040]

Claims

1. Application of KASP marker PSA1KASP primer in ear row number breeding of corn; The primer is: High ear row number allelotype specific primer PSA1KASP-F1: AGCTCCCCCTCGATCGTC Low ear row number allelotype specific primer PSA1KASP-F2: AGCTCCCCCTCGATCGTT Reverse primer PSA1KASP-R: GATGAAAAGTGCCAAAGAGAT; When the base at position 270911250 on chromosome 1 of the corn v4 genome is of CC genotype, the ear row number of the material is increased compared with that of TT genotype material.

Images