Engineered herpes simplex virus vectors and uses thereof

Abstract

The invention discloses an HSV-1 replication-deficient recombinant virus vector and an application of the HSV-1 replication-deficient recombinant virus vector. Specifically, the method comprises the following steps: performing gene editing on a specific genome segment in an HSV-1 genome to obtain an HSV-1 replication-defective recombinant virus vector; wherein compared with the existing HSV-1 replication-deficient recombinant virus vector, the HSV-1 replication-deficient recombinant virus vector can express an exogenous gene more efficiently, and the HSV-1 replication-deficient recombinant virus vector, as an excellent delivery vector, can effectively deliver the exogenous gene into the body of a subject to achieve a treatment effect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an HSV-1 replication-deficient recombinant virus vector and an application thereof. Background Art

[0002] Herpes simplex virus (HSV) belongs to the herpesviridae family. It is an enveloped double-stranded DNA virus, including two subtypes: type I (HSV-1) and type II (HSV-2).

[0003] The herpes simplex virus is composed of four parts: core, capsid, interlayer protein and envelope. The virus core is composed of dense double-stranded DNA, which is wound into a filament scroll. The capsid surrounded by DNA is an icosahedral structure with a diameter of 100-110nm and consists of 162 capsomeres. The outside of the capsid is covered by irregularly arranged, amorphous interlayer proteins. The outermost layer of the virus is a lipid bilayer envelope with short protrusions, and the diameter of the virus wrapped in the envelope is 150-200 nm. The virus envelope is composed of 11 glycoproteins and at least two non-glycosylated proteins, including viral glycoprotein B (gB), viral glycoprotein C (gC), viral glycoprotein D (gD), viral glycoprotein G (gG) and viral glycoprotein M (gM). The three-dimensional structure of the viral envelope glycoprotein is related to the cell infection ability of the virus, which determines whether the virus can enter the host cell and the amount of virus entering the host cell.

[0004] At present, HSV-1 virus has been used in gene therapy for major diseases such as tumors, neurodegenerative diseases, genetic diseases and immune system diseases. Compared with other gene therapy viral vectors, HSV-1 virus has many advantages.

[0005] First, the HSV-1 genome is relatively large and can carry relatively large or multiple exogenous genes. The HSV-1 genome is as long as 152 kb, while the commonly used viral vector, the adenovirus genome, is only 35 kb. Of the more than 80 known genes in the HSV-1 genome, about half are non-essential genes in in vitro culture and can be replaced by multiple exogenous therapeutic genes. Its maximum exogenous gene insertion amount can reach 30-40 kb. This is particularly important for the treatment of many diseases, especially those related to multiple genes.

[0006] HSV-1 does not integrate with cell DNA, its replication is controllable, and it is highly safe. HSV-1 rarely causes life-threatening diseases in adults with immune competence [Shen Y, Nemunaitis J. Herpes simplex virus 1 (HSV-1) for cancer treatment [J]. Cancer Gene Therapy, 2006, 13 (11): 975-992]. Many non-essential genes of HSV-1 are related to its neurotoxicity. Removing some non-essential genes in HSV-1, such as the ICP34.5 gene, allows HSV-1 to selectively replicate only in tumor cells, while normal tissue cells are not affected [Chou J, Kern E, Whitley R, et al. Mapping of herpes simplex virus-1 neurovirulence to gamma 34.5, a genenonessential for growth in culture [J]. Science, 1990, 250 (4985): 1262-1266].

[0007] Herpes simplex virus type 1 (HSV-1) is considered to be a very promising virus in gene therapy due to its wide range of host cells and high safety. For example, herpes simplex virus type 1 can be genetically modified into a replication-defective viral vector to introduce exogenous genes into the subject to treat related diseases. Injection of HSV-1 vectors carrying ENK, GABA or endorphin genes can alleviate pain caused by chronic inflammation and bone cancer, as well as neuropathic pain, while HSV-1 vectors carrying anti-inflammatory factors such as IL-4, IL-10 and IL-13 can also relieve acute and chronic pain [Goss JR, Krisky DM, Wechuck JB, et al. Herpes simplex virus-based nerve targeting gene therapy in pain management [J]. Journal of Pain Research, 2014: 71-79]. Replication-deficient recombinant herpes virus vectors can also be used in the treatment of skin diseases. Topical application of HSV-1 vectors carrying the COL7A1 gene can treat dystrophic epidermolysis bullosa [Gurevich, I., Agarwal, P., Zhang, P. et al. In vivo topical gene therapy for recessive dystrophic epidermolysis bullosa: a phase 1 and 2 trial. Nat Med 28, 780–788 (2022)].

[0008] The HSV-1 viral genome consists of long terminal repeats (TRs) L ), long unique segment (U L ), long internal repeat (IR L ), short internal repeat (IR S ), short unique segment (U S ) and short terminal repeats (TR S )composition( Figure 1). The HSV-1 genome is 152 kb long, and the proteins it encodes are involved in multiple functions such as cell adhesion, cell invasion, replication, assembly, cell interaction, and immune interaction, and it has relatively complex gene regulatory elements. Affected by viral regulatory elements, the insertion position of exogenous genes greatly affects the expression of exogenous genes. How to obtain HSV-1 viral vectors with high efficiency in expressing exogenous genes has become a problem that urgently needs to be solved. Summary of the invention

[0009] The present invention provides an HSV-1 replication-deficient recombinant viral vector and its application. Specifically, the present application is directed to a specific region of the HSV-1 genome (e.g. Figure 2 By transforming the virus vector obtained in the present application, an HSV-1 replication-deficient virus vector can be obtained. Using the virus vector obtained in the present application to deliver foreign genes can effectively treat diseases such as hereditary diseases, skin diseases, and muscle diseases.

[0010] Specifically, the first aspect of this application relates to the following technical solutions:

[0011] Item 1. A replication-deficient recombinant herpes simplex virus type 1 (HSV-1) vector, wherein the nucleotide sequence of the following genomic segment in the genome is disrupted or knocked out:

[0012] 1) The nucleotide sequence from 1-100 nucleotides upstream and downstream of nucleotide 126785 to 1-100 nucleotides upstream and downstream of nucleotide 131176, and the nucleotide sequence from 1-823 nucleotides upstream and downstream of nucleotide 147025 to 1-93 nucleotides upstream and downstream of nucleotide 151439; and / or

[0013] 2) The nucleotide sequence from nucleotides 1-257 upstream and downstream of nucleotide 113494 to nucleotides 1-223 upstream and downstream of nucleotide 115314;

[0014] The nucleotide positions of the above HSV-1 genome were determined with reference to the HSV-1 laboratory virus strain 17 genome (NC_001806.2).

[0015] Furthermore, the disrupted or knocked-out genomic site contains one or more exogenous protein encoding genes selected from the group consisting of: collagen, elastin and growth factor.

[0016] Item 2. The recombinant herpes simplex virus type I vector according to Item 1, wherein the genome is selected from the group consisting of ICP34.5 gene, ICP6 gene, ICP0 gene, ICP47 gene, ICP22 gene, ICP4 gene, ICP27 gene, U S 3 genes, U L56 genes, functional VP16 gene, VHS gene, UNG gene, IR L / IR S One or more of the glycoprotein H gene, thymidine kinase gene, or region is disrupted or knocked out.

[0017] Item 3. The recombinant herpes simplex virus type 1 (HSV-1) vector according to Item 1, wherein the viral vector is cultured in compensatory cells.

[0018] Item 4. The recombinant herpes simplex virus type 1 (HSV-1) vector according to Item 3, wherein the compensatory cells are Vero cells.

[0019] Item 5. The recombinant herpes simplex virus type I vector according to any one of Items 1 to 2, wherein ICP0 and / or ICP22 in the genome are destroyed or knocked out.

[0020] Item 6. A recombinant herpes simplex virus type I vector according to any one of Items 1 to 5, wherein the exogenous protein encoding gene is introduced into the same or different genomic site as the above-mentioned destroyed or knocked out site.

[0021] Item 7. A recombinant herpes simplex virus type I vector according to Item 6, wherein the exogenous protein is selected from one or more of the following proteins: epidermal growth factor (EGF), fibroblast growth factor (FGF), type I collagen (COL1), type II collagen (COL2), type III collagen (COL3), type IV collagen (COL4), type VII collagen (COL7), type IX collagen (COL9), type XVII collagen (COL17), elastin (ELN), sirtuin 1 (SIRT1), sirtuin 3 (SIRT3), sirtuin 6 (SIRT6), sirtuin 7 (SIRT7), EGF, FGF, and ELN.

[0022] Item 8. A recombinant herpes simplex virus type I according to any one of Items 1 to 7, for use in beauty treatments, wherein the beauty treatments include one or more of the following: improving skin elasticity, improving skin dryness, improving skin vitality, removing wrinkles, and / or delaying skin aging.

[0023] Item 9. The recombinant herpes simplex virus type I according to any one of Items 1 to 7, for use in treating epidermolysis bullosa.

[0024] Item 10. A composition comprising the recombinant herpes simplex virus type I vector according to any one of Items 1 to 7 and a solvent or excipient acceptable to humans.

[0025] Item 11. The composition according to Item 10, which is a pharmaceutical composition or a composition for cosmetic use, and optionally, the composition for cosmetic use is a composition for external application, subcutaneous injection, intradermal injection, or microneedle injection for skin improvement.

[0026] Item 12. A cosmetic method, comprising administering to a subject in need thereof an effective amount of a cosmetic composition according to Item 10 or 11, optionally wherein the cosmetic treatment comprises one or more of the following: improving skin dryness, improving skin vitality, removing wrinkles, and / or delaying skin aging, optionally wherein the cosmetic treatment composition is a composition for external application, subcutaneous injection, intradermal injection, or microneedle injection for skin improvement.

[0027] Item 13. A method for treating a disease, comprising administering an effective amount of the composition according to Item 10 or 11 to a subject in need thereof, wherein the disease is epidermolysis bullosa.

[0028] Item 14. A compensating cell for culturing a herpes simplex virus vector, wherein the herpes simplex virus vector is a recombinant herpes simplex virus type 1 (HSV-1) vector according to any one of Items 1 to 7.

[0029] Item 15. The compensatory cell according to Item 14, which is a Vero cell.

[0030] Item 16. Use of Vero cells for culturing herpes simplex virus vectors, wherein the herpes simplex virus vector is the recombinant herpes simplex virus type I (HSV-1) vector described in any one of Items 1-7.

[0031] The second aspect of this application involves the following technical solutions:

[0032] Item 1. A recombinant herpes simplex virus type I (HSV-1) vector, comprising a gene encoding an anti-dystrophin protein, wherein the viral vector genome is selected from the group consisting of ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more of the regions are disrupted or knocked out.

[0033] Item 2. The recombinant herpes simplex virus type 1 (HSV-1) vector according to Item 1, wherein the viral vector is cultured in compensatory cells.

[0034] Item 3. The recombinant herpes simplex virus type 1 (HSV-1) vector according to Item 2, wherein the compensatory cells are Vero cells.

[0035] Item 4. The recombinant herpes simplex virus type I vector according to any one of Items 1 to 3, wherein the ICP34.5 gene and / or IR L / IR S Regions are disrupted or knocked out.

[0036] Item 5. The recombinant herpes simplex virus type I vector according to Item 4, wherein the gene encoding dystrophin is introduced into the same or different genomic site as that which is disrupted or knocked out.

[0037] Item 6. Use of the recombinant herpes simplex virus type I vector described in Items 1-5 in the preparation of a drug for treating muscle diseases.

[0038] Item 7. The use of Item 6, wherein the muscle disease is dystrophinopathy, optionally, the muscle disease is Duchenne muscular dystrophy, Becker muscular dystrophy, intermediate muscular dystrophy and / or X-linked dilated cardiomyopathy.

[0039] Item 8. A pharmaceutical composition comprising the recombinant herpes simplex virus type I vector according to any one of Items 1-7.

[0040] Item 9. A method for treating a disease, comprising administering an effective amount of the recombinant herpes simplex virus type I vector described in Items 1-8 to a subject in need thereof.

[0041] Item 10. The method of Item 9, wherein the disease is a muscle disease.

[0042] Item 11. The method of Item 10, wherein the muscle disease is a dystrophinopathy, optionally, the muscle disease is Duchenne muscular dystrophy, Becker muscular dystrophy, intermediate muscular dystrophy and / or X-linked dilated cardiomyopathy.

[0043] Item 12. A compensatory cell for culturing a herpes simplex virus vector, wherein the herpes simplex virus vector is the recombinant herpes simplex virus type 1 (HSV-1) vector described in any one of Items 1 to 5.

[0044] Item 13. The compensatory cell according to Item 12, which is a Vero cell.

[0045] Item 14. Use of Vero cells for culturing herpes simplex virus vectors, wherein the herpes simplex virus vector is the recombinant herpes simplex virus type 1 (HSV-1) vector described in any one of Items 1-5.

[0046] The third aspect of this application involves the following technical solutions:

[0047] Item 1. A recombinant herpes simplex virus type I (HSV-1) vector, comprising a gene encoding an ATP2C1 protein, wherein the viral vector genome is selected from the group consisting of an ICP0 gene, an ICP4 gene, an ICP27 gene, an ICP34.5 gene, an ICP47 gene, an ICP22 gene, an ICP6 gene, an U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more of the regions are disrupted or knocked out.

[0048] Item 2. The recombinant herpes simplex virus type 1 (HSV-1) vector according to Item 1, wherein the viral vector is cultured in compensatory cells.

[0049] Item 3. The recombinant herpes simplex virus type 1 (HSV-1) vector according to Item 2, wherein the compensatory cells are Vero cells.

[0050] Item 4. The recombinant herpes simplex virus type I vector according to any one of Items 1 to 3, wherein the ICP34.5 gene and / or IR L / IR S Regions are disrupted or knocked out.

[0051] Item 5. The recombinant herpes simplex virus type I vector according to Item 4, wherein the gene encoding the ATP2C1 protein is introduced into the same or different genomic site as the one that is disrupted or knocked out.

[0052] Item 6. Use of the recombinant herpes simplex virus type I vector described in Items 1-5 for the preparation of a drug for the treatment of familial chronic benign pemphigus.

[0053] Item 7. A pharmaceutical composition comprising a recombinant herpes simplex virus type I vector according to any one of Items 1-6.

[0054] Item 8. A method for treating a disease, comprising administering an effective amount of the recombinant herpes simplex virus type I vector described in Items 1-5 to a subject in need thereof.

[0055] Item 9. The method according to Item 8, wherein the disease is familial chronic benign pemphigus.

[0056] Item 10. A compensatory cell for culturing a herpes simplex virus vector, wherein the herpes simplex virus vector is the recombinant herpes simplex virus type 1 (HSV-1) vector described in any one of Items 1 to 5.

[0057] Item 11. The compensatory cell according to Item 10, which is a Vero cell.

[0058] Item 12. Use of Vero cells for culturing herpes simplex virus vectors, wherein the herpes simplex virus vector is the recombinant herpes simplex virus type 1 (HSV-1) vector described in any one of Items 1-5.

[0059] The fourth aspect of this application involves the following technical solutions:

[0060] Item 1. A short hairpin RNA (shRNA) for knocking down the KRT5 gene and / or the KRT14 gene, comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0061] Item 2. The short hairpin RNA according to Item 1, comprising a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0062] Item 3. A nucleic acid construct comprising the short hairpin RNA described in Item 1 or 2.

[0063] Item 4. The nucleic acid construct according to Item 3, which is a nucleic acid construct composed of the short hairpin RNA according to Item 1 or 2 and a miRNA backbone, wherein the short hairpin RNA replaces the targeting region in the miRNA backbone.

[0064] Item 5. The nucleic acid construct according to Item 4, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.

[0065] Item 6. The nucleic acid construct described in Item 4 or 5 comprises the nucleotide sequence shown in SEQ ID NO: 45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0066] Item 7. A vector comprising the short hairpin RNA described in Item 1 or 2 or the nucleic acid construct described in any one of Items 3 to 6.

[0067] Item 8. The vector of Item 7, which includes a plasmid, a lipid nanoparticle (LNP), a transposon, a cosmid, a bacterial artificial chromosome, a virus-like particle (VLP) and a viral vector, optionally, the viral vector includes a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a herpes simplex viral vector.

[0068] Item 9. A cell comprising the vector of Item 8, optionally, the cell is a prokaryotic cell or a eukaryotic cell.

[0069] Item 10. A vector system for treating epidermolysis bullosa (EB), comprising one or more vectors, wherein the one or more vectors include:

[0070] 1) a nucleotide sequence targeting a mutant gene causing EB, for knocking out or knocking down the mutant gene causing EB; and

[0071] 2) the nucleotide sequence encoding the normal gene corresponding to the mutant gene causing EB,

[0072] The components 1) and 2) are located on the same or different carriers of the system.

[0073] Item 11. The vector system according to Item 10, wherein the EB-causing mutant gene comprises one or more genes selected from the group consisting of KRT5, KRT14, PLEC, KLHL24, CD151, DST, EXPH5, ​​TGM5, JUP, PKP1, and DSP.

[0074] Item 12. The vector system according to Item 10 or 11, wherein the vector comprises a plasmid, a lipid nanoparticle (LNP), a transposon, a cosmid, a bacterial artificial chromosome, a virus-like particle (VLP) and a viral vector, optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a herpes simplex viral vector.

[0075] Item 13. A vector system according to any one of Items 10-12, wherein the EB-causing mutant gene is knocked out or knocked down by one or more methods selected from the following: CRISPR homologous recombination, single base editing, PrimeEditing, RNA interference and RNA editing.

[0076] Item 14. The vector system according to any one of Items 10 to 13, wherein the nucleotide sequence targeting the EB-causing mutant gene comprises siRNA, shRNA, microRNA (miRNA), a nucleic acid construct consisting of shRNA and microRNA, or sgRNA for knocking out or knocking down the EB-causing mutant gene.

[0077] Item 15. The vector system according to any one of Items 10 to 14, wherein the EB-causing mutant gene comprises the KRT5 gene and / or the KRT14 gene.

[0078] Item 16. The vector system according to any one of Items 10 to 15, wherein the vector is a herpes simplex virus vector, optionally a type I herpes simplex virus vector, and preferably, the herpes simplex virus vector genome is selected from the group consisting of ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more of the regions are disrupted or knocked out.

[0079] Item 17. A vector system according to Item 16, wherein the components 1) and 2) are located on the same or different herpes simplex virus vectors, and optionally, the components 1) and 2) are located on the same or different sites on the same herpes simplex virus vector, and the site is selected from one or more of the following disrupted or knocked-out gene sites: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S area.

[0080] Item 18. A vector system according to any one of Items 15-17, wherein the nucleotide sequence targeting the mutated gene causing EB includes a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, and the nucleotide sequence is a shRNA for knocking down the KRT5 gene and / or the KRT14 gene, optionally, the shRNA comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0081] Item 19. The vector system according to any one of Items 10 to 17, wherein the nucleotide sequence targeting the mutant gene causing EB is a nucleic acid construct comprising an shRNA targeting the mutant gene causing EB and a miRNA backbone.

[0082] Item 20. The vector system according to Item 19, wherein the shRNA targeting the mutant gene causing EB is a shRNA targeting the KRT5 gene and / or the KRT14 gene.

[0083] Item 21. The vector system according to Item 20, wherein the shRNA targeting the KRT5 gene and / or the KRT14 gene comprises the short hairpin RNA described in Item 1 or 2.

[0084] Item 22. The vector system according to Item 19, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.

[0085] Item 23. The vector system described in Item 21 or 22 comprises the nucleotide sequence shown in SEQ ID NO: 45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0086] Item 24. The vector system of any one of Items 10-23, wherein the nucleotide sequence encoding keratin comprises the nucleotide sequence shown in SEQ ID NO:43 or 44 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0087] Item 25. A vector system according to any one of Items 16-24, further comprising an ICP34.5 gene and / or an IR L / IR S Regions are disrupted or knocked out.

[0088] Item 26. A composition comprising the carrier system according to any one of Items 10-25.

[0089] Item 27. The composition according to Item 26, which is a pharmaceutical composition, further comprising a pharmaceutically acceptable excipient.

[0090] Item 28. Use of the short hairpin RNA (shRNA) described in any one of Items 1-2, the nucleic acid construct described in any one of Items 3-6, the vector described in any one of Items 7-8, the vector system described in any one of Items 10-25, or the composition described in any one of Items 26-27 in the preparation of a treatment for epidermolysis bullosa.

[0091] Item 29. The use according to Item 28, wherein the epidermolysis bullosa is epidermolysis bullosa simplex.

[0092] Item 30. A method for treating epidermolysis bullosa, comprising administering to a subject in need thereof an effective amount of the composition described in any one of Items 26-27.

[0093] Item 31. The method according to Item 30, wherein the epidermolysis bullosa is epidermolysis bullosa simplex.

[0094] It should be understood that within the scope of this application, the above-mentioned technical features of the present invention and the technical features described in detail below can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described in detail.

[0095] Since the genome lengths of different HSV-1 strains are different, the positions of the HSV-1 genome bases (nucleotides) described in each embodiment of the present application are determined with reference to the HSV-1 laboratory virus strain 17 genome (NC_001806.2). The positions corresponding to the HSV-1 genome base (nucleotide) positions described in each embodiment of the present application in different virus strains can be obtained by sequence alignment. Specifically, when describing the positions of mutations, knockouts, insertions, etc. performed on the viral genome, the base positions corresponding to the HSV-1 laboratory virus strain 17 genome are listed in the present invention, and the genome sequences of any other HSV-1 virus strains are compared with the genome sequences of the laboratory virus strain 17 using sequence alignment tools such as BLAST, Vector NTI, DNAstar, etc. Therefore, the technical solutions for the base positions of any other HSV-1 virus strains corresponding to the base positions of the laboratory virus strain 17 involved in the present invention are also included in the scope of the claims of the present application.

[0096] The beneficial effects of the present invention are as follows: the present invention provides a novel HSV-1 replication-deficient recombinant viral vector, which can more efficiently express exogenous genes compared to the existing HSV-1 replication-deficient recombinant viral vector, thereby effectively treating diseases such as genetic diseases, skin diseases, and muscle diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 Schematic diagram of the HSV-1 genome.

[0098] Figure 2 Schematic diagram of the ICP4 gene and ICP27 gene of HSV-1.

[0099] Figure 3 Schematic diagram of the recombinant viral vector A1.

[0100] Figure 4 Schematic diagram of the recombinant viral vector B1.

[0101] Figure 5Schematic diagram of the recombinant viral vector A2.

[0102] Figure 6 Schematic diagram of the recombinant viral vector B2.

[0103] Figure 7 These are fluorescence microscopy images of green fluorescent protein expressed in Vero and CCC-ESF-1 cells infected with different recombinant viral vectors.

[0104] Figure 8 Schematic diagram of recombinant viral vector C.

[0105] Fig. 9 Schematic diagram of recombinant viral vector D.

[0106] Fig.10 Schematic diagram of recombinant viral vector E.

[0107] Fig.11 Schematic diagram of recombinant viral vector F.

[0108] Fig.12 Schematic diagram of the recombinant viral vector G.

[0109] Fig.13 These are the results of expression verification of genes carried by HSV-1 replication-deficient recombinant viral vectors.

[0110] Fig.14 The results of COL7 protein detection in the supernatant of human primary keratinocytes at different time points after infection with recombinant viral vector D. M: protein molecular weight (kD); 1: 24 hours; 2: 48 hours; 3: 72 hours; 4: negative control; 5: positive control.

[0111] Fig.15 The results of COL7 protein detection in the supernatant of immortalized human dermal fibroblasts HSF (SV40) at different time points after infection with recombinant viral vector D. M: protein molecular weight (kD); 1: 24 hours; 2: 48 hours; 3: 72 hours; 4: negative control; 5: positive control.

[0112] Fig.16 Immunofluorescence staining of NC1 in the skin tissue of the mouse administration site.

[0113] Fig.17 NC2 immunofluorescence staining of the skin tissue at the administration site of mice.

[0114] Fig.18 Immunohistochemical staining of NC1 in the skin tissue of the mouse administration site.

[0115] Fig.19 NC2 immunohistochemical staining of the skin tissue at the drug administration site of mice.

[0116] Fig. 20 The figure shows the phenotypic changes of the recombinant viral vector D before and after administration in DEB mice.

[0117] Fig.21 Schematic diagram of the recombinant viral vector H.

[0118] Fig. 22 Schematic diagram of recombinant viral vector I.

[0119] Fig.23 Schematic diagram of recombinant viral vector J.

[0120] Fig.24 Detection of the expression product of recombinant viral vector H. M: protein molecular weight standard; 1: type I collagen expressed by recombinant viral vector H; 2: cell protein control.

[0121] Fig.25 Detection of the expression product of recombinant viral vector I. M: protein molecular weight standard; 1: type III collagen, the expression product of recombinant viral vector I; 2: cell protein control.

[0122] Fig.26 Detection of the expression product of recombinant viral vector J. M: protein molecular weight standard; 1: type XVII collagen, the expression product of recombinant viral vector J; 2: cell protein control.

[0123] Fig. 27 Schematic diagram of the recombinant viral vector K.

[0124] Fig.28 Schematic diagram of the recombinant viral vector L.

[0125] Fig.29 Schematic diagram of the recombinant viral vector M.

[0126] Fig.30 Detection of the expression product of recombinant viral vector K. M: protein molecular weight standard; 1: cell protein control; 2: blank control; 3-5: SIRT1 protein expressed by recombinant viral vector K.

[0127] Fig.31 Detection of the expression product of the recombinant viral vector L. M: protein molecular weight standard; 1-3: SIRT3 protein expressed by the recombinant viral vector L; 2: cell protein control.

[0128] Fig.32 Detection of the expression product of the recombinant viral vector M. M: protein molecular weight standard; 1-4: SIRT6 protein expressed by the recombinant viral vector M; 2: cell protein control.

[0129] Fig.33This is the effect of shRNA knocking down the expression of KRT5 gene.

[0130] Fig.34 This is the effect of knocking down the expression of KRT14 gene by shRNA.

[0131] Fig.35 Schematic diagram of recombinant viral vectors N and O.

[0132] Fig.36 Schematic diagram of recombinant viral vectors P and Q.

[0133] Fig.37 Schematic diagram of the recombinant viral vector R.

[0134] Fig.38 The results of TGM1 protein immunoblotting test. M: protein molecular weight standard; 1: HaCat cell lysis protein; 2: HaCat cell lysis protein infected by recombinant virus vector R.

[0135] Fig.39 The results of TGM1 protein immunofluorescence test.

[0136] Fig.40 Schematic diagram of the recombinant viral vector S.

[0137] Fig.41 Schematic diagram of the recombinant viral vector T.

[0138] Fig.42 The results of Dys protein immunoblotting. M: protein molecular weight; 1: cell supernatant; 2-3: recombinant virus vector S transfected cell sample; 4: recombinant virus vector T transfected cell sample.

[0139] Fig.43 The concentration of CK in the serum of mice in each experimental group after administration.

[0140] Fig.44 The concentration changes of TNNI2 in the serum of mice in each experimental group after administration.

[0141] Fig.45 These are the forelimb grip strength test results of mice in each experimental group at 12 weeks.

[0142] Fig.46 The results of eMHC protein immunohistochemistry were shown in Figure 2.

[0143] Fig.47 Schematic diagram of recombinant viral vector U.

[0144] Fig.48 The results of immunoblotting of ATP2C1 protein. M: molecular weight standard; 1. HaCat cells; 2-5. HaCat cell samples transfected with recombinant viral vector U.

[0145] Figures 49A-49B This is the result of immunofluorescence detection of ATP2C1 protein. Fig.49A HaCat cells were transfected with recombinant viral vector U; Fig.49B These are HaCat cells. DETAILED DESCRIPTION

[0146] The specific embodiments of the present invention are described in detail below, but it should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples without specifying specific experimental conditions are usually operated under conventional conditions or under conditions recommended by the manufacturer.

[0147] Unless explicitly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising" etc. will be understood to include the stated elements or components but not to exclude other elements or components.

[0148] As used herein, the term "replication defective" refers to a viral vector that cannot replicate completely and effectively. A replication defective virus is a mutant or defective type with respect to one or more functions essential to viral genome replication or viral particle synthesis and assembly. A replication defective virus can be propagated in a complementary cell line expressing the missing gene product. However, in normal target cells, a replication defective virus can express viral gene products, but will not replicate to form infectious progeny viral particles. In some embodiments, a replication defective virus or viral vector is a mutant or defective type of a virus or vector with respect to one or more functions essential to viral genome replication. In some embodiments, a replication defective virus or viral vector is a mutant or defective type of a virus or vector with respect to one or more functions essential to viral particle synthesis and assembly.

[0149] In one embodiment of the present invention, the replication-defective viral vector is an HSV-1 viral vector.

[0150] "Genomic segment" refers to a specific nucleotide position in the genome. The nucleotide position of a specific genomic segment of the HSV-1 genome in this application is determined with reference to the HSV-1 laboratory strain 17 genome (NC_001806.2). Those skilled in the art will appreciate that the specific nucleotide positions may vary in the genomes of different HSV-1 strains, but those skilled in the art can determine the nucleotide position corresponding to the specific genomic segment disclosed in this application based on conventional techniques. Therefore, this application covers specific genomic segments determined with reference to the HSV-1 laboratory strain 17 genome (NC_001806.2), and also covers genomic segments corresponding to the genomic segments in different HSV-1 strains.

[0151] In some embodiments, the genome segment of the nucleotide sequence from 1-100 nucleotides upstream and downstream of the 126785th nucleotide to 1-100 nucleotides upstream and downstream of the 131176th nucleotide in the genome of the replication-deficient recombinant herpes simplex virus type I (HSV-1) vector is destroyed or knocked out. In the present application, the numerical range of 1-100 covers any positive integer in the numerical range. In the present application, the term "a genomic segment of a nucleotide sequence from 1-100 nucleotides upstream and downstream of the 126785th nucleotide to 1-100 nucleotides upstream and downstream of the 131176th nucleotide" covers a genomic segment of a nucleotide sequence from any positive integer nucleotide in the range of 1-100 nucleotides upstream and downstream of the 126785th nucleotide to any positive integer nucleotide in the range of 1-100 nucleotides upstream and downstream of the 131176th nucleotide. For example, a genomic segment of the nucleotide sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 upstream and downstream of nucleotide 126785 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 upstream and downstream of nucleotide 131176 is disrupted or knocked out (the specific nucleotide positions upstream and downstream of nucleotide 126785 and the specific nucleotide positions upstream and downstream of nucleotide 131176 described herein can be any combination).

[0152] In some embodiments, the genome segment of the nucleotide sequence from 1-823 nucleotides upstream and downstream of nucleotide 147025 to 1-93 nucleotides upstream and downstream of nucleotide 151439 in the genome of the replication-deficient recombinant herpes simplex virus type I (HSV-1) vector is destroyed or knocked out. In the present application, the numerical range of 1-823 and the numerical range of 1-93 cover any positive integers within the above numerical ranges. In the present application, the term "a genomic segment of a nucleotide sequence from 1-823 nucleotides upstream and downstream of nucleotide 147025 to 1-93 nucleotides upstream and downstream of nucleotide 151439" covers a genomic segment of a nucleotide sequence from any positive integer nucleotides within the range of 1-823 nucleotides upstream and downstream of nucleotide 147025 to any positive integer nucleotides within the range of 1-93 nucleotides upstream and downstream of nucleotide 151439. 800, 805, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 805, 810, 811, 812, 813, 814, 815, 816, 817, 818, The genomic segment of the nucleotide sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93 upstream and downstream of nucleotide 151439 is destroyed or knocked out (the specific nucleotide positions upstream and downstream of nucleotide 147025 and the specific nucleotide positions upstream and downstream of nucleotide 151439 described here can be any combination).

[0153] In some embodiments, the genome segment of the nucleotide sequence from 1-257 nucleotides upstream and downstream of nucleotide 113494 to 1-223 nucleotides upstream and downstream of nucleotide 115314 in the genome of the replication-deficient recombinant herpes simplex virus type I (HSV-1) vector is destroyed or knocked out. In the present application, the numerical range of 1-257 and the numerical range of 1-223 cover any positive integers within the above numerical ranges. In the present application, the term "a genomic segment of a nucleotide sequence from 1-257 nucleotides upstream and downstream of nucleotide 113494 to 1-223 nucleotides upstream and downstream of nucleotide 115314" covers a genomic segment of a nucleotide sequence from any positive integer nucleotides within the range of 1-257 nucleotides upstream and downstream of nucleotide 113494 to any positive integer nucleotides within the range of 1-223 nucleotides upstream and downstream of nucleotide 115314. For example, from nucleotide 113494 upstream and downstream 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 251, 252, 253, 254, 255, 256, 257 to nucleotide 115314 upstream and downstream 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 The genomic segment of the nucleotide sequence at positions 0, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 205, 210, 215, 220, 221, 222, and 223 is disrupted or knocked out (the specific nucleotide positions upstream and downstream of nucleotide position 113494 and the specific nucleotide positions upstream and downstream of nucleotide position 115314 described herein can be any combination).

[0154] As used herein, the term "exogenous" refers to a nucleotide sequence that is not derived from a specific cell, but is introduced into the cell by a DNA delivery method, such as transfection, electroporation or transduction by a viral vector. Therefore, an exogenous nucleotide sequence is an artificial sequence, wherein the man-made object may be derived from, for example, a combination of subsequences from different sources (e.g., a combination of a recombinase recognition sequence with an SV40 promoter and a coding sequence for green fluorescent protein is an artificial nucleic acid), or a deletion of a partial sequence (e.g., a sequence encoding only the extracellular domain of a membrane-bound receptor or cDNA) or a mutation of a nucleobase. The term "endogenous" refers to a nucleotide sequence derived from a cell. An "exogenous" nucleotide sequence may have an "endogenous" counterpart that is identical in base composition, but wherein the sequence (e.g., by recombinant DNA technology) is introduced into a cell to become an "exogenous" sequence.

[0155] As used herein, the term "Vero cells", also known as green monkey kidney cells, are an aneuploid African green monkey (genus name: Chlorocebus) kidney cell line. In 1962, Mihiro Yasumura of Chiba University, Japan, isolated normal adult African green monkey renal epithelial cells and obtained this cell line. Vero cells are a continuous aneuploid cell line, which means that it has an abnormal number of chromosomes, and as a continuous cell line, Vero cells can go through many division cycles without aging. Vero cells have defects in interferon secretion function, and unlike normal mammalian cells, they do not secrete interferon α / β when infected by viruses. However, they still have receptors for interferon-α / β, so they can still respond when recombinant interferon is added to their culture medium. Vero cells are currently widely used in the study of the molecular mechanisms of viral infection, the production of vaccines and recombinant proteins, and are regarded as an ideal cell model for cultivating influenza vaccines and studying the molecular mechanisms of viral infection.

[0156] In some embodiments, a complementing cell line that supports replication of a replication-defective viral vector is obtained by transfecting Vero cells.

[0157] Preferably, the compensatory cell line is the ZH02 compensatory cell line and / or the ZH06 compensatory cell line.

[0158] As used herein, the term "coding sequence" refers to a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are usually determined by an open reading frame, usually starting with the ATG start codon or alternative start codons such as GTG and TTG, and ending with a stop codon such as TAA, TAG, and TGA. The coding sequence can be a DNA, cDNA, synthetic or recombinant polynucleotide.

[0159] As used herein, the term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0160] As used herein, the term "expression vector" refers to a linear or circular DNA molecule that includes a polynucleotide encoding a polypeptide and is operably linked to additional nucleotides that provide for its expression.

[0161] As used herein, the term "type I collagen (COL1)" is a type of collagen that forms fibers and is found in most connective tissues, and is abundant in bones, corneas, dermis, and tendons. COL1 is the most common type of collagen in the body, with a large diameter, dense arrangement, and no elasticity. It mainly plays a supporting role. Supplementing COL1 can improve aging conditions such as skin sagging, wrinkles, and dryness, and make the skin plump and firm.

[0162] As used herein, the term "type III collagen (COL3)" is a fibrous collagen found in extensible connective tissues such as the skin, lungs, uterus, intestines, and vascular system, and is usually associated with type I collagen. COL3 is one of the main structural proteins of the skin and plays an important role in the elasticity and firmness of the skin.

[0163] As used herein, the term "elastin (ELN)" is one of the two components of elastic fibers. Elastic fibers form part of the extracellular matrix and give organs and tissues elasticity. Elastin can maintain and support skin elasticity and has anti-aging effects.

[0164] As used herein, the term "sirtuin 1 (SIRT1)" is a protein that is a NAD + -dependent deacetylase, regarded as a sensor of cellular energy and metabolism. SIRT1 is considered one of the members most relevant to anti-aging. Studies have found that SIRT1 regulates multiple signaling pathways related to aging through deacetylation, promotes cell survival and resists oxidative stress, and slows down the aging process.

[0165] As used herein, the term "sirtuin 3 (SIRT3)" is a NAD + -dependent deacetylase that regulates the roles of many mitochondrial proteins in metabolism, oxidative stress, and cell survival. It is an instrumental regulator of mitochondrial adaptive responses, including metabolic reprogramming and enhanced antioxidant defense mechanisms. SIRT3 is involved in the regulation of fat metabolism and can help control body weight by promoting fatty acid oxidation and inhibiting fat synthesis, which is of great significance in body management and body shaping.

[0166] As used herein, the term "sirtuin 6 (SIRT6)" is an NAD + -dependent deacetylase, plays a role in chromatin signaling and genome maintenance. Through these functions, SIRT6 can prevent diseases associated with aging, and SIRT6 and SIRT1 play a role in the metabolism and inflammatory response of skin cells. By activating these genes, skin hydration, elasticity and radiance can be improved, and wrinkles can be reduced.

[0167] As used herein, the term "sirtuin 7 (SIRT7)" is a recently identified member of the SIRT family that plays an important role in DNA repair and maintaining genome stability, helping cells maintain physiological homeostasis and providing anti-aging protection.

[0168] As used herein, the term "steroid sulfatase (STS)" refers to any sulfatase involved in steroid metabolism. STS can degrade cholesterol sulfate to produce cholesterol, which acts as a skin barrier. The accumulation of cholesterol sulfate promotes the degradation of desmosomes, leading to normal desquamation of the skin. X-linked ichthyosis is caused by the deletion and mutation of the STS gene. The lack of STS in the patient's skin cells causes cholesterol sulfate to accumulate in the stratum corneum, changing the physical properties between the stratum corneum cell membranes. The normal desquamation process of the skin is prolonged and scales and thickened skin are formed (Wren GH, Davies W. X-linked ichthyosis: New insights into a multi-system disorder. Skin Health Dis. 2022 Oct 17;2(4):e179).

[0169] As used herein, the term "transglutaminase 1 (TGM1)" is an enzyme that catalyzes acyl transfer reactions between proteins, thereby causing covalent cross-linking between proteins (or polypeptides). It is reported that TGM1 is associated with autosomal recessive congenital ichthyoses (ARCI). Currently, there are 13 known pathogenic mutation genes for the disease, of which 30-50% are TGM1 mutations. As many as 140 mutation types have been reported for this gene (see Herman et al., 2009; CN113234722B).

[0170] As used herein, the term "ATPase Secretory Pathway Ca2+ transporter 1" 2+ Transporting 1 (ATP2C1) belongs to the P-type cation transporter ATPase family. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP and the transport of calcium ions. Studies have shown that mutations in the ATP2C1 gene ultimately lead to chronic familial benign Hailey-Hailey Disease (HHD) is an autosomal dominant genetic disease (see Deng H, Xiao H. The role of the ATP2C1 gene in Hailey-Hailey disease. Cell Mol Life Sci. 2017 Oct;74(20):3687-3696.).

[0171] As used herein, the term "Serine Peptidase Inhibitor Kazal Type 5 (SPINK5)" encodes a multidomain serine protease inhibitor containing 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to produce a variety of protein products that may exhibit unique activities and specificities. These proteins may play a role in the morphogenesis of skin and hair and in the anti-inflammatory and antibacterial protection of mucous epithelial cells. Mutations in this gene may cause Netherton syndrome, a disease characterized by ichthyosis, keratinization defects, and atopy (see CN115052900A).

[0172] As used herein, the term "type VII collagen (COL7)" consists of three identical alpha collagen chains and is localized to the basal zone beneath stratified squamous epithelial cells. COL7 is associated with all forms of dystrophic epidermolysis bullosa.

[0173] As used herein, the term "keratin 5 (KRT5)" is a member of the keratin gene family. Type II cytokeratins consist of basic or neutral proteins arranged in pairs of heterotypic keratin chains that are co-expressed during differentiation of simple and stratified epithelial tissues. KRT5 is associated with a complex disease called epidermolysis bullosa simplex (EBS).

[0174] As used herein, the term "keratin 14 (KRT14)" is a type I keratin protein that is usually found as a heterotetramer with two molecules of keratin 5. Mutations in the genes for these keratins are associated with epidermolysis bullosa simplex.

[0175] Since most simple bullous epidermolysis bullosa is caused by dominant negative mutant genes, the mutant gene expression products will cause the functional activity of normal gene expression products to be lost, so simply supplementing normal genes cannot achieve a therapeutic effect. The present invention provides a method for treating simple bullous epidermolysis bullosa, specifically, by simultaneously inserting 1) a sequence for knocking out a mutated keratin gene and 2) an exogenous normal keratin gene sequence into an HSV-1 replication-deficient viral vector, after delivery into skin cells, on the one hand, the mutant gene is knocked out to prevent its expression product from inhibiting the normal protein function, and on the other hand, the normal gene expression functional protein is supplemented, thereby restoring skin function. Among them, the supplemented exogenous normal gene is sequence optimized, which is different from the wild-type gene sequence, so as to avoid the knockout gene sequence from shearing the supplemented exogenous normal gene.

[0176] As used herein, the term "type XVII collagen (COL17)" is a transmembrane protein. Collagen XVII is a structural component of hemidesmosomes, which are multiprotein complexes located in the dermal-epidermal basement membrane region that mediate the adhesion of keratinocytes to the underlying membrane. COL17 is associated with benign systemic atrophic disease and junctional epidermolysis bullosa.

[0177] As used herein, dystrophinopathy is a group of X-linked recessive inherited muscle diseases that mainly affect skeletal muscle and / or cardiac muscle, caused by pathogenic variants in the dystrophin gene (dystrophin, Dys) (OMIM: 300377) located at Xp21.2, including Duchenne muscular dystrophy (Duchenne muscular dystrophy, DMD), Becker muscular dystrophy (Becker muscular dystrophy, BMD), intermediate muscular dystrophy (Intermediate muscular dystrophy, IMD) and X-linked dilated cardiomyopathy (XLDCM). The Dys gene is about 2.2Mb in length and contains 79 exons. It is the largest known human gene and is prone to mutations due to its long gene fragment. The Dys protein is a structural protein that maintains the integrity of muscle fibers and protects them from damage caused by contraction. The deficiency of dystrophin protein in patients with dystrophinopathy mainly leads to defects in skeletal muscle cell membranes, leakage of intracellular creatine kinase, muscle cell necrosis, hyperplasia of adipose tissue and fibrous connective tissue, damage to the stability and function of muscle fibers, and ultimately muscle degeneration.

[0178] DMD is a fatal disease and one of the most common lethal genetic diseases, mainly occurring in males. Globally, the incidence of DMD in male newborns is about 1 / 3500, and the number of symptomatic female carriers is estimated to be 1 / 100000-1 / 45000. There are thousands of different gene mutations in DMD patients, which occur almost anywhere in the Dys gene. DMD patients will experience an inflammatory response shortly after birth, which will lead to muscle fibrosis and muscle atrophy and degeneration. Muscle damage initially occurs in the proximal muscles of the lower limbs, accompanied by decreased muscle strength and progressive contractures with gait disorders. Subsequently, as the strength of the upper limb muscles decreases, patients develop arm contractures, respiratory muscles and myocardium are damaged, causing respiratory and / or heart failure, making the patient's life expectancy rarely exceed 40 years. Despite decades of research, DMD is still incurable. Standardized multidisciplinary comprehensive treatment can slow the progression of the disease, prolong the patient's life and improve his quality of life. The most commonly used drug for the treatment of DMD in clinical practice is glucocorticoids. The use of glucocorticoids is to reduce the damage of inflammation to the muscles, thereby reducing the loss of muscle strength and delaying the progression of the disease. However, long-term use of hormones brings many side effects, such as osteoporosis, obesity, hirsutism, adrenal insufficiency, etc., and these hormone drugs do not treat the cause and cannot prevent the occurrence and progression of DMD. They only play a role in temporarily prolonging the patient's survival (Guidelines for the Diagnosis and Treatment of Duchenne Muscular Dystrophy in China, Chinese Journal of Neurology, 2016, 49 (1): 17-20).

[0179] Example

[0180] Preparation Example 1 Preparation of HSV-1 replication-deficient recombinant virus vector

[0181] The HSV-1 viral genome consists of long terminal repeats (TRs) L ), long unique segment (U L ), long internal repeat (IR L ), short internal repeat (IR S ), short unique segment (U S ) and short terminal repeats (TR S )composition( Figure 1 ). Specific regions of the HSV-1 genome (e.g. Figure 2 By modifying the vector (as shown in the figure), an HSV-1 replication-defective viral vector can be obtained.

[0182] According to the method in the literature (Stuart CR, Seymour LD, James F N. Mutant simplexviruses and uses thereof. WO9938955A3), IR was knocked out by genetic engineering in the HSV-1 viral genome. S and TR S The 126785-131735 bp and 146471-151439 bp positions of the region, which involve the ICP4 region of the HSV-1 virus, were deleted, and the ICP4 promoter and ICP4 gene were deleted, and the green fluorescent protein (GFP) marker gene was inserted at this position to obtain the recombinant viral vector A1 ( Figure 3 ).

[0183] According to the method of the literature (Howard, M., Kershaw, T., Gibb, B. et al. High efficiency gene transfer to the central nervous system of rodents and primates using herpes virus vectors lacking functional ICP27 and ICP34.5. Gene Ther 5, 1137–1147 (1998)), the U was knocked out from the HSV-1 viral genome. L The 113280-116878 bp region of the region deleted ICP27, U L 55 and U L 56 gene, and inserted the GFP gene at this position to obtain the recombinant viral vector B1 ( Figure 4 ).

[0184] Preparation Example 2 Optimization of HSV-1 replication-deficient viral vector

[0185] Reference to the method described in the patent application with application publication number CN113046331A to knock out HSV-1 genome IR S and TR S The 126785-131176 bp and 147025-151439 bp regions of the region involve the ICP4 gene region of the HSV-1 virus, and the GFP gene is inserted at this position to obtain the viral vector A2 ( Figure 5 ).

[0186] Reference is made to the method described in the patent application of application publication number CN113046331A for knocking out U on the HSV-1 viral genome. LThe 113494-115314 bp region of the region involves the ICP27 gene region of the HSV-1 virus, and the GFP gene is inserted at this position to obtain the viral vector B2 ( Figure 6 ).

[0187] Viral vectors with deletion of ICP4 and ICP27, essential genes for HSV-1 replication, need to be prepared and grown on a compensatory cell line that can compensate for ICP4 and ICP27 genes. ICP4 gene (Gene ID: 2703392) and ICP27 gene (Gene ID: 24271474) were simultaneously cloned into a plasmid (Takara, 3244) carrying a puromycin selection gene. According to the instructions of Lipofectamine™ 3000 (Thermo, L3000015), the plasmids were stably transfected into Vero cells by lipofectamine method to obtain the ZH02 compensatory cell line that supports the replication of replication-deficient viral vectors. ICP0 gene (Gene ID: 2703390) is a non-essential gene for HSV-1 replication, but its knockout will affect the expression of exogenous genes. The ICP4, ICP27 and ICP0 genes were simultaneously cloned into a plasmid carrying a puromycin selection gene, and the plasmids were stably transfected into Vero cells by liposome method to obtain the ZH06 compensatory cell line that supports the replication of replication-defective viruses.

[0188] Example 1 Optimized HSV-1 replication-deficient recombinant viral vector expresses higher levels of exogenous genes

[0189] The cells were cultured in DMEM medium containing 10% serum at 37°C and 5% CO 2 African green monkey kidney cells Vero (ATCC) and human embryonic skin fibroblasts CCC-ESF-1 (Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences) were cultured under different conditions, and the two types of cells were inoculated into six-well plates, and two experimental groups were set up for each cell type, with 2 wells in each group, and blank cell control wells were set up at the same time. After 24 hours, each experimental group was inoculated with recombinant viral vector A1, recombinant viral vector B1, recombinant viral vector A2 and recombinant viral vector B2 at an MOI of 1. After 72 hours, the green fluorescence was observed under a fluorescence microscope and photographed. The results showed that after the recombinant viral vectors A2 and B2 infected the two cells, the green fluorescence brightness expressed was higher than that of A1 and B1; after the recombinant viral vector A2 infected the two cells, the green fluorescence brightness expressed was higher than that of the recombinant viral vector B2 ( Figure 7 ).

[0190] The experimental results show that in the ICP4 and ICP27 regions, the recombinant viral vectors obtained by inserting exogenous genes into specific positions in the above-mentioned regions of the HSV-1 genome according to the present invention express higher amounts of exogenous genes than the recombinant viral vectors obtained according to the literature methods, especially the recombinant viral vectors obtained by inserting exogenous genes into specific positions in the ICP4 region express the highest amount of exogenous genes.

[0191] HSV-1 has a 152kb genome. After infection into cells, the viral genome will be epigenetically modified, and different genomic regions have different modifications, which causes different expression levels of exogenous genes at different sites. After knocking out different viral fragments and inserting exogenous genes at the same site (such as ICP4 or ICP27), the expression level of the exogenous gene will also be different, mainly because the knocked-out viral sequence may contain regulatory elements of gene expression (such as promoters, enhancers, cis or trans regulatory elements). The present invention optimizes the position of the virus knockout fragment in the exogenous gene insertion area, and the recombinant virus obtained by inserting the exogenous gene into the specific position of the above-mentioned region of the HSV-1 genome expresses a higher amount of exogenous genes than the recombinant virus obtained according to the literature method.

[0192] Preparation Example 3 Preparation of HSV-1 replication-deficient recombinant virus vector carrying foreign genes

[0193] According to the method described in the patent application with application publication number CN113046331A, the GFP gene was replaced at the knockout position of the recombinant viral vector A2, and the COL7A1 gene encoding type VII collagen (NM_000094.4) was inserted to obtain the recombinant viral vector C ( Figure 8 ). Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced by the COL7A1 gene to obtain the recombinant viral vector D ( Fig. 9 ). Based on the recombinant viral vector A2, ICP22 and ICP27 were knocked out, and the GFP gene was replaced by the COL7A1 gene to obtain the recombinant viral vector E ( Fig.10 ).

[0194] According to the method described in the patent application with application publication number CN113046331A, the GFP gene was replaced at the knockout position of the recombinant viral vector B2, and the COL7A1 gene was inserted to obtain the recombinant viral vector F ( Fig.11According to the method in the literature (Miyagawa Y, Marino P, et al., Herpes simplex viral-vector design for efficient transduction of nonneuronal cells without cytotoxicity. Proc Natl Acad Sci USA. 2015, 112 (13): E1632-41), the ICP0, ICP22, ICP4 and JOINT regions were knocked out on the basis of the recombinant viral vector B2, and the GFP gene was replaced by the COL7A1 gene to obtain the recombinant viral vector G ( Fig.12 ).

[0195] Example 2 Verification of expression of genes carried by HSV-1 replication-deficient recombinant virus vector

[0196] ZH02 and ZH06 complement cell lines were seeded into six-well plates and incubated at 37°C with 5% CO 2 After 2 days of cell culture, recombinant viral vectors C, D and E were added to ZH02 cells at an MOI of 0.01, and recombinant viral vectors F and G were added to ZH06 cells. Cell negative control wells were set. The transfected cells were continued to be cultured at 37°C and 5% CO 2 After culturing for 3 days under the same conditions, the culture supernatant was taken and the expression of type VII collagen was detected using an ELISA kit (Abclonal, RK01162). The results showed that there was no significant difference in the expression of the target protein after the cells were transfected with recombinant viral vectors C, D and E, and there was no significant difference in the expression of the target protein after the cells were transfected with recombinant viral vectors F and G.

[0197] The results showed that the recombinant virus vector obtained by inserting the functional gene COL7A1 after specific modification of the ICP4 and ICP27 regions of the HSV-1 genome in this application did not significantly affect the expression level of the COL7A1 gene after further modification ( Fig.13 ).

[0198] Example 3 Functional verification of the HSV-1 vector carrying the type VII collagen gene (COL7A1)

[0199] Western blotting was used to detect the expression level of COL7A1 gene in human keratinocytes and fibroblasts by recombinant viral vector D. Human primary keratinocytes and human immortalized dermal fibroblasts HSF (SV40) (Hefei Wanwu) were cultured in DMEM medium containing 15% fetal bovine serum. The cells were seeded in 6-well plates (1.5×10 6Cells / well) were added with recombinant viral vector D at an MOI of 2, and the supernatant was harvested after 24, 48, and 72 hours. 50 μl of each supernatant sample was added to 6× loading buffer (DL101-02, Quanshijin) and boiled for 10 minutes to prepare the loading mixture, which was added to the wells of denatured protein precast gel (PG41510-S, Solebol), electrophoresed at 150V for 50 minutes, and then transferred to PVDF membrane (ISEQ0001010, Millipore) at 200 mA for 2 hours. Protein immunoblotting experiments were performed using specific antibodies COL7A1 antibody (with goat anti-rabbit secondary antibody) (D161588-0100, Shanghai Bioengineering) and β-actin antibody (PA1-183, Thermo). Finally, chemiluminescence detection was performed using the reagent Pierce ECL Western Blotting Substrate (32109, Thermo). The results showed that the recombinant viral vector D was able to express the target gene COL7A1 in both human keratinocytes and fibroblasts, producing type VII collagen that could be detected within 24 hours ( Fig.14 and Fig.15 ).

[0200] Type VII collagen is a structural protein that anchors the epidermis and dermis. Immunofluorescence (IF) and immunohistochemistry (IHC) were used to detect the expression level of type VII collagen in mouse skin tissue. C57BL / 6J mice aged 6-8 weeks were selected for the experiment. A recombinant virus vector D administration group and a PBS control group were set up, with one mouse in each group. The back was shaved to a 1 cm × 1 cm square, divided into 3 injection sites, with a total of 100 μl, and the drug titer was 1E8 pfu / ml. The drug was administered on the first and third days, and the administration part was sampled on the fifth day. After the tissue was fixed with 4% paraformaldehyde overnight, it was gradiently permeabilized and precipitated in a 20%-30% sucrose solution. It was embedded with OCT embedding medium and placed in an ultra-low temperature refrigerator for quick freezing. The slices were sliced ​​using a cryostat (CM1950, Leica) with a thickness of 10 μm and stored at -20°C. IF detection: After the frozen slides were rewarmed at room temperature, they were incubated with 0.1% TritonX-100 and blocked with serum. Antibodies against the N-terminal domain NC1 of type VII collagen (NBP2-37900, NOVUS-BIO) and the C-terminal domain NC2 (D161588, Sangon Biotech) were used for incubation, and goat anti-rabbit IgG (H+L) (A-11008, Invitrogen) was used as the secondary antibody. After DAPI incubation, 50% glycerol was used for sealing and detection. A negative control without primary antibody was set up for the experiment. IHC detection: After the frozen slides were rewarmed at room temperature, immunohistochemistry kit (rabbit) (KIT-9707, Maixin Biotech) was used for staining and preparation. A negative control without primary antibody was set up for the experiment.

[0201] IF staining ( Fig.16 and Fig.17 ) and IHC staining ( Fig.18 and Fig.19 ) The results showed that after two administrations of the recombinant viral vector D, NC1 and NC2 staining were visible between the mouse epidermis and dermis and in the vascular wall, indicating that the recombinant viral vector D can correctly express complete type VII collagen in mice, and that type VII collagen can be correctly distributed between the epidermis and dermis and has good physiological activity.

[0202] Example 4 Efficacy of HSV-1 vector carrying type VII collagen gene (COL7A1) in DEB mice

[0203] The deletion or mutation of the gene encoding COL7 protein can lead to the occurrence of malnutrition-type epidermolysis bullosa (DEB). Delivering the COL7A1 gene encoding COL7 protein into skin cells for gene therapy is a therapy with great therapeutic potential. Efficacy experiments were conducted on the DEB mouse model (from Jicui Yaokang), and a PBS control group, a recombinant viral vector control group without therapeutic genes, and a recombinant viral vector D treatment group were set up, with 3 mice in each group. The virus titer was 1E8 pfu / ml, and the drug was administered once every 2 days according to the size of the wound, and the wound healing was observed. The results are as follows Fig. 20 As shown, by observing typical mouse healing pictures, it was found that the wound healed in about 3 days after treatment with the recombinant viral vector D, while the wound healing in the PBS and recombinant viral vector control groups was not obvious.

[0204] Example 5 Expression verification of HSV-1 vectors carrying other collagen genes

[0205] Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, the GFP gene was replaced at the position of the ICP4 gene knockout, and the type I collagen gene (COL1A1) (NM_000088.4) was inserted to obtain the recombinant viral vector H ( Fig.21 ), inserting the type III collagen gene (COL3A1) (NM_000090.4) to obtain the recombinant viral vector I ( Fig. 22 ), inserting the type XVII collagen gene (COL17A1) (NM_000494.4) to obtain the recombinant viral vector J ( Fig.23 ).

[0206] Western blotting was used to detect the level of collagen expressed by recombinant viral vector H, recombinant viral vector I and recombinant viral vector J on human keratinocytes HaCat. HaCat cells (Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences) were cultured in DMEM medium containing 15% fetal bovine serum. The cells were seeded in 6-well plates (1.5×106 Cells / well) were added with recombinant viral vector H, recombinant viral vector I and recombinant viral vector J at MOI=0.5, and blank cell control was set. After 72 hours, cells were harvested, and whole protein lysate was prepared using a protein extraction kit (DE101, Quanshijin). The content of whole lysate protein solution was detected using a BCA protein detection kit (23227, Thermo). 30μg of each protein sample was loaded into the well of denatured protein precast gel, electrophoresed at 100V for 90 minutes, and then transferred to PVDF membrane at 200mA for 2 hours. Specific antibodies COL1A1 antibody (PA5-29569, Thermo), COL3A1 antibody (B-10) (sc-271249, Santa Cruz) and Collagen XVII antibody (NBP1-91800, novus biologicals) were used for corresponding detection, and HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime) was used as the secondary antibody. Finally, chemiluminescence detection was performed using the reagent Pierce ECL Western Blotting Substrate.

[0207] The results showed that the recombinant viral vector H could significantly express type I collagen in HaCat cells ( Fig.24 ), recombinant viral vector I can significantly express type III collagen on HaCat cells ( Fig.25 ), recombinant viral vector J can significantly express type XVII collagen on HaCat cells ( Fig.26 ).

[0208] Example 6 Expression verification of HSV-1 vector carrying SIRT gene

[0209] Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, the GFP gene was replaced at the position of the ICP4 gene knockout, and the SIRT1 gene (NM_012238.5) was inserted to obtain the recombinant viral vector K ( Fig. 27 ), insert SIRT3 gene (NM_001370322.1) to obtain recombinant viral vector L ( Fig.28 ), insert SIRT6 gene (NM_016539.4) to obtain recombinant viral vector M ( Fig.29 ).

[0210] Western blotting was used to detect the expression level of target protein in ZH02 cells by recombinant viral vector K, recombinant viral vector L and recombinant viral vector M. Cells were seeded in 6-well plates (1.5×10 6Cells / well) were added with recombinant viral vector K, recombinant viral vector L and recombinant viral vector M at MOI=0.5, and cell control was set. Cells were harvested after 72 hours, and whole protein lysate was prepared using a protein extraction kit, and the content of whole lysate protein solution was detected using a BCA protein detection kit. 30µg of each protein sample was loaded into the denatured protein precast gel well, and electrophoresis was continued at 90V for 40 minutes and 110V for 60 minutes, and then the protein on the gel was transferred to the PVDF membrane at 200mA for 2 hours. Specific antibodies SIRT1 (B-10) mouse monoclonal IgG2b (sc-74504, Santa), Mouse anti-Sirtuin3 / SIRT3 (6B2A1)-BSAFree mA (NBP2-52563, novus biologicals) and SIRT6 (2G1H1) mouse monoclonal IgG1 (sc-517196, Santa) were used for corresponding detection, and the secondary antibody was HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime). Finally, the reagent Pierce ECL Western Blotting Substrate was used for chemiluminescence detection. The results showed that the recombinant viral vector K can significantly express SIRT1 protein on cells ( Fig.30 ), the recombinant viral vector L can significantly express SIRT3 protein on cells ( Fig.31 ), the recombinant viral vector M can significantly express SIRT6 protein on cells ( Fig.32 ).

[0211] Example 7 Design of shRNA for knocking down human KRT5 and KRT14 genes

[0212] KRT5 and KRT14 gene mutations are associated with simple bullous epidermolysis and have a dominant negative effect. The mutated gene expression product will cause the functional activity of the normal gene expression product to be lost, so simply supplementing the normal gene cannot achieve a therapeutic effect. Examples 7-11 and Preparation Example 4 provide a method for treating simple bullous epidermolysis, specifically, by simultaneously inserting 1) a sequence for knocking out the mutated KRT5 and KRT14 genes and 2) an exogenous normal KRT5 and KRT14 gene sequence into an HSV-1 replication-deficient viral vector, after delivery into skin cells, on the one hand, the mutant gene is knocked out to prevent its expression product from inhibiting the normal protein function, and on the other hand, the normal gene expression functional protein is supplemented, thereby restoring skin function. Among them, the supplemented exogenous normal gene has been sequence optimized, which is different from the wild-type gene sequence, so as to avoid the knockout gene sequence from shearing the supplemented exogenous normal gene.

[0213] Knockdown shRNAs were designed for human KRT5 gene (NM_000424.4) and KRT14 gene (NM_000526.5). shRNAs were designed and optimized using VectorBuilder shRNA Target design software (https: / / en.vectorbuilder.com / tool / shrna-target-design.html), and 18 shRNAs for knockdown of KRT5 gene (as shown in SEQ ID NO: 1-18 in the sequence list) and 23 shRNAs for knockdown of KRT14 gene (as shown in SEQ ID NO: 19-41 in the sequence list) were obtained.

[0214] Example 8 Screening of shRNA for knocking down human KRT5 gene

[0215] The shRNA sequences of SEQ ID NO: 1-3 knocking down the human KRT5 gene were synthesized and cloned into the multiple cloning site of the pGMLV-Puro vector (Jiman Bio). After transforming competent cells, single colonies were picked for small-scale shaking culture, and the recombinant plasmid was extracted using a plasmid extraction kit (DP120-01, TIANGEN). The target plasmid was transfected into HaCaT cells (Jiman Bio) using an electroporator (Celetrix) for verification. HaCaT cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO 2 The HaCaT cell pellet was collected by digestion and centrifugation, and 1×10 6 Add 20 μl of electroporation solution and 2 μg of plasmid to each cell and mix well, then transfer to an electroporation tube for electroporation. Then transfer to a six-well plate, add culture medium to each well to 2 ml, and place at 37°C and 5% CO. 2After 3 days of culture in the incubator, the samples were collected. The total RNA of the cells was extracted using a total RNA extraction kit (19221ES50, Yisheng) according to the instructions of the kit. The extracted RNA was reverse transcribed using a cDNA synthesis kit (EG15133S, Bristol-Myers Squibb) according to the instructions of the kit. The obtained cDNA was used for quantitative analysis of KRT5 gene expression by real-time quantitative PCR. The primer sequences for KRT5 gene detection in PCR detection analysis were KRT5-F: TGTCTCGCCAGTCAAGTGTG and KRT5-R: CCACCCACTCCACAAGCAC, and GAPDH was used as an internal reference. The primer sequences for detection were GAPDH-F: GTCTCCTCTGACTTCAACAGCG and GAPDH-R: ACCACCCTGTTGCTGTAGCCAA. The data were analyzed using the ΔΔCt method, and the relative expression of the KRT5 gene was calculated using normal HaCaT cells with GAPDH as an internal reference.

[0216] ΔΔCt = (average Ct value of KRT5 gene in the test sample - average Ct value of the reference gene in the test sample) - (average Ct value of KRT5 gene in the control sample - average Ct value of the reference gene in the control sample)

[0217] The relative expression of the gene F = 2 -ΔΔCt .

[0218] The Ct value results of real-time quantitative PCR detection are shown in Table 1 below:

[0219] Table 1

[0220]

[0221] The effect of shRNA knocking down the expression of KRT5 gene is shown in Table 2 and Fig.33 As shown:

[0222] Table 2

[0223]

[0224] The above results showed that KRT5 shRNA1, shRNA2 and shRNA3 could significantly knock down the expression of KRT5 gene.

[0225] Example 9 Screening of shRNA for knocking down human KRT14 gene

[0226] The shRNA sequence of knocking down the human KRT14 gene of the synthetic sequence SEQ ID NO: 19-21 was cloned into the pGMLV-Puro vector according to the method of Example 8, and the recombinant plasmid was prepared by culture extraction, and the total cell RNA was extracted after electroporation of HaCaT cells, and the real-time quantitative PCR method was used to quantitatively analyze the expression of the KRT14 gene. In the PCR detection analysis, the primer sequences for KRT14 gene detection were KRT14-F: GAGCAGCAGAACCAGGAGTACA and KRT14-R: AGGAGGTCACATCTCTGGATGA, GAPDH was used as an internal reference, and the detection primer sequences were GAPDH-F: GTCTCCTCTGACTTCAACAGCG and GAPDH-R: ACCACCCTGTTGCTGTAGCCAA. The data analysis used the ΔΔCt method to calculate the relative expression of the KRT14 gene in normal HaCaT cells with GAPDH as an internal reference.

[0227] ΔΔCt = (average Ct value of KRT14 gene in the test sample - average Ct value of the reference gene in the test sample) - (average Ct value of KRT14 gene in the control sample - average Ct value of the reference gene in the control sample)

[0228] The relative expression of the gene F = 2 -ΔΔCt .

[0229] The Ct value results of real-time quantitative PCR detection are shown in Table 3 below:

[0230] Table 3

[0231]

[0232] The effect of shRNA knocking down the expression of KRT14 gene is shown in Table 4 and Fig.34 As shown:

[0233] Table 4

[0234]

[0235] The above results showed that KRT14 shRNA 19, shRNA 20 and shRNA 21 could significantly knock down the expression of KRT14 gene.

[0236] Preparation Example 4 Construction of HSV-1 vector for gene therapy of epidermolysis bullosa simplex

[0237] Targeting the KRT5 gene, the ICP34.5 gene was further knocked out on the basis of the recombinant viral vector A2, and the GFP gene was replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT5 sequence (opKRT5) (SEQ ID NO: 43), the polyadenylic acid sequence, the U6 promoter, and the KRT5 shRNA 1 sequence (SEQ ID NO: 1) were inserted in sequence to obtain the recombinant viral vector N ( Fig.35 ).

[0238] The maturation of miRNA and shRNA has similar cellular mechanisms. The use of the secondary structure of the precursor miRNA can be used as the backbone for the production of interfering RNA. The processing and shearing of the interfering RNA produced by this method is more natural, which can minimize side effects. At the same time, the miRNA backbone sequence inserted into the shRNA sequence is longer, and can be driven by pol II type promoters including a variety of tissue-specific promoters, thereby achieving gene silencing in specific tissues. Among the miRNA backbones currently used for gene interference research (such as miR30, miR155, miR17-92, etc.), miR30 is the most commonly used structure.

[0239] This preparation example further uses KRT5 shRNA 1 to replace the targeting region in the miR30 backbone, thereby obtaining KRT5 mirshRNA based on the miRNA backbone (SEQ ID NO: 45). Next, the ICP34.5 gene is further knocked out on the basis of the recombinant viral vector A2, and the GFP gene is replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT5 sequence (opKRT5) (SEQ ID NO: 43), the KRT5 mirshRNA (SEQ ID NO: 45) and the polyadenylation sequence are sequentially inserted to obtain the recombinant viral vector O ( Fig.35 Since the opKRT5 sequence is different from the wild-type KRT5 sequence, avoid shRNA or miRNA sequence cleavage.

[0240] The HSV-1 vector designed for the KRT14 gene was constructed with the same strategy as the HSV-1 vector designed for the KRT5 gene. Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT14 sequence (opKRT14) (SEQ ID NO: 44), the polyadenylation sequence, the U6 promoter, and the KRT14 shRNA 1 sequence (SEQ ID NO: 19) were inserted in sequence to obtain the recombinant viral vector P ( Fig.36 ).

[0241] KRT14 shRNA 1 was further used to replace the targeting region in the miR30 backbone to obtain KRT14 mirshRNA based on the miRNA backbone (SEQ ID NO: 46). Next, the ICP34.5 gene was further knocked out on the basis of the recombinant viral vector A2, and the GFP gene was replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT14 sequence (opKRT14) (SEQ ID NO: 44), the KRT14 mirshRNA (SEQ ID NO: 46) and the polyadenylation sequence were inserted in sequence to obtain the recombinant viral vector Q ( Fig.36 ).

[0242] Example 10 Verification of the effect of HSV-1 vector designed for KRT5 gene

[0243] HaCaT cells were cultured at 2×10 6 The cells were plated at a density of 1000 cells / well in a six-well plate and incubated at 37°C with 5% CO 2 The recombinant viral vector N was transfected into HaCaT cells at MOI = 1, and a blank cell control group (without viral vector) was set up. Two wells were set up for each group of cells, and the cells were cultured at 37°C and 5% CO 2 Conditions were set aside for 2 days for static culture. Total RNA from each well of cells was extracted according to the method of Example 8 and reverse transcribed into cDNA. The obtained cDNA was subjected to quantitative expression analysis of the wild-type KRT5 gene and the optimized KRT5 gene using real-time quantitative PCR. GAPDH was used as an internal reference, and the GAPDH detection primer sequence and the wild-type KRT5 detection primer sequence were the same as those in Example 8. The optimized KRT5 detection primer sequences were: opKRT5-F1: AGCAATCGCATTCTGCAAGTT and opKRT5-R1: GAAGCCGAGTCCTGGTACCA. The ΔΔCt method was used for data analysis to calculate the relative expression of the KRT5 gene in normal HaCaT cells using GAPDH as an internal reference.

[0244] The Ct value results of real-time quantitative PCR detection are shown in Table 5 below:

[0245] Table 5

[0246]

[0247] The effect of knocking down the expression of KRT5 gene by shRNA is shown in Table 6 below:

[0248] Table 6

[0249]

[0250] Experimental data showed that compared with normal cells, the HSV-1 vector designed for the KRT5 gene can significantly knock down the expression of the wild-type KRT5 gene in cells, while highly expressing the optimized KRT5 gene. The experimental results show that this vector has a good application prospect in the treatment of epidermolysis bullosa simplex.

[0251] Example 11 Verification of the effect of HSV-1 vector designed for KRT14 gene

[0252] HaCaT cells were cultured at 2×10 6 The cells were plated at a density of 1000 cells / well in a six-well plate and incubated at 37°C with 5% CO 2 The recombinant viral vector P was transfected into HaCaT cells at MOI = 1, and a blank cell control group (without viral vector) was set up. Two wells were set up for each group of cells at 37°C and 5% CO 2 Conditions were set aside for 2 days for static culture. Total RNA from each well of cells was extracted according to the method of Example 9 and reverse transcribed into cDNA. The obtained cDNA was subjected to quantitative expression analysis of the wild-type KRT14 gene and the optimized KRT14 gene using real-time quantitative PCR. GAPDH was used as an internal reference, and the GAPDH detection primer sequence and the wild-type KRT14 detection primer sequence were the same as those in Example 9. The optimized KRT14 detection primer sequences were: opKRT14-F1: TTGAGCTCAGGTGGGCATCT and opKRT14-R1: AGTTAGCCCAAATCCAGGAAATG. The ΔΔCt method was used for data analysis to calculate the relative expression of the KRT14 gene in normal HaCaT cells using GAPDH as an internal reference.

[0253] The Ct value results of real-time quantitative PCR detection are shown in Table 7 below:

[0254] Table 7

[0255]

[0256] The effect of knocking down the expression of KRT14 gene by shRNA is shown in Table 8 below:

[0257] Table 8

[0258]

[0259] Experimental data showed that compared with normal cells, the HSV-1 vector designed for the KRT14 gene can significantly knock down the expression of the wild-type KRT14 gene in cells, while highly expressing the optimized KRT14 gene. The experimental results show that this vector has a good application prospect in the treatment of simple bullous epidermolysis bullosa.

[0260] Preparation Example 5 Construction of HSV-1 vector for ichthyosis gene therapy

[0261] TGM1 gene mutation is associated with autosomal recessive ichthyosis (ARCI). Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced at the position of the ICP4 gene knockout and inserted into the TGM1 gene (NM_000359.3) to obtain the recombinant viral vector R ( Fig.37 ).

[0262] Example 12 Expression verification of HSV-1 vector for ichthyosis gene therapy

[0263] Western blotting was used to detect the level of TGM1 protein expressed by the recombinant viral vector R in human keratinocytes HaCat. HaCat cells (Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences) were cultured in DMEM medium containing 15% fetal bovine serum. The cells were seeded in 6-well plates (1.5×10 6 cells / well), and recombinant viral vector R was added at MOI=0.5. After 72 hours, the cells were harvested, and the whole protein lysate was prepared using a protein extraction kit, and the content of the whole lysate protein solution was detected using a BCA protein detection kit. 30µg of each protein sample was loaded into the denatured protein precast gel well, electrophoresed at 110V for 80 minutes, and then transferred to the PVDF membrane at 200 mA for 1.5 hours. Protein immunoblotting experiments were performed using specific antibodies TGM1 antibodies (PA5-59088, Thermo) and HRP-labeled goat anti-rabbit IgG (H+L) (A0208, Beyotime). Finally, the reagent Pierce ECL Western Blotting Substrate was used for chemiluminescence detection. The results showed that ( Fig.38 ), the recombinant viral vector R can successfully express TGM1 protein in HaCat cells.

[0264] Immunofluorescence was used to detect the level of TGM1 protein expressed by the recombinant viral vector R on HaCat cells. The cells were seeded in a 6-well plate (2×10 5Cells / well) were added to the cells and cultured in a 37°C incubator for 24 hours. Recombinant viral vector D and recombinant viral vector R were added at an MOI of 0.5, and blank cell control wells were set. After 24 hours, 4% cell fixative (P1110, Solebao) was used to fix the cell morphology for 40 minutes, 0.2% Triton-X100 (IT9100, Solebao) was used to permeabilize the cell membrane for 40 minutes, and 10% blocking donkey serum (SL050, Solebao) was used to block nonspecific antigens for 1 hour. The target protein was labeled with a specific antibody TGM1 antibody (PA5-59088, Thermo), and a goat anti-rabbit IgG (H+L) secondary antibody (A11034, Thermo) was used for fluorescent labeling. Anti-fluorescence attenuation mounting medium (containing DAPI) (S2110, Solebao) was used for cell nucleus staining and mounting. An inverted fluorescence microscope (DMi8, Leica) was used to detect green and blue fluorescence signals. The results showed that the recombinant viral vector R could significantly express TGM1 protein ( Fig.39 ). The above results show that the recombinant viral vector R has a good application prospect in the treatment of ichthyosis.

[0265] Preparation Example 6 Construction of HSV-1 vector for gene therapy of muscular dystrophy

[0266] Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced at the position of the ICP4 gene knockout. The MHCK7 promoter, the full-length Dys gene (NM004006.3) and the polynucleotide were inserted to obtain the recombinant viral vector S ( Fig.40 ). Based on the recombinant viral vector A2, the ICP34.5 gene and IR were further knocked out. L / IR S Region, in IR L / IR S The MHCK7 promoter, Dys full-length gene and polynucleic acid were inserted into the region to obtain the recombinant virus T ( Fig.41 ).

[0267] Example 13 Expression verification of HSV-1 vector carrying Dys gene

[0268] Western blotting was used to detect the level of Dys protein expressed by recombinant viral vector S and recombinant viral vector T in human skeletal muscle cells (HSkMC, Yaji Biotechnology). HSkMC cells were cultured in DMEM medium containing 10% newborn calf serum. The cells were seeded in 6-well plates (1.5×10 6Cells / well) were cultured in a 37°C incubator for 24 hours. Recombinant viral vector S and recombinant viral vector T were added at MOI = 0.5, and blank cell control wells were set. After 72 hours, the cells were harvested, and the whole protein lysate was prepared using a protein extraction kit, and the content of the whole lysate protein solution was detected using a BCA protein detection kit. Each protein sample was added to 6× loading buffer and boiled for 10 minutes to prepare a loading mixture. 20μg of each protein sample was loaded into the protein precast gel well, electrophoresed at 90V for 40 minutes, then changed to 120V for 50 minutes, and then transferred to the PVDF membrane at 200mA for 2 hours. Protein immunoblotting experiments were performed using specific antibodies Anti-Dystrophin (mouse monoclonal) (MAB1645, Millipore) and HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime). Finally, chemiluminescence detection was performed using the reagent Pierce ECL Western Blotting. The results showed that both recombinant viral vector S and recombinant viral vector T could significantly express Dys protein (such as Fig.42 as shown).

[0269] Example 14 Study on the efficacy of HSV-1 vector carrying Dys gene

[0270] The recombinant viral vector S was tested in 4-week-old mdx (C57BL / 10ScSn-Dmdmdx / J) Duchenne muscular dystrophy model mice (WuXi AppTec). The pharmacodynamic effects of the recombinant viral vector S and the effects of different administration methods on the pharmacodynamics were evaluated by detecting serum creatine kinase (CK) and skeletal muscle fast-twitch troponin I (TNNI2), behavioral tests and histopathological observations.

[0271] The experiment was set up as a group of intramuscular injection and a group of tail vein injection of recombinant viral vector S, with 4 mice in each group, a dosing volume of 200 μl, and a dosing titer of 3.6×10 8pfu / ml, starting from the 4th week of mice, the drug was continuously administered for 3 weeks and observed until the 10th week. At the same time, a model mouse control group administered with normal saline and a wild-type group control group were set up. Before and after drug administration, 150 μl of whole blood was collected from each group of mice by submandibular blood sampling. At the end of the experiment (EOL), 2 mice were selected from the tail vein injection group, intramuscular injection group and model control group, and 150 μl of whole blood was collected by submandibular blood sampling. The whole blood processing method is as follows: after standing at 4°C for 30 minutes, serum was obtained by centrifugation at 12000 rpm, 15 minutes, and 4°C. The serum was divided into two parts for the detection of CK and TNNI2, respectively. Hitachi 3500 fully automatic analyzer was used for CK detection. TNNI2 was detected according to the instructions of the TNNI2 ELISA kit (MBS2022948, Mybiosource). The status of the mice was observed twice a week, and the forelimb grip test was performed using a grip strength tester at 12 weeks of mice to evaluate the forelimb function of the mice. At the end of the experiment, two mice in each group were euthanized, and the heart, liver, quadriceps, tibialis anterior, and gastrocnemius were collected and immersed in formalin, fixed at 4°C for more than 24 hours, and then paraffin-embedded and sectioned after dehydration. Immunohistochemical staining of embryonic myosin heavy chain (eMHC, antibody from abcam, ab264038) was performed using the Bond Rx Platform automated platform (Leica) to evaluate the level of regenerated muscle fibers.

[0272] During the experiment, no abnormality was observed in the observation of the mice at the side of the cage or outside the cage. The drug administration, behavioral test and blood sampling did not cause the weight loss of the mice.

[0273] CK and TNNI2 test results ( Fig.43 and Fig.44 ) showed that the concentrations of CK and TNNI2 in the serum of mice in the tail vein injection group and the intramuscular injection group decreased to varying degrees throughout the entire test process after administration, among which the concentrations of CK and TNNI2 in the serum of mice in the tail vein injection group decreased more significantly. CK and TNNI2 are key markers of muscle damage. The decrease in serum CK and TNNI2 concentrations indicates that the recombinant viral vector S helps reduce muscle damage and prevent the progression of muscular dystrophy.

[0274] The results of the forelimb grasping strength test showed that the relative grasping strength of the mice in the tail vein injection group and the intramuscular injection group was significantly higher than that in the model control group at 12 weeks ( Fig.45 ).

[0275] Immunohistochemistry results showed that in the wild-type control group, no eMHC-positive fibers were detected in the heart, quadriceps, gastrocnemius, tibialis anterior and liver, while eMHC-positive fiber aggregation was observed in the model control group. Compared with the model control group, the eMHC-positive fibers in the tail vein injection group and the intramuscular injection group increased significantly ( Fig.46 eMHC is a structural protein unique to new muscle fibers and can be used as a marker for regenerated muscle fibers. The results showed that the recombinant viral vector S increased the muscle regeneration level of the experimental mice, whether injected into the tail vein or intramuscularly.

[0276] The above experimental results show that the recombinant viral vector S showed good effects in pseudohypertrophic muscular dystrophy model mice and demonstrated great therapeutic potential in the field of muscular dystrophy treatment.

[0277] Preparation Example 7 Construction of HSV-1 vector for gene therapy of chronic familial benign pemphigus

[0278] Chronic familial benign pemphigus (HHD) is caused by mutations in the ATP2C1 gene. Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced at the position of the ICP4 gene knockout and inserted into the human ATP2C1 gene (Genbank: 27032) to obtain the recombinant viral vector U ( Fig.47 ).

[0279] Example 15 ATP2C1 protein immunoblot analysis

[0280] Western blotting was used to detect the expression of ATP2C1 protein by recombinant viral vector U in human keratinocytes HaCat. HaCat cells were cultured in DMEM medium containing 15% fetal bovine serum. The cells were seeded in 6-well plates (1.5×10 6cells / well), recombinant viral vector U was added at MOI=0.5, and cells were harvested after 48 hours. The whole protein lysate was prepared using a protein extraction kit, and the content of the whole lysate protein solution was detected using a BCA protein detection kit. Take each protein sample and add 6× loading buffer and boil for 10 minutes to prepare a loading mixture. Take 20µg of each protein sample and load it into the denatured protein precast gel well. Electrophoresis was performed at 140 V for 50 minutes, and then the gel protein was transferred to the PVDF membrane at 200 mA for 2 hours. Protein immunoblotting experiments were performed using specific antibodies ATP2C1 Monoclonal Antibody (MA5-15592, Thermo) and HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime). Finally, the reagent Pierce ECL Western Blotting Substrate was used for chemiluminescence detection. The results showed that ( Fig.48 ), the recombinant viral vector U can significantly express ATP2C1 protein.

[0281] Example 16 Detection of ATPase activity of ATP2C1 protein

[0282] ATP2C1 protein is an ATPase. To detect the activity of ATP2C1 expressed by the recombinant viral vector U, ZH02 cells were cultured at 1.5×10 6 The cells were inoculated at a density of 10 cells / well in a 6-well plate, and the cells were transfected with recombinant viral vector U at MOI=0.5. After 72 hours of transfection, the whole protein lysate was prepared using a protein extraction kit, the content of the whole lysate protein solution was detected using a BCA protein detection kit, and the ATPase activity in the sample was detected using an ATPase assay kit (ab234055, Abcam). The results showed that the ATP2C1 enzyme activity expressed by the recombinant viral vector U after transfection of the cells was 6.8 U / ng. The results showed that the ATP2C1 enzyme activity expressed by the recombinant viral vector U after transfection of the cells was 6.8 U / ng, which can play the ATPase function.

[0283] Example 17 Immunofluorescence detection of ATP2C1 protein

[0284] HaCat cells were cultured at 2×10 5The cells were inoculated at a density of 10 cells / well in a 6-well plate containing a cell slide, and the cells were transfected with the recombinant viral vector U at an MOI of 0.5. After 40 hours of transfection, the cells were fixed with 4% cell fixative, the cell membrane was permeabilized with 0.2% Triton-X100, and non-specific antigens were blocked with 10% donkey serum. The target protein was detected using the specific antibody rabbit anti-ATP2C1 (119-269) mAb (H00027032-M01, Abnova) and the fluorescent secondary antibody sheep anti-mouse IgG-RBITC (SR131, Solebao). Finally, the cell nucleus was stained and the slide was sealed with an anti-fluorescence attenuation mounting medium (containing DAPI), and the test results were observed under a fluorescence microscope. The results showed ( Figures 49A-49B ), after the recombinant viral vector U was transfected into the cells, the expression of ATP2C1 protein (red fluorescence) could be detected in the cells, while the cells not transfected with the recombinant viral vector could not be detected. The experimental results of the above Examples 15-17 show that the recombinant vector U can express the physiologically active ATP2C1 protein in the cells, and has a good application prospect in the treatment of HHD diseases.

[0285] Sequence Listing ; ; ; ; .

[0286] The above is only a preferred embodiment of the present application and does not limit the present application in any form. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present application without departing from the content of the technical solution of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A replication-deficient recombinant herpes simplex virus type I vector, wherein the nucleotide sequence of the following genomic segment in the genome is destroyed or knocked out: 1) The nucleotide sequence from 1-100 nucleotides upstream and downstream of nucleotide 126785 to 1-100 nucleotides upstream and downstream of nucleotide 131176, and the nucleotide sequence from 1-823 nucleotides upstream and downstream of nucleotide 147025 to 1-93 nucleotides upstream and downstream of nucleotide 151439; and / or 2) The nucleotide sequence from nucleotides 1-257 upstream and downstream of nucleotide 113494 to nucleotides 1-223 upstream and downstream of nucleotide 115314; in, The nucleotide positions of the above HSV-1 genome were determined with reference to the HSV-1 laboratory virus strain 17 genome.

2. The recombinant herpes simplex virus type I vector according to claim 1, further, the genome is selected from ICP34.5 gene, ICP6 gene, ICP0 gene, ICP47 gene, ICP22 gene, ICP4 gene, ICP27 gene, U S 3 genes, U L 56 genes, functional VP16 gene, VHS gene, UNG gene, IR L / IR S One or more of the glycoprotein H gene, thymidine kinase gene, or region is disrupted or knocked out.

3. The recombinant herpes simplex virus type I vector according to claim 1, wherein the viral vector is cultured in compensatory cells. The recombinant herpes simplex virus type I vector according to claim 3 , wherein the compensating cells are Vero cells.

5. The recombinant herpes simplex virus type I vector according to any one of claims 1-2, further, ICP0 and / or ICP22 in the genome are destroyed or knocked out.

6. The recombinant herpes simplex virus type I vector according to any one of claims 1 to 3, comprising one or more introduced foreign genes.

7. The recombinant herpes simplex virus type I vector according to claim 6, wherein the one or more exogenous genes are introduced at the same or different genomic sites that are disrupted or knocked out.

8. The recombinant herpes simplex virus type I vector according to any one of claims 1 to 7, wherein the exogenous gene encodes a therapeutic protein molecule or a nucleic acid molecule.

9. The recombinant herpes simplex virus type I vector according to any one of claims 1 to 8, wherein the exogenous gene encodes an antibody, an enzyme protein, a cytokine, a cytokine receptor, a metabolic regulatory factor, a receptor protein, a ligand protein, a structural protein, other functional proteins, antisense RNA, a small RNA or an interfering RNA.

10. The recombinant herpes simplex virus type I vector according to claim 9, wherein the therapeutic protein molecule is one or more proteins selected from the following: steroid sulfatase, transglutaminase 1, secretory pathway calcium ion transporter ATPase 1, serine peptidase inhibitor Kazal type 5, type I collagen, type II collagen, type III collagen, type IV collagen, type VII collagen, type IX collagen, keratin 5, keratin 14, type XVII collagen, anti-dystrophin protein, sirtuin 1, sirtuin 3, sirtuin 6, sirtuin 7, EGF, FGF, and ELN.

11. Use of the recombinant herpes simplex virus type I vector according to claims 1-10 in preparing a drug for treating a disease.

12. The use according to claim 11, wherein the disease is selected from one or more of the following: genetic diseases, skin diseases, muscle diseases.

13. The use according to claim 12, wherein the disease is selected from one or more of the following: X-linked ichthyosis, autosomal recessive congenital ichthyosis, chronic familial benign pemphigus, Netherton syndrome, epidermolysis bullosa, muscular dystrophy.

14. Use of the recombinant herpes simplex virus type I vector according to any one of claims 1 to 10 in cosmetic applications.

15. A composition comprising the recombinant herpes simplex virus type I vector according to any one of claims 1 to 10 and a solvent or excipient acceptable to humans.

16. The composition according to claim 15, which is a pharmaceutical composition, comprising the recombinant herpes simplex virus type I vector according to any one of claims 1 to 10 and a pharmaceutically acceptable solvent and / or excipient.

17. A method for treating a disease, comprising administering an effective amount of the recombinant herpes simplex virus type I vector of claims 1-10 or the composition of claim 15 or 16 to a subject in need thereof.

18. The method of claim 17, wherein the disease is selected from one or more of the following: a genetic disease, a skin disease, a muscle disease.

19. The method of claim 18, wherein the genetic disease is selected from one or more of the following: X-linked ichthyosis, autosomal recessive congenital ichthyosis, chronic familial benign pemphigus, Netherton syndrome, epidermolysis bullosa, muscular dystrophy.

20. A compensatory cell for culturing herpes simplex virus, wherein the herpes simplex virus is the recombinant herpes simplex virus type I vector according to any one of claims 1 to 10. The compensatory cell according to claim 20 , which is a Vero cell.

22. Use of Vero cells for culturing herpes simplex virus vectors, wherein the herpes simplex virus vector is the recombinant herpes simplex virus type I vector according to any one of claims 1 to 10.

Images