Application of microRNA-31-5P in preparation of drugs for treating metabolic liver diseases and complications thereof

Abstract

The invention discloses application of microRNA-31-5P in preparation of drugs for treating metabolic liver diseases and complications thereof, and belongs to the technical field of biological medicines. A metabolic liver disease model is treated by adopting the extracellular vesicle microRNA-31-5P, it is innovatively found that the extracellular vesicle microRNA-31-5P can remarkably inhibit liver injury and effectively improve neurovascular complications, and the treatment effect and potential of the microRNA-31-5P in the metabolic liver disease and the complications of the metabolic liver disease are proved. The invention has important clinical application value and wide development prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of microRNA-31-5P in preparing drugs for treating metabolic liver diseases and their complications. Background Art

[0002] Metabolic liver diseases include metabolic dysfunction-associated fatty liver disease (MAFLD; formerly known as NAFLD) and metabolic dysfunction-associated steatohepatitis (MASH; formerly known as NASH), which are diseases of liver fat accumulation and related pathological states caused by metabolic abnormalities such as obesity, type 2 diabetes and hyperlipidemia. These diseases not only affect liver function, but are also often accompanied by neurovascular damage, seriously threatening the health of patients (PMID: 38350680). However, effective treatments for metabolic liver diseases and their complications are still lacking (PMID: 38857502), so there is an urgent need to develop new molecular treatment strategies.

[0003] MicroRNA (miRNA) is a class of endogenous non-coding small RNAs that play an important role in regulating gene expression, metabolic regulation, inflammatory response, and fibrosis. In metabolic liver diseases, the therapeutic potential of miRNA as a small molecule drug has attracted much attention (PMID: 33127832). However, the therapeutic effect of miRNA-31-5P in metabolic liver diseases and their complications has not been reported. At the same time, traditional miRNA application forms, such as mimics, viral vectors, or regulators, are susceptible to degradation in vivo and lack targeting, which limits the breadth of their clinical application. To overcome these limitations, researchers have begun to explore new delivery systems. EVs (including exosomes) are a class of membrane vesicles secreted by cells, widely present in biological fluids, and can carry a variety of bioactive molecules, including proteins, lipids, nucleic acids, and metabolites. Studies have shown that miRNAs in EVs play an important role in cellular communication in metabolic diseases (PMID: 34496230), but the specific miRNAs are unknown. EVs are natural delivery vectors of miRNA, which have high stability, low immunogenicity and good targeting (PMID: 38311623), and their application in the treatment of metabolic liver diseases shows good development prospects.

[0004] Nevertheless, there are still many problems in the treatment of metabolic liver diseases and their complications. For example, 1) A miRNA bionic nanoselenium particle that targets the liver and improves lipid deposition, its preparation method and application (CN116421577B), suggesting that miR148a-3p inhibitor releases selenium through electrostatic action, regulates intracellular redox balance and ultimately alleviates liver lipid deposition, but lacks research on the therapeutic activity of miRNA; 2) The application of miRNA-378 in the treatment of fatty liver (CN105617399A), confirming that miR-378 can function by inhibiting the key protein p110α of the insulin signaling pathway, becoming a new strategy for treating liver lipid accumulation, suggesting the therapeutic potential of miRNA in liver disease, but there is no integrated treatment idea for metabolic liver disease, especially the exploration of miR-31-5p; 3) EVs have a positive therapeutic effect on liver disease (Hepatology, doi:10.1002 / hep.32129, 2022) and the application of mesenchymal stem cell exosomes in the preparation of fatty liver disease drugs (CN113171379A) ​​have discovered its therapeutic potential for liver disease, but EVs contain a lot of contents, and it is still necessary to clarify the specific substances such as miRNAs that EVs (including exosomes) play a therapeutic role. Summary of the invention

[0005] In view of the problems that existing drugs cannot effectively reverse the progression of metabolic liver disease, have poor stability and many side effects, the existing technology lacks research on the therapeutic activity of specific miRNAs, lacks integrated therapy, and the unclear therapeutic effect of EVs limits its application technology status in the treatment of metabolic liver disease. The present invention aims to provide the application of microRNA-31-5P in the preparation of drugs for the treatment of metabolic liver disease and its complications.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides application of microRNA-31-5P (miR-31-5P) in preparing a drug for treating metabolic liver disease and its complications.

[0007] The medicine is a medicine for improving liver tissue damage and brain neurovascular damage.

[0008] Furthermore, liver tissue damage and brain neurovascular damage can be improved by inhibiting the abnormal activation of hepatic stellate cells and macrophages.

[0009] The drug is a drug for delaying the progression of metabolism-related fatty liver disease to metabolism-related fatty hepatitis.

[0010] Furthermore, by regulating the expression of genes related to lipid metabolism and inhibiting the expression of inflammatory factors, the progression of metabolic-related fatty liver disease to metabolic-related fatty hepatitis is delayed.

[0011] The metabolic liver diseases include liver damage and dysfunction caused by fatty liver, non-alcoholic fatty liver disease, liver fibrosis, cirrhosis, obesity-related liver disease and hyperlipidemia.

[0012] The complications of metabolic liver disease include neurodegenerative lesions, endothelial dysfunction, microcirculatory disorders, and systemic inflammatory responses triggered by liver disease.

[0013] The present invention provides a medicine for preventing and / or treating metabolic liver disease and its complications. The medicine uses microRNA-31-5p as an active ingredient and is combined with a pharmaceutically acceptable carrier.

[0014] Furthermore, the sequence of the microRNA-31-5P is: AGGCAAGAUGCUGGCAUAGCUG (as shown in SEQ ID NO.1).

[0015] The dosage form of the drug is any one of tablets, pills, powders, suspensions, gels, emulsions, creams, granules, capsules, suppositories, injections, sprays and injections.

[0016] The microRNA-31-5p as an active ingredient is any one of microRNA-31-5p, its analogs, its agonists and substances expressing microRNA-31-5p.

[0017] The pharmaceutically acceptable carrier includes extracellular vesicles, liposome nanoparticles or other carrier materials that can be used for drug delivery.

[0018] Furthermore, the extracellular vesicles are derived from mesenchymal stem cells, hepatocytes or other cell types capable of secreting extracellular vesicles.

[0019] Furthermore, the extracellular vesicles are derived from mesenchymal stem cells.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The application of microRNA-31-5P provided by the present invention in the preparation of therapeutic drugs for metabolic liver diseases and their complications reveals for the first time the important role of microRNA-31-5P in the treatment of metabolic liver diseases and their complications, and verifies its significant therapeutic effect through experiments, providing a new target and method for the treatment of metabolic liver diseases, which has great scientific significance and clinical application value.

[0021] Furthermore, microRNA-31-5P can directly act on the liver, and by regulating the activation state of hepatic stellate cells and macrophages, effectively inhibit the abnormal activation of these cells, thereby delaying or preventing the pathological progression of MAFLD (metabolic-associated fatty liver disease) to the more serious MASH (metabolic-associated fatty liver hepatitis); microRNA-31-5P can significantly improve brain neurovascular damage while treating metabolic liver disease. By regulating the pathological state of the liver, it indirectly improves brain neurovascular health and inhibits inflammation and tissue damage; by inhibiting inflammation and tissue damage, microRNA-31-5P helps to alleviate or reverse the disease state of metabolic liver disease and its complications, and improve the quality of life of patients.

[0022] The drug provided by the present invention not only directly treats the liver pathological process, but also indirectly improves the health of brain neurovascular system by regulating the liver pathological state, inhibits inflammation and tissue damage, promotes the repair and regeneration of damaged tissue, and has a significant targeted therapeutic effect on metabolic liver diseases (such as MAFLD / MASH); it provides new targets and new methods for drug development, showing broad clinical prospects and development potential. Therefore, the present invention is expected to bring new hope and treatment options to patients with metabolic liver diseases and their complications. microRNA-31-5P can directly act on the liver, regulate the activation state of hepatic stellate cells and macrophages, effectively inhibit the abnormal activation of these cells, thereby delaying or preventing the pathological progression of MAFLD to MASH; by regulating the liver pathological state, microRNA-31-5P can indirectly improve the health of brain neurovascular system and reduce neurodegenerative lesions, providing a new perspective and strategy for the treatment of metabolic liver diseases and their complications (such as neurodegenerative lesions); microRNA-31-5P can inhibit inflammatory response and tissue damage, promote the repair and regeneration of damaged tissues, not only limited to the liver, but also may have a positive effect on other tissues throughout the body; Furthermore, microRNA-31-5P and its enriched EVs, as new drugs or therapeutic means, provide new strategies and methods for the treatment of metabolic liver diseases and their complications; therapeutic strategies based on microRNA-31-5P and its enriched EVs show broad clinical prospects and development potential in the treatment of metabolic liver diseases and their complications. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1Figure 1 is the EV miRNA microarray analysis of the present invention; a is the microarray analysis identifying 2647 miRNAs in EV samples (n=3), and edgeR analysis showing differential miRNAs (FDR<0.05; |log2(FC)|>1); b is a Venn diagram showing that the miRNAs (173 consistently expressed) in EVs from mesenchymal stem cells (MSCs) overlap 171 (98.8%) with the Vesiclepedia database; c is a heat map showing the differential expression of the top 50 miRNAs in EVs; d is the KEGG enrichment analysis association screening of miRNAs and immune pathways such as MAPK and PI3K-Akt; e is a violin plot (real-time quantitative PCR) verifying the expression of miR-31-5p and miR-24-3p in EVs (n=3); Figure 2 The distribution and liver targeting effect of EVs enriched with microRNA-31-5P of the present invention in db / db mice, wherein a is the SPECT / CT images (planar and tomographic imaging) of 99mTc-labeled EVs in db / db mice at 6, 24, and 48 hours after injection; b is a bar graph showing the distribution ratio of EVs in various organs at 1, 6, 24, and 48 hours after injection (n=8 / time point); c is the main clearance pathway of EVs through the bladder and liver over time, showing fast and slow two-phase clearance (n=8); d is an immunofluorescence image showing the distribution of EVs labeled with PKH26 (red) in liver macrophages (F4 / 80, green) and hepatic stellate cells (GFAP, green) 20 hours after injection (n=3); e is the histopathological evaluation of liver tissue H&E, Oil Red O, Sirius Red and α-SMA staining (2-8 weeks); f is the NAFLD activity score of the experimental group (n=6 / group / time point); j is the Oil Red O Quantitative analysis of staining area (n=6 / group / time point); h is quantitative analysis of Sirius Red staining area (n=6 / group / time point); i is quantitative analysis of α-SMA staining area (n=6 / group / time point), significance: ns P>0.05; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001; Figure 3The present invention is to evaluate the neurovascular complications of db / db mice treated with EVs enriched with microRNA-31-5P, wherein ag is the neurobehavioral evaluation of db / db mice at 2, 4, and 6 weeks after treatment: a is the open field test (OFT), b is the evaluation speed, c is the central zone residence time, d is the Y maze, e is the evaluation of alternating triplet, f is the elevated plus maze (EPM), and g is the evaluation of the number of entries into the open arm (n=8-10); (hm) ELISA detected the levels of h for VCAM-1, i for ET-1, j for IL-1β, k for TNF-α, l for NSE, and m for BDNF in the serum of each group (n=6); n is the immunostaining and 3D visualization of Laminin-α2, ZO-1, and Connexin43 co-labeled with PECAM-1 (CD31) in the hippocampus of each group; o is the quantitative analysis of the staining area / intensity of Laminin-α2 / PECAM-1 in each group, p is the quantitative analysis of the staining area / intensity of ZO-1, and q is the quantitative analysis of the staining area / intensity of Conne Quantitative analysis of xin43 staining area / intensity (Laminin-α2 / PECAM-1, n=60; ZO-1 and Connexin43, n=40, from vascular units of 4 mice in each group); r is a TEM image of the morphology of hippocampal blood vessels in each group, showing the structural differences of hippocampal blood vessels in WT, db / db-Veh and db / db-EVs groups (n=4), with annotations in the figure: P (pericytes), BM (basement membrane), CG (intercellular space), L (lumen), EC (endothelial cells), MS (myelin sheath). The dotted box marks the tight junction, and the arrow indicates the edema around the blood vessels; significance: ns P>0.05; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

[0024] Figure 4Figure 2 shows the regulatory effect of microRNA-31-5P on MCD cells and animal models of the present invention; wherein, a is a fluorescence image of bone marrow macrophages (BMDMs) transfected with miR-NC labeled with FAM (green); b is a bar graph of the expression level of microRNA-31-5P in BMDMs under different EVs treatment; cf is ELISA detection of PDGFB (c, n=6), IL-1β (d, n=5), IL-10 (e, n=5) and TGFβ (f, n=5) levels in the supernatant of different EVs treated with palmitic acid (PA)-stimulated BMDMs (NASH); gj is immunohistochemical analysis of the expression of PDGFB (h), α-SMA (i) and CD68 (j) in the miR-31-5p agomir and NC treatment groups of MCD mice in liver tissue, scale bar: 50 μm; km is H&E (k), Oil Red O (l) and Sirius (m2) images of liver tissue. Analysis of Red (m) staining in MCD-NC and MCD-miR-31-5p agomir groups (n=6), significance: ns P>0.05; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

[0025] Figure 5 . Evaluation of neurovascular complications of MCD mice by microRNA-31-5P, where ac are neurobehavioral assessments of MCD mice, Y maze (a), open field test (OFT, b) and elevated plus maze (EPM, c), performed 4 weeks after treatment (n=8); d is immunostaining and 3D visualization of Laminin-α2 (green) and ZO-1 (green) co-labeled with PECAM-1 (CD31, red) in the hippocampus, and 3D reconstruction of vascular markers by Imaris 9.0 completed; e and f are quantitative analysis of the staining area / intensity of Laminin-α2 / PECAM-1 (e) and ZO-1 (f) (Laminin-α2 / PECAM-1: n=60 in Naïve group and MCD-EVs group, n=48 in MCD-Veh group; ZO-1: n=40 in each group, vascular units from 4 mice), significance: *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. DETAILED DESCRIPTION

[0026] In order to enable those skilled in the art to understand the characteristics and effects of the present invention, the following is a general description and definition of the terms and expressions mentioned in the specification and claims. Unless otherwise specified, all technical and scientific terms used in the text are the common meanings understood by those skilled in the art for the present invention. In the event of a conflict, the definition in this specification shall prevail.

[0027] The theories or mechanisms described and disclosed herein, whether correct or incorrect, should not limit the scope of the present invention in any way, that is, the present invention can be implemented without being limited by any specific theory or mechanism.

[0028] In this article, all features such as values, quantities, contents and concentrations defined in the form of numerical ranges or percentage ranges are for simplicity and convenience only. Accordingly, the description of numerical ranges or percentage ranges should be considered to have included and specifically disclosed all possible secondary ranges and individual values ​​within the range (including integers and fractions).

[0029] The following examples use conventional instruments and equipment in the art. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The various raw materials used in the following examples, unless otherwise specified, are conventional commercial products, and their specifications are conventional specifications in the art.

[0030] Example 1 microRNA-31-5p screening.

[0031] 1. Isolation and purification of MSC-EVs.

[0032] Mesenchymal stem cells (MSCs) were cultured in culture flasks and supplemented with exosome-free fetal bovine serum (FBS). The cells were cultured for 48 hours to ensure a pure source of EVs. The cell culture supernatant, as the initial source of EVs, was centrifuged at 300 g for 10 minutes to remove cell debris; at 2,000 g for 20 minutes to remove cell debris; at 10,000 g for 30 minutes to further remove larger organelles; and at ultracentrifugation (100,000 g) for 70 minutes to collect the pure EVs precipitate, which was resuspended in PBS and washed by ultracentrifugation again to ensure the purity of the EVs, ultimately obtaining MSC-EVs.

[0033] 2. EVs surface markers and purity verification To ensure the purity and characteristics of EVs, the following verifications were performed: Western Blot was used to analyze the expression of EVs markers CD63, CD9 and TSG101, and cell markers (such as Calnexin) were detected to ensure the purity of EVs samples; nanoparticle tracking analysis (NTA) was used to detect the particle size distribution of EVs, and it was found that its particle size was between 50-150 nm, which was consistent with the typical characteristics of EVs.

[0034] 3. miRNA Microarray Chip Detection In order to analyze the expression profile of microRNA in MSC-EVs, the Agilent microRNA chip (Agilent Human miRNA Microarray) was used to analyze the expression profile of microRNA in MSC-EVs. EVs samples (n=3) were extracted from the culture supernatant of MSCs from different human umbilical cords, and the small molecule RNA was isolated using the miRNeasy kit (Qiagen, Germany), hybridized using the Agilent microRNA chip (Shanghai Biotech), and the signal intensity was read by a scanner to obtain the expression profile of microRNA.

[0035] 4. Differential miRNA Analysis See attached Figure 1 Through microarray data analysis, it was found that there were a variety of high-abundance microRNA molecules in MSC-EVs, among which the expression level of microRNA-31-5P was significantly increased (Fold Change>2; p<0.05). The expression abundance of microRNA-31-5P was further verified by real-time quantitative PCR. Further KEGG signaling pathway enrichment analysis showed that microRNA-31-5P was closely related to PI3K-Akt, MAPK, cell adhesion molecules and inflammation-related signaling pathways, indicating that it may play a key role in immune regulation and angiogenesis.

[0036] Based on the miRChip data, the present invention selected microRNA-31-5P (miR-31-5P) as the research target and further verified its function in subsequent experiments.

[0037] The sequence of microRNA-31-5P: AGGCAAGAUGCUGGCAUAGCUG (as shown in SEQ ID NO.1).

[0038] Conclusion: microRNA-31-5P (miR-31-5P) is enriched in MSC-EVs and has important immunomodulatory potential.

[0039] Example 2 This study mainly investigated the targeted therapeutic effect of extracellular vesicles (EVs) enriched with microRNA-31-5p in metabolic fatty liver disease (MAFLD) model mice (db / db mice). The specific process is as follows.

[0040] 1. Experimental animals and groups Twenty-week-old male wild-type db (lean+ / +) control mice (WT) or db / db mice (metabolic fatty liver disease model) were selected and randomly divided into the WT group; the control group (db / db-Veh): injected with an equal amount of normal saline; the experimental group (db / db-EVs): injected with 50-100 μg EVs through the tail vein; liver tissue or serum samples were collected 2-8 weeks after injection for subsequent analysis.

[0041] 2. Distribution of EVs in db / db mice.

[0042] To track the distribution of EVs in vivo, db / db mice (20 weeks old) were injected with 50 μg of EVs labeled with 99mTc or PKH26 (diluted in 150 μL PBS) via the tail vein. The control group was injected with an equal amount of free 99mTc. The SPECT / CT imaging system (870DR, USA) was used and the method described in reference (PMID: 39135135) was used. Isoflurane anesthesia (induction concentration 3%, maintenance concentration 1%) was used during the experiment to ensure experimental stability; each group of animals underwent a 1200-second SPECT planar scan, and the SPECT / CT imaging parameters included: 256×256 acquisition matrix, 1.5-fold magnification factor, 20 seconds for each tomographic angle, and 1 mm slice thickness for CT scan; SPECT / CT images were collected at 1 hour, 6 hours, 24 hours, and 48 hours after injection; immunofluorescence staining was used to evaluate the co-labeling of PKH26-labeled EVs with hepatic macrophages (F4 / 80 positive) and hepatic stellate cells (GFAP positive).

[0043] 3. EV Pharmacokinetic Analysis The radiation dose and administration volume were simulated by the water model, and the physical half-life (1 / T) and biological half-life (1 / Tb) were calculated. The effective half-life formula (1 / Te = 1 / T + 1 / Tb) was used to evaluate the in vivo distribution, residual amount and excretion rate of the drug. Systemic drug residue: Systemic drug residue (%) = e−(0.693×t) / Te×100. Distribution in major organs: SPECT / CT fusion images were used to analyze the radiation distribution of major organs such as the brain, liver, lungs, heart, kidneys, spleen and bladder. Organ boundaries were accurately defined by CT images (1 mm slice thickness), and SPECT radiation signals were measured to estimate the drug concentration in each organ and its percentage of systemic drug distribution. Muscle and bone distribution: Artificial intelligence analysis tools (Q.Volumetrix MI software) were used to map the whole body's bone and muscle areas and calculate their radiation doses. Immunofluorescence staining showed that PKH26-labeled EVs were mainly enriched in liver macrophages (F4 / 80 positive) and hepatic stellate cells (GFAP positive), see Appendix. Figure 2 shown.

[0044] 4. Analysis of liver tissue pathology and lipid metabolism indicators After the initial administration of EVs or PBS, the mice in different experimental groups were sampled at 2, 4, 6, and 8 weeks. All mice were anesthetized by inhalation of a 3% isoflurane / air mixture and then liver tissues were obtained and cut into approximately 2 cm × 2 cm × 1 cm pieces. H&E staining and Sirius Red staining: The liver tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The slices were 5 μm thick and processed with H&E staining solution (MCE, USA) or Sirius Red staining solution (MCE, USA). Oil Red O staining: The liver tissues were cryo-embedded and sliced ​​at a thickness of 10 μm. After treatment with 70% ethanol, the tissues were stained with Oil Red O staining solution according to the manufacturer's instructions (Abcam, USA). α-SMA immunohistochemical staining: The paraffin sections were immunohistochemically stained with anti-α-SMA antibodies to evaluate the activation of hepatic stellate cells (HSCs). Images were captured using a microscope (Leica DMi8, Germany). Three fields of view were randomly selected for each group of samples and images were collected at 200× magnification. Image analysis was performed using ImageJ Pro Plus V6.0 (Bethesda, Maryland, USA) to evaluate changes in lipid deposition, fibrosis, and α-SMA-positive areas in tissues.

[0045] Conclusion: miR-31-5p-enriched EVs specifically targeted the liver of db / db mice. EVs treatment significantly improved liver tissue cell damage, reduced lipid deposition and fibrosis, and inhibited the progression of MAFLD to more severe liver diseases such as MASH. The use of microRNA-31-5p-enriched EVs as a treatment for MAFLD provides strong experimental evidence and lays a solid foundation for its further clinical application.

[0046] Example 3 See attached Figure 3 , to investigate the therapeutic effect of microRNA-31-5p-enriched EVs on neurovascular complications in db / db mice.

[0047] 1. Neurobehavioral assessment.

[0048] The Y-maze test, open field test (OFT) and elevated plus maze test (EPM) were performed on experimental groups of db / db mice (2, 4, and 6 weeks after drug administration), control groups, and age-matched WT. Y-maze test: The Y-maze consists of three arms of equal length (33 cm long, 10 cm wide, 11 cm high, with an angle of 120°, marked as 1, 2, and 3). Mice started from the end of arm 1 and explored for 8 minutes. The bottom of the maze was cleaned with 10% ethanol after each trial. Spatial memory and motor activity were calculated. The alternation rate was calculated as follows: % alternation rate = (number of alternations) / ((total number of arm entries-2))×100. Open field test (OFT): A square box of 40 cm×40 cm×40 cm was defined as a central area of ​​20 cm×20 cm. Each mouse was placed individually in the box, and each trial lasted for 10 minutes. Elevated plus maze test (EPM): 50 cm high, composed of two open arms (30 cm long, 5 cm wide) and two closed arms (30 cm long, 5 cm wide, 11 cm high) arranged vertically, with a platform in the middle. The mouse was placed on the central platform facing the open arm to start the test. SMART v3.0 software (Panlab, USA) was used to record and analyze behavioral data, including the alternation rate and speed of the Y maze, the time spent in the central area of ​​the OFT, and the number of times entering the open arm in the EPM.

[0049] Y-maze test: the alternation rate of mice in the experimental group was significantly higher than that in the control group, indicating that their spatial memory ability was improved; open field test (OFT): the mice in the experimental group stayed in the central area for a longer time, indicating that their exploratory behavior increased and their anxiety level decreased; elevated plus maze test (EPM): the number of times the mice in the experimental group entered the open arm increased, further confirming the decrease in their anxiety level, indicating that microRNA-31-5p-enriched EVs treatment can significantly improve the neurobehavioral performance of db / db mice.

[0050] 2. Detection of serum inflammatory factors and neuroprotective factors The levels of inflammatory factors and neuroprotective factors in the serum of each group of mice were detected by ELISA kits. The mice in each group were treated with EVs or PBS for 4 weeks, and heart serum samples were collected. The samples were centrifuged at 3000 × g for 10 minutes at 4°C to remove the residue and particulate impurities. The collected supernatant was stored at −80°C for further analysis. The levels of multiple biomarkers were detected using ELISA kits (ThermoFisher, USA). The detected biomarkers included vascular cell adhesion molecule 1 (VCAM-1), endothelin 1 (ET-1), interleukin 1β (IL-1β), tumor necrosis factor α (TNF-α), brain-derived neurotrophic factor (BDNF), and neuron-specific enolase (NSE), according to the instructions of the kit. The absorbance was read at a wavelength of 450 nm using a FlexStation 3 microplate reader (Molecular Devices, USA), and the data were processed by SoftMax Pro software (Molecular Devices, USA). The concentration of biomarkers was determined by the standard curve, and the experimental validity was verified by positive and negative controls. To ensure the accuracy of the experiment, the coefficient of variation (CV) within and between groups was controlled below 10%.

[0051] Inflammatory factors: The levels of vascular cell adhesion molecule 1 (VCAM-1), endothelin 1 (ET-1), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) in the experimental group of mice were significantly lower than those in the control group, indicating that EVs treatment can inhibit the inflammatory response; Neuroprotective factors: The levels of brain-derived neurotrophic factor (BDNF) and neuron-specific enolase (NSE) in the experimental group of mice were significantly higher than those in the control group, suggesting that EVs treatment has a neuroprotective effect; The results further support the therapeutic effect of microRNA-31-5p-enriched EVs on neurovascular complications in db / db mice.

[0052] 3. Analysis of Vascular Markers in the Hippocampus Immunostaining of the hippocampus was performed, and microscopic imaging was performed using light microscopy and confocal microscopy. After db / db mice were treated with EVs for 4 weeks, 10-30 μm thick tissue sections were obtained from each group for immunostaining; the primary antibodies used included platelet endothelial cell adhesion molecule 1 (PECAM-1), laminin α2 (Laminin-α2), tight junction protein 1 (ZO-1), and connexin 43 (Connexin43). The samples were first incubated with the primary antibody overnight and then with the corresponding secondary antibody; after staining, the sections were sealed with Permount™ mounting solution, dehydrated, and transparent, and then coverslipped. Microscopic imaging was performed using a light microscope (Leica DMi8, Germany) or a confocal microscope (Olympus FV3000, Japan). Three fields of view were randomly selected from each group of samples and photographed at a magnification of 200× to ensure the objectivity of the results; three-dimensional reconstruction of vascular markers was performed using Imaris9.0 software (Bitplane, Switzerland), and data analysis was performed using ImageJ Pro Plus V6.0 (Bethesda, USA).

[0053] Vascular markers: The expression levels of platelet endothelial cell adhesion molecule 1 (PECAM-1), laminin α2 (Laminin-α2), tight junction protein 1 (ZO-1) and connexin 43 (Connexin43) in the experimental group of mice were significantly higher than those in the control group, indicating that EVs treatment can promote the stabilization and repair of vascular structure in the hippocampus; Three-dimensional reconstruction and data analysis: Three-dimensional reconstruction was performed using Imaris9.0 software, and data analysis was performed using ImageJ Pro Plus V6.0, which further confirmed the above results; indicating that microRNA-31-5p-enriched EVs treatment can significantly improve the vascular structure and function in the hippocampus of db / db mice.

[0054] 4. Transmission Electron Microscope Observation Ultrastructural changes in the hippocampus were observed by transmission electron microscopy. After four consecutive weeks of EV or PBS treatment, db / db mice and WT mice were deeply anesthetized and perfused with ice-cold PBS, followed by fixation with 3% glutaraldehyde solution (Sigma-Aldrich, USA). The hippocampus region of the brain tissue was excised and processed according to the method described in the literature64. Hippocampal tissue sections were stained with methylene blue (Sigma-Aldrich, USA). Ultrathin sections (60-90 nm thickness) were prepared, cut with a diamond knife, and stained with uranyl acetate (Sigma-Aldrich, USA) and lead citrate (Sigma-Aldrich, USA) in sequence. Sections (hippocampus region) were observed using a transmission electron microscope (HT7700-SS, Hitachi, Japan) to record changes in tissue ultrastructure.

[0055] Mice in the experimental group: the microvascular structure in the hippocampus was clear, the endothelial cells were intact, the basement membrane was continuous, the mitochondrial morphology was normal, and no obvious edema or necrosis was observed; mice in the control group: the microvascular structure in the hippocampus was disordered, the endothelial cells were swollen, the basement membrane was broken, the mitochondrial morphology was abnormal, accompanied by edema and necrosis, indicating that miR-31-5p-enriched EVs significantly improved the combined neurovascular damage in db / db mice.

[0056] Example 4 See attached Figure 4 , investigate the therapeutic effect of microRNA-31-5p on MASH model.

[0057] 1. Modification and processing of microRNA-31-5p.

[0058] In vitro experiments, miRNA inhibitors (inhibitor), mimics (mimic), and negative controls (NC) were labeled with 6-carboxyfluorescein (FAM) and synthesized by GenePharma (Shanghai, China). These constructs were introduced into MSC-EVs (therapeutic EVs) or HEK-293 cell-derived EVs (provided by EV Biobank) at a concentration of 100 nM using a Sonic Dismembrator (FB505110, Fisher Scientific, USA) according to established methods. The successful entry of miRNA into EVs was confirmed by immunofluorescence, and the miRNA expression levels in primary cultured bone marrow-derived macrophages (BMDMs) were detected by quantitative PCR (qPCR); BMDMs were pre-treated with 10 μg / mL of the above-mentioned miRNA-modified EVs (HEK-EVmiR NC, HEK-EVmiR-31-5p mimic, EVmiR-31-5pinhibitor) and then stimulated with 0.6 mmol / L palmitic acid (PA) for 24 hours.

[0059] In the in vivo study, microRNA-31-5P agonist (agomir) and its corresponding control (agomir NC) were synthesized by Ribobio (Guangzhou, China). Oligonucleotides were prepared in PBS and injected into mice via tail vein at a concentration of 5 nM, twice a week for three consecutive weeks, starting treatment three weeks after the start of MCD (methionine-choline deficient) diet.

[0060] 2. Study on the therapeutic effect of microRNA-31-5p on MASH cell model.

[0061] In vitro cell model: The cell supernatant of each group was collected according to the method described above, and the expression levels of macrophage M1 and M2 phenotype markers were detected using ELISA kits, including PDGFB (platelet-derived growth factor-B), interleukin 1β (IL-1β) (M1 phenotype markers) and interleukin 10 (IL-10), transforming growth factor β (TGFβ) (M2 phenotype markers).

[0062] In vivo animal model: MCD mice were treated with microRNA-31-5P agonist (agomir) group and corresponding agomirNC (negative control) for 4 weeks, and then liver tissue specimens were collected; pathological staining was performed as above using H&E, Sirius Red and OilRed O staining (Oil Red O staining), and histopathological features were observed and photographed under an optical microscope to evaluate the degree of liver fibrosis and lipid deposition in hepatocytes; immunohistochemistry (IHC) staining of platelet-derived growth factor-B (PDGFB), α-SMA and CD68 was used to evaluate liver inflammatory response and stellate cell activation.

[0063] Through in vitro and in vivo experiments, microRNA-31-5P-treated cells (palmitic acid-stimulated macrophages) or mouse models (methionine-choline deficient diet-induced fatty liver hepatitis) can significantly improve MASH inflammatory response or pathological damage. This result confirms that microRNA-31-5p, as a small molecule drug, has a significant therapeutic effect on metabolic liver disease (MAFLD / MASH), providing an important basis for further clinical application and mechanism research.

[0064] Example 5 See attached Figure 5 This example investigates the therapeutic effect of microRNA-31-5p on neurovascular injury in MCD mice.

[0065] 1. Neurobehavioral Assessment After MCD mice were treated with microRNA-31-5P agomir and NC, each group and age-matched normal C57BL / 6 mice (Naive) were subjected to Y-maze test, open field test (OFT) and elevated plus maze test (EPM) with the same method as above. SMART v3.0 software (Panlab, USA) was used to record and analyze behavioral data, including alternation rate and speed of Y-maze, time spent in the central area of ​​OFT, and number of times entering the open arm in EPM. The effects of microRNA-31-5P agomir on the neurobehavioral function of MCD mice were evaluated by comparing the performance of mice in each group in each test.

[0066] 2. Analysis of Vascular Markers in the Hippocampus Brain tissue sections of mice in each group were prepared as above, and immunofluorescence staining was performed using representative vascular injury markers such as platelet endothelial cell adhesion molecule 1 (PECAM-1), laminin α2 (Laminin-α2), and tight junction protein 1 (ZO-1). Representative vascular units in the hippocampus were photographed using a confocal microscope (Olympus FV3000, Japan). Three fields of view were randomly selected from each group of samples and photographed at 200× magnification to ensure objective results. Three-dimensional reconstruction of vascular markers was performed using Imaris9.0 software (Bitplane, Switzerland), and data analysis was performed using ImageJ Pro Plus V6.0 (Bethesda, USA).

[0067] Through neurobehavioral evaluation and analysis of vascular markers in the hippocampal region, we found that treatment of MCD mice with miR-31-5p agonist could significantly improve the neurovascular damage associated with MSAH (methionine-choline deficient diet-induced steatohepatitis), further confirming the potential role of microRNA-31-5p in neurovascular protection and providing a new therapeutic strategy for the treatment of MSAH-related neurovascular complications.

[0068] The present invention systematically reveals the key therapeutic role of microRNA-31-5P in metabolic liver disease and its neurovascular complications, demonstrates its potential in liver targeted therapy and immune regulation, provides an important reference for the future development of small molecule drugs, and has significant clinical application value and broad prospects.

[0069] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. Application of microRNA-31-5P in the preparation of therapeutic drugs for metabolic liver diseases and their complications.

2. The use according to claim 1, characterized in that: The medicine is a medicine for improving liver tissue damage and brain neurovascular damage.

3. The use according to claim 2, characterized in that: Improve liver tissue damage and brain neurovascular damage by inhibiting abnormal activation of hepatic stellate cells and macrophages.

4. The use according to claim 1, characterized in that: The drug is a drug for delaying the progression of metabolism-related fatty liver disease to metabolism-related fatty hepatitis.

5. The use according to claim 4, characterized in that: By regulating the expression of genes related to lipid metabolism and inhibiting the expression of inflammatory factors, it delays the progression of metabolic-associated fatty liver disease to metabolic-associated steatohepatitis.

6. The use according to claim 1, characterized in that: The metabolic liver diseases include liver damage and dysfunction caused by fatty liver, non-alcoholic fatty liver disease, liver fibrosis, cirrhosis, obesity-related liver disease and hyperlipidemia.

7. The use according to claim 1, characterized in that: The complications of metabolic liver disease include neurodegenerative lesions, endothelial dysfunction, microcirculatory disorders, and systemic inflammatory responses triggered by liver disease.

8. A drug for preventing and / or treating metabolic liver disease and its complications, characterized in that: The drug uses microRNA-31-5p as an active ingredient and is combined with a pharmaceutically acceptable carrier. The dosage form of the drug is any one of tablets, pills, powders, suspensions, gels, emulsions, creams, granules, capsules, suppositories, injections, sprays and injections.

9. A drug for preventing and / or treating metabolic liver diseases and their complications according to claim 8, characterized in that: The microRNA-31-5p as an active ingredient is any one of microRNA-31-5p, its analogs, its agonists and substances expressing microRNA-31-5p.

10. The drug for preventing and / or treating metabolic liver diseases and their complications according to claim 8, characterized in that: The pharmaceutically acceptable carrier includes extracellular vesicles, liposome nanoparticles or other carrier materials that can be used for drug delivery.

Images