Engineering strain with high yield of glucoamylase as well as construction method and application of engineering strain

Abstract

The invention belongs to the technical field of fermentation engineering, and particularly relates to an engineering strain with high yield of glucoamylase as well as a construction method and application of the engineering strain. The engineering strain disclosed by the invention is constructed by knocking out a gene prtT and replacing a gene to be knocked out in aspergillus niger with a glaA-M13 expression cassette, and the obtained engineering strain can remarkably improve the production level of glucoamylase and reduce the glucoside conversion activity of the obtained glucoamylase; the problems that at present, domestic saccharifying enzyme production strains are low in fermentation level, and saccharifying enzyme products contain transglycosidase activity are solved.

Description

Technical Field

[0001] The invention belongs to the technical field of fermentation engineering, and specifically relates to an engineering strain with high saccharifying enzyme production, a construction method and application thereof. Background Art

[0002] Glucose amylase, also known as glucoamylase (EC.3.2.1.3.), can hydrolyze α-1,4 glucoside bonds from the non-reducing end of starch to produce glucose, and can also slowly hydrolyze α-1,6 glucoside bonds to convert them into glucose. It can also hydrolyze dextrin and release β-D-glucose from the non-reducing end of glycogen. Glucose amylase is an important enzyme preparation, widely used in medicine, energy, food, fermentation and other industries. In the food industry, it can produce glucose, maltose, dextrin syrup and amylose film, improve the color and texture of the face, process vegetables, and make vegetable juice and vegetable puree. In the fermentation industry, glucose amylase is used as a saccharifying agent in the manufacturing industries of sodium glutamate, alcohol, vinegar, etc., and is used to produce amino acids, organic acids, vitamins, antibiotics and other substances with glucose as a substrate. In my country, glucose amylase is also used to hydrolyze oligosaccharides in cotton to reduce the adhesion of cotton fibers to facilitate spinning. In addition, agricultural wastes such as straw and pectinase can be converted through the synergistic effect of glucose amylase and cellulase.

[0003] At present, saccharifying enzymes are mainly produced by deep fermentation of Aspergillus niger. However, Aspergillus niger species all contain α-glucosidase genes, and the saccharifying enzymes produced all contain α-glucosidase, which is very difficult to purify; moreover, the current saccharifying enzyme genes all have certain transglycosidation activity in the presence of high concentrations of glucose; thus, when glucose is produced by the saccharifying enzyme method, non-fermentable sugars such as isomaltose will be produced, affecting the purity and quality of glucose and the utilization rate of sugars. At the same time, the average production level of saccharifying enzyme fermentation in my country is only about 60,000 units / mL, but the saccharifying enzyme production giant Novozymes has a saccharifying enzyme fermentation production level of up to 120,000 units / mL, so my country's saccharifying enzymes lack market competitiveness. Therefore, constructing an efficient saccharifying enzyme production strain without transglycosidation activity is a key issue that must be solved for the efficient production of saccharifying enzymes. Summary of the invention

[0004] In view of the above problems, the present invention provides an engineering strain with high saccharifying enzyme production and a construction method and application thereof. glaA-M13 The expression cassette site-specifically replaces the specific gene to be knocked out in Aspergillus niger, which can increase the number of Aspergillus niger hyphae tips and enhance the secretion of saccharifying enzymes, while reducing the degradation of saccharifying enzymes by the proteases secreted by Aspergillus niger itself. The resulting engineered strain can significantly improve the production level of saccharifying enzymes and reduce the transamination activity of the resulting saccharifying enzymes, solving the current problems of low fermentation level of saccharifying enzyme production strains in China and the presence of transamination enzyme activity in saccharifying enzyme products.

[0005] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical scheme: The first aspect of the present invention provides an engineered strain with high saccharifying enzyme production: the engineered strain is based on Aspergillus niger as the starting strain, and the gene is knocked out. prtT (NCBI Gene ID: 4991098) and glaA-M13 The expression cassette is constructed by replacing the gene to be knocked out in Aspergillus niger; the gene to be knocked out includes gene racA (GenBank: AY540629.1); glaA-M13 The expression cassette consists of a filamentous fungus promoter, a saccharifying enzyme gene glaA-M13 and a terminator; the saccharifying enzyme gene glaA-M13 Encodes the amino acid sequence shown in SEQ ID NO.1.

[0006] Through research, it was found that the number of growth at the top of Aspergillus niger hyphae affects the secretion of protease, and knocking out racA Genes can increase the number of hyphae tips and thus increase the secretion of proteases; saccharifying enzyme genes glaA-M13 No transaminase activity; transcription factor prtT The expression can promote the secretion of extracellular protease of Aspergillus niger. The present invention genetically modifies the industrial production strain of saccharifying enzyme Aspergillus niger, and transforms the saccharifying enzyme gene which is generated by the filamentous fungus promoter and has no transaminase activity into glaA-M13 Constructed by connecting with terminator glaA-M13 Expression cassette site-directed replacement racA Gene, which can increase the number of Aspergillus niger hyphae tips, enhance the secretion of saccharifying enzymes, and knock out prtT The gene can reduce the degradation of saccharifying enzyme by the protease secreted by Aspergillus niger itself. After the above genetic transformation, the engineered strain constructed by the present invention can significantly improve the production level of saccharifying enzyme and reduce the transglycosidation activity of the obtained saccharifying enzyme.

[0007] Preferably, the saccharifying enzyme gene glaA-M13 The nucleotide sequence is shown in SEQ ID NO.2.

[0008] Preferably, the nucleotide sequence of the filamentous fungus promoter is as shown in SEQ ID NO.3 or SEQ ID NO.4, both of which have high activity and produce similar effects when applied in the present invention.

[0009] Preferably, the terminator is terminator Tglucan693.

[0010] The starting strain for constructing the engineered strain can be any Aspergillus niger. For example, Aspergillus niger commonly used in the art for producing saccharifying enzymes can be used. An41683 Aspergillus niger CBS 513.88Aspergillus niger SH2 Preferably, the Aspergillus niger is Aspergillus niger An41683 This strain is an industrial production strain with high production of saccharifying enzymes.

[0011] Preferably, the gene to be knocked out also includes an α-glucosidase gene. The expression of the α-glucosidase gene is the source of α-glucosidase mixed in the saccharifying enzyme.

[0012] Further preferably, the α-glucosidase gene includes the gene agdA (GenBank: EHA20839.1)、 agdB (GenBank: EHA26885.1)、 agdC (GenBank: EHA23512.1)、 agdD (NCBI ReferenceSequence: XM_059743974.1), agdE (GenBank: EHA28539.1)、 agdF (GenBank: EHA19157.1) and agdG (GenBank: EHA23468.1). glaA-M13 Expression cassette site-directed replacement of α-glucosidase related genes agdA, agdB, agdC, agdD, agdE, agdF and agdG , which can eliminate the transglycosidation activity of Aspergillus niger strains.

[0013] Preferably, the gene to be knocked out also includes a pepsin-like gene.

[0014] Further preferably, the pepsin-like gene comprises gene pepAa (GenBank: EF140756.1) 、 pepAb (GenBank: EF140757.1) , pepAc (GenBank: EF140758.1) and pepAd At least one of the pepsin-like genes (GenBank: EF140759.1). pepAa, pepAb, pepAc, pepAd The expression of the glycoamylase gene cassette can also lead to protein degradation. glaA-M13 Site-directed replacement of pepsin-like gene pepAa, pepAb, pepAc and pepAd , which can prevent the degradation of saccharifying enzymes by pepsin.

[0015] Preferably, the gene to be knocked out includes the gene racA ,Gene agdA ,Gene agdB and genes agdC.

[0016] Preferably, the gene to be knocked out includes the gene racA ,Gene agdA ,Gene agdB ,Gene agdC ,Gene agdD ,Gene agdE ,Gene agdF and genes agdG.

[0017] Further preferably, the gene to be knocked out also includes a pepsin-like gene, and the pepsin-like gene includes a gene pepAa, pepAb, pepAc and pepAd At least one of .

[0018] When glaA-M13 After the expression cassette site-specifically replaces the above-mentioned α-glucosidase gene or simultaneously replaces the pepsin-like gene, the resulting recombinant bacteria can not only significantly increase the production of saccharifying enzymes, but also the fermentation broth for producing saccharifying enzymes basically does not contain α-glucosidase, which can effectively reduce the cost of separation and purification of saccharifying enzymes after fermentation and improve the purity of saccharifying enzymes.

[0019] More preferably, the pepsin-like gene comprises the gene pepAa, pepAb, pepAc and pepAd The recombinant bacteria thus constructed can not only further increase the production of saccharifying enzymes, but also the fermentation broth for producing saccharifying enzymes does not contain α-glucosidase, which can more effectively reduce the cost of separation and purification of saccharifying enzymes after fermentation and improve the purity of saccharifying enzymes.

[0020] In the present invention, the above-mentioned gene can be knocked out by conventional means in the art.

[0021] The second aspect of the present invention provides the use of the above-mentioned engineered strain in the fermentation production of saccharifying enzymes.

[0022] The third aspect of the present invention provides a method for producing saccharifying enzyme by fermentation, wherein the saccharifying enzyme is produced by fermentation using the above-mentioned engineered strain.

[0023] Preferably, the engineered strain is cultured in a CD liquid medium for 3 days, inoculated in a YPD medium for further culturing for 3 days, and then inoculated in a fermentation medium for fermentation to produce saccharifying enzyme.

[0024] The culture medium used for producing the saccharifying enzyme may be a synthetic or natural culture medium, such as a typical culture medium containing a carbon source, a nitrogen source, a sulfur source, inorganic ions and other organic and inorganic components as required.

[0025] The engineered strain is cultured under aerobic conditions for 5-7 days; the culture temperature is controlled at 30 to 35° C.; and the pH is adjusted between 3.5 and 6.5.

[0026] Further preferably, the fermentation medium is corn steep liquor fermentation medium.

[0027] The corn steep liquor fermentation medium can be a corn steep liquor fermentation medium commonly used in the art, or can be prepared by the following operation (taking 50 mL corn steep liquor fermentation medium as an example): 1.5 g soybean cake powder is weighed and added into a container, 40 mL corn steep liquor aqueous solution is added, and the solution is sterilized at 121° C. for 30 minutes to obtain solution 1; 150 g glucose is weighed and dissolved in 300 mL water, and the solution is sterilized at 115° C. for 20 minutes to obtain a glucose solution; 10 mL of the glucose solution is drawn and added into solution 1 before inoculation.

[0028] The beneficial effects of the present invention are as follows: the present invention transforms the existing saccharifying enzyme producing strain Aspergillus niger, and transforms the saccharifying enzyme gene without transaminase activity into a filamentous fungus promoter. glaA-M13 Constructed by connecting with terminator glaA-M13 Expression cassette site-directed replacement racA Gene, which can increase the number of Aspergillus niger hyphae tips and enhance the secretion of saccharifying enzymes, prtT The gene reduces the degradation of saccharifying enzyme by protease secreted by Aspergillus niger itself, thereby constructing an engineered strain with high saccharifying enzyme production and reduced saccharifying enzyme transglycoside activity.

[0029] The present invention also glaA-M13 Site-directed replacement of Aspergillus niger α-glucosidase-related genes by expression cassette agdA, agdB, agdC, agdD, agdE, agdF and agdG , and pepsin-like genes pepAa, pepAb, pepAc, pepAd, while knocking out these genes, the copy number and expression level of the saccharifying enzyme gene are increased, thereby constructing a high-yield saccharifying enzyme production strain with no transglycosylation activity and high activity, laying the foundation for the efficient production of saccharifying enzymes. In the engineering strains for efficiently producing saccharifying enzymes constructed by the present invention, the saccharifying enzyme activities of the engineering strains GLA5, GLA9, GLA11, GLA12 and GLA13 are 11291.75, 10913.82, 10907.76, 10980.77, and 11703.42 U / ml, respectively, which are 34.91%, 30.39%, 30.32%, 31.19%, and 39.84% higher than the starting strain (saccharifying enzyme activity is 8369.75 U / ml). The saccharifying enzyme activities of other engineering strains are all increased by more than 10%. The engineered strains constructed by the present invention not only have significantly improved enzyme activity, but also significantly reduced or even no transaminase activity. Compared with the starting strains, the transaminase activity in the supernatant of the fermentation broth of the GLA1-GLA4 engineered strains is reduced by 14.05%, 61.67%, 86.67% and 93.33% respectively compared with the starting strains, and the transaminase activity of the engineered strains GLA5-GLA13 is reduced by 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The target gene knockout construct in Example 1 of the present invention racA Map of plasmid pFC332-racA-sgRNA; Figure 2 The present invention embodiment 1 contains glaA-M13 Expression cassette and racA pUC57 plasmid restriction enzyme verification diagram of the upstream and downstream homology arms of the gene. M: DNA Marker; 1: plasmid restriction enzyme enzyme map, 2600 and 4300 (bp) respectively; Figure 3 The electrophoresis diagram of the PCR verification of the engineering strain in Example 1 of the present invention. Wherein, M is a DNA marker; 1-5 are pepAa, pepAb, pepAc, pepAd, racA Each site integrates a glaA-M13 The PCR verification band of the expression cassette, AG agdA, agdB, agdC, agdD, agdE, agdF, agdG Each site integrates a glaA-M13 Colony PCR verification band after the expression cassette; Figure 4 This is a diagram showing the results of the saccharifying enzyme activity detection in Example 2 of the present invention; Figure 5 This is a graph showing the results of detecting the transglycosidation activity of the saccharifying enzyme fermentation broth in Example 2 of the present invention. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0032] Aspergillus niger species all contain α-glucosidase genes, so the saccharifying enzymes produced by Aspergillus niger species through deep fermentation all contain α-glucosidase, which is very difficult to purify. In addition, the current saccharifying enzyme genes have certain transglycosidation activity in the presence of high concentrations of glucose, and when glucose is produced by the saccharifying enzyme method, non-fermentable sugars such as isomaltose will be produced, affecting the purity and quality of glucose and the utilization rate of sugars. At the same time, the average production level of saccharifying enzyme fermentation in my country is only around 60,000 units / mL, which needs to be improved urgently.

[0033] To solve this problem, the present invention provides an engineering strain with high glucoamylase production: the engineering strain is based on Aspergillus niger as the starting strain, and the gene is knocked out. prtT Use with glaA-M13 The expression cassette is constructed by replacing the gene to be knocked out in Aspergillus niger; the gene to be knocked out includes gene racA ; glaA-M13 The expression cassette consists of a filamentous fungus promoter, a saccharifying enzyme gene glaA-M13 and a terminator; the saccharifying enzyme gene glaA-M13 Encodes the amino acid sequence shown in SEQ ID NO.1.

[0034] As a preferred embodiment, the gene to be knocked out also includes an α-glucosidase gene. As a specific embodiment, the α-glucosidase gene includes a gene agdA , agdB , agdC , agdD , agdE , agdF and agdG At least one of .

[0035] As a preferred embodiment, the gene to be knocked out also includes a pepsin-like gene. As a specific embodiment, the pepsin-like gene includes a gene pepAa, pepAb, pepAc and pepAd At least one of .

[0036] The embodiment of the present invention also provides a method for constructing the engineered strain.

[0037] The embodiment of the present invention also provides the use of the engineered strain in the fermentation production of saccharifying enzyme.

[0038] The embodiment of the present invention also provides a method for producing saccharifying enzyme by fermentation.

[0039] The scheme of the present invention is described below through specific embodiments.

[0040] The components and preparation methods of the culture medium used in the following examples are as follows: PDA slant culture medium: Peel 200 g of potatoes, cut into small pieces, add 1 L of water and boil for 30 min, filter out the potato pieces, add 20 g of glucose and 15 g of agar, make up the filtrate to 1 L, and sterilize with high pressure steam at 115°C for 20 min.

[0041] The LB solid medium containing ampicillin resistance contains: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder. Sterilize at 121°C for 20 min. When the sterilization is cooled to about 50°C, add ampicillin to a final concentration of 100 µg / mL.

[0042] MMS upper layer medium containing 100 µg / mL hygromycin: 32.52% sucrose, 0.6% agar powder, sterilized at 115℃ for 20min. When sterilized and cooled to about 50℃, add hygromycin with a final concentration of 100 µg / mL, 2% 10×ASPA+N, 0.2% MgSO4, and 0.1% 1000× trace elements; MMS lower layer medium containing 100 µg / mL hygromycin: 32.52% sucrose, 1.2% agar powder, sterilized at 115℃ for 20min. When sterilized and cooled to about 50℃, add hygromycin with a final concentration of 100 µg / mL, 2% 10×ASPA+N, 0.2% MgSO4, and 0.1% 1000× trace elements; PDA hygromycin resistance medium: 20% potato, 2% glucose, 2% agar, sterilized at 115℃ for 20min; when sterilized and cooled to about 50℃, add hygromycin to a final concentration of 100 µg / mL.

[0043] CD liquid medium: 2% glucose, 0.2% potassium chloride, 0.3% sodium nitrate, 0.05% magnesium sulfate heptahydrate, 0.1% potassium dihydrogen phosphate, 0.001% potassium sulfate heptahydrate, 0.05% agar powder for suspension. Sterilize at 115℃ for 20min; YPD medium (g / L): 2% peptone, 1% yeast powder and 2% glucose, sterilized at 115℃ for 20min; Corn steep liquor fermentation medium: Prepare by the following operation (taking 50 mL corn steep liquor fermentation medium as an example): weigh 1.5 g soybean cake powder and add it into a 250 mL conical flask, add 40 mL corn steep liquor aqueous solution, sterilize at 121°C for 30 minutes to obtain solution 1; weigh 150 g glucose, dissolve it in 300 mL water, sterilize at 115°C for 20 minutes to obtain glucose solution; before inoculation, draw 10 mL of glucose solution and add it into solution 1.

[0044] Aspergillus niger An41683 It is an industrial production strain with high production of saccharifying enzymes.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] Unless otherwise specified, the specific operation means of molecular biology, genetic engineering, etc. involved in the following examples can be implemented according to technical manuals, textbooks or literature reports that are easily available to those skilled in the art, and the operation process is not described in detail here. In addition, specific starting strains are selected in the following examples, and thus specific primers are selected according to the starting strains, but it does not mean that the purpose of the present invention can only be achieved through these specific selections, and the scope of the present invention cannot be limited to this. The essence and scope of the present invention are only limited by the claims.

[0047] Example 1 This embodiment provides an engineered strain with high saccharifying enzyme production and a method for constructing the same.

[0048] 1. No transglycosidation activity glaA-M13 Construction of expression cassette This example uses the promoter Pglucan with a nucleotide sequence as shown in SEQ ID NO.4 and the glucoamylase gene with no transaminase activity and high activity as shown in SEQ ID NO.2. glaA - M13 Using overlapping PCR, the promoter Pglucan and the glucoamylase mutant were first cloned. glaA-M13 The fragment PG was constructed by ligating the pUC57 plasmid and the PG fragment with primers Pglucan-Xho I-Bgl II-KpnI-F and Gla-M13-Xba IR (as shown in Table 1). The fragment PG was recovered by gel excision. Kpn I and Xba After digestion with restriction enzyme I, the two were connected using ligase solution I to obtain plasmid pUC57-Pglucan-Gla-M13; then, on the T vector, primers TT-Xba IF and TT-BamH IR (as shown in Table 1) were used to amplify the terminator Tglucan693, and then restriction enzyme Xba I and BamHI digested the plasmid pUC57-Pglucan-Gla-M13 and the terminator Tglucan693, purified and recovered the digestion product, and then used ligase solution I to connect the two to obtain plasmid pUC57-Pglucan-Gla-M13-Tglucan693.

[0049] Table 1 Sequences of primers Pglucan-Xho I-Bgl II-Kpn IF and Gla-M13-Xba IR

[0050] 2. Construction of Aspergillus niger engineered strain Aspergillus niger An41683 As the starting strain, the following genes in Aspergillus niger were knocked out one by one using CRISPR-Cas9 technology: prtT, agdA, agdB, agdC, agdD, agdE, agdF, agdG, racA, pepAa, pepAb, pepAc and pepAd, At the same time agdA, agdB, agdC, agdD, agdE, agdF, agdG, racA, pepAa, pepAb, pepAc and pepAd Site-directed integration of a high-activity glucoamylase gene expression cassette without transglycosylation activity glaA-M13 , a series of Aspergillus niger engineered strains with no transglycosidation activity and high activity for efficient production of saccharifying enzymes were constructed. The operation is summarized as follows: An41683 The genome is used as a template to amplify the target genes through PCR reaction: agdA, agdB, agdC, agdD, agdE, agdF, agdG, racA, pepAa, pepAb, pepAc, pepAd The upstream and downstream homology arm sequence fragments will be used Xho I and Bgl II digested the upstream homology arm sequence fragment and the pUC57-Pglucan-Gla-M13-Tglucan693 plasmid, and connected the two using Solution I to obtain the plasmid pUC57-Gla-M13-XX upstream homology arm; then BamH I and Hind III digested the plasmid and the corresponding downstream homology arms, and after ligation, the plasmid pUC57-GlaA-M13-XX upstream and downstream homology arms were obtained. Xho Ⅰ and Hind Ⅲ double digestion to obtain the homologous recombination donor DNA fragment. Then Aspergillus niger An41683 Genome template obtained using CRISPR RGEN tool prtT , agdA, agdB, agdC, agdD, agdE, agdF, agdG, racA, pepAa, pepAb, pepAc, pepAd The target sequences of these genes were 20 bp (http: / / crispor.tefor.net / ), and then a pair of complementary primers were synthesized and annealed to form double-stranded DNA. The double-stranded DNA was then ligated to the target sequences of the genes using Solution I ligase. BbsAfter digestion with I, pUC57-sgRNA-Bbs I plasmid was transformed into E . coli JM109 The competent cells were evenly spread on LB solid medium containing 100 µg / mL ampicillin resistance, inverted and cultured overnight at 37°C, and single clones were picked for colony PCR verification to obtain the pUC57-target-sgRNA intermediate plasmid. Bgl II and Pac I enzyme digestion of the vector to obtain a fragment with the target-sgRNA expression cassette, and then Solution I ligase was used to ligate the fragment with the same Bgl II and Pac Ⅰ After restriction digestion, the pFC332 plasmid vector containing Cas9 was connected to construct the knockout target plasmid pFC332-target-sgRNA; then, through protoplast transformation, the donor DNA fragment of the corresponding gene and the knockout plasmid pFC332-target-sgRNA were co-transformed, poured onto the MMS lower plate with hygromycin resistance, and cultured in a 30°C incubator for about 3 days. The grown transformants were picked onto the PDA plate with hygromycin resistance and cultured for about 3 days, and then a single colony was picked to verify the positive transformant and obtain an engineered strain with high glucoamylase production. The knockout target plasmid pFC332-target-sgRNA of the correct colony was eliminated by continuous subculture until a plasmid without pFC332-Cas9, the corresponding target gene was knocked out and integrated glaA-M13 The results of the engineered Aspergillus niger strains with the gene are shown in Table 2.

[0051] Table 2 Constructed engineering strains and starting strains Strain name Strain genotype GLA An41683, starting strain GLA1 An41683∆prtT GLA2 An41683ΔprtT ΔracA::glaA-M13 GLA3 An41683ΔprtT ΔracA ΔagdA::2glaA-M13 GLA4 An41683ΔprtT ΔracA ΔagdA ΔagdB::3glaA-M13 GLA5 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC::4glaA-M13 GLA6 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD::5glaA-M13 GLA7 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE::6glaA-M13 GLA8 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE ΔagdF::7glaA-M13 GLA9 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE ΔagdF ΔagdG::8glaA-M13 GLA10 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE ΔagdF ΔagdG ΔpepAa::9glaA-M13 GLA11 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE ΔagdF ΔagdG ΔpepAa ΔpepAb::10glaA-M13 GLA12 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE ΔagdF ΔagdG ΔpepAa ΔpepAb ΔpepAc::11glaA-M13 GLA13 An41683ΔprtT ΔracA ΔagdA ΔagdB ΔagdC ΔagdD ΔagdE ΔagdF ΔagdG ΔpepAa ΔpepAb ΔpepAc ΔpepAd::12glaA-M13 Next, we constructed the genetically engineered strain GLA2. racA Taking genes as an example, the construction process is described in detail.

[0052] (1) racA Construction of knockout target plasmid pFC332-racA-sgRNA by racA The gene sequence was used as a template to obtain a 20 bp target sequence using the CRISPR RGEN tool: gatggccgaccgattagctt, and then a pair of complementary primers racA-sgRNA-F and racA-sgRNA-R (as shown in Table 3) were synthesized and annealed to form a double-stranded DNA, which was then ligated to the Bbs I digested the pUC57 plasmid and transformed it into E . coli JM109The competent cells were evenly spread on LB solid medium containing 100 µg / mL ampicillin resistance, inverted and cultured overnight at 37°C, and single clones were picked for colony PCR verification. After verification, pUC57-racA-sgRNA was used Bgl II and Pac Ⅰ double digestion to obtain the fragment with racA expression cassette, ligated to Bgl II and Pac Ⅰ double-enzyme-digested pFC332 vector and then transformed into E . coli JM109 In competent cells, evenly spread on LB solid medium containing 100 µg / mL ampicillin resistance, inverted and cultured overnight at 37°C, pick single clones for colony PCR verification, and obtain knockout target plasmid pFC332-racA-sgRNA after verification. The above primer sequences are shown in Table 3, and the enzyme digestion system and ligation system are shown in Table 4 and Table 5. The knockout target plasmid map for constructing knockout target gene is shown in Figure 1 shown.

[0053] Table 3 Primer sequences of racA-sgRNA-F and racA-sgRNA-R

[0054] Table 4 Enzyme digestion system

[0055] Table 5 Connection system

[0056] (2) Contains glaA-M13 Expression cassette and racA Obtaining donor DNA fragments of upstream and downstream homology arms of genes design racA The upstream homology arm primer pair racA-F1 / racA-F2 and the downstream homology arm primer pair racA-R1 / racA-R2 of the gene (as shown in Table 6) were used to isolate Aspergillus niger. An41683 The genome was used as a template and amplified by PCR racA The upstream homology arm fragment and the downstream homology arm fragment of the gene were connected to the pUC57-Pglucan-Gla-M13-Tglucan693 plasmid respectively, and the homologous recombination donor fragment was obtained after being digested with XhoⅠ and HindⅢ and then cut and recovered. The results of the enzyme digestion were verified as follows: Figure 2 shown.

[0057] Table 6 Homology arm primer sequences

[0058] (3) racA Construction of gene knockout strains Through protoplast transformation, racA Homologous recombination donor DNA fragment of gene (gene prt Without adding homologous recombination donor fragments), pFC332-racA-sgRNA, protoplasts made with GLA1 strain, PEG Buffer, and MMS upper medium containing 100 µg / mL hygromycin were mixed and poured onto the MMS lower plate containing 100 µg / mL hygromycin and cultured in a 30°C incubator for about 3 days. Then, the grown transformants were picked onto the PDA hygromycin resistance plate and cultured for about 3 days. When the transformants matured, the genome was extracted, and PCR was performed to verify the positive transformants to obtain the engineered strain. The knockout target plasmid pFC332-racA-sgRNA-AMA1-T1 of the correct colony was eliminated by continuous subculture until a plasmid without pFC332-racA-sgRNA-AMA1-T1 was obtained, and one was integrated into each target gene. glaA-M13 An engineered strain of Aspergillus niger with a high-yield saccharifying enzyme gene.

[0059] Using the above steps, one glaA-M13 The expression cassette was used to construct the Aspergillus niger engineering strain shown in Table 2. The primers used in the construction process are shown in Table 7. The PCR verification electrophoresis diagram of the obtained engineering strain is shown in Figure 3 shown.

[0060] Table 7 Primer sequence list Primer name Primer sequences use prtT-sgRNA-F CACCAGATGTGATCTAGATCCGCG prtT site knockout plasmid prtT-sgRNA-R AAACCGCGGATCTAGATCACATCT prtT site knockout plasmid agdA-UP-F AATctcgagCCAAAGGGGGTATCAC agdA upstream homology arm agdA-UP-R AATagatctCCTGGCAGCCAGACGATCA agdA upstream homology arm agdA-Down-F TATggatcCCCACGGCATTCCTGCATGACT agdA downstream homology arm agdA- Down-R CTCaagcttATGCTGTGACTAACCCGAGCG agdA downstream homology arm agdB-UP-F AATctcgagGTTGCATCCGACGCTTTGT agdB upstream homology arm agdB-UP-R AATagatctATTACAGCAAGCCGTGACTTCA agdB upstream homology arm agdB-Down-F TATggatcGTTGCATCCGACGCTTTGT agdB downstream homology arm agdB- Down-R CTCaagcttATTACAGCAAGCCGTGACTTCA agdB downstream homology arm agdC-UP-F TTGctcgagGCGTTACATCCATCAGCTTGGC agdC upstream homology arm agdC-UP-R GGAagatctAGGTCAGAGGGGGCACAAG agdC upstream homology arm agdC-Down-F TGCggatccACAGTGGAGTCAAGTATGTTTTCGTAGT agdC downstream homology arm agdC-Down-R GCGaagcttCATTTTTGGATATAGATGGTAGGGTAG agdC downstream homology arm agdD-UP-F AAActcgagGCATGGCGAACGCCCACA agdD upstream homology arm agdD-UP-R CGGagatctTCAGGCAGTTCCAATCTTCACTGA agdD upstream homology arm agdD-Down-F GTGggatccCAGGTTGCGTGGTATCACTACTAGTAC agdD downstream homology arm agdD-Down-R CCGaagcttAACGTCGTTTCAACAGAACCCATCT agdD downstream homology arm agdE-UP-F ATTctcgagAGCAGAGCTTCAGAGCAACG agdE upstream homology arm agdE-UP-R GCGagatctACACTCAACCTCTGAAAGAAGAACTATCA agdE upstream homology arm agdE-Down-F AAGggatccCACGAGGATATGGATTGAGCACCC agdE downstream homology arm agdE-Down-R ACCaagcttTCAACAAGACTACCTGCACCCC agdE downstream homology arm agdF-UP-F ATGctcgagCGGGATAACATGACGTGGAAGTGG agdF upstream homology arm agdF-UP-R GGTagatctTCACACTGGGGTATGGAGGGA agdF upstream homology arm agdF-Down-F GGCggatccGGATATTGGAAAGACTGTGGAGTATAAGGG agdF downstream homology arm agdF-Down-R GGCaagcttCAAGGATGACGAATAGAGTCGAAGTGTTG agdF downstream homology arm agdG-UP-F GTActcgagATGGCCTGATCAGGG agdG upstream homology arm agdG-UP-R GGAagatctCTTGGGCGAGAGTTTTGAAATCCTG agdG upstream homology arm agdG-Down-F GGCggatccTGTTGCTTCTCATGCACTGTATACTAAGAGT agdG downstream homology arm agdG-Down-R GGGaagcttCATCCGCCCCAATGTTTGCTA agdG downstream homology arm pepAa-UP-F GAGctcgaggcgaatcaactatagtaggcctgct pepAa upstream homology arm pepAa-UP-R GGAagatctgactggaggagctgcatggt pepAa upstream homology arm pepAa-Down-F GGCggatccggtacctcccttatgctgct pepAa downstream homology arm pepAa-Down-R GGGaagcttaaagcaatgcacgtgagcaaact pepAa downstream homology arm pepAb-UP-F GAGctcgagcaccacgccactaactgcc pepAb upstream homology arm pepAb-UP-R GGAagatctcctgagcgcttgtagttgagattg pepAb upstream homology arm pepAb-Down-F GGCggatccggcgcaggataagctacc pepAb downstream homology arm pepAb-Down-R GGGaagcttggtaggagcagggatggcatg pepAb downstream homology arm pepAc-UP-F GAGctcgagatcacatcgagcgcatgaagcaa pepAc upstream homology arm pepAc-UP-R GGAagatctgcaaggagcgaggcagtg pepAc upstream homology arm pepAc-Down-F GGCggatccgcctcctgtggacttcgt pepAc downstream homology arm pepAc-Down-R GGGaagcttgccgaagtggacaataaggatatg pepAc downstream homology arm pepAd-UP-F GAGctcgagcattctgtcattgactccggct pepAd upstream homology arm pepAd-UP-R GGAagatctccaggtatcagagccgcc pepAd upstream homology arm pepAd-Down-F GGCggatccgtggacgatgtctatgttggc pepAd downstream homology arm pepAd-Down-R GGGaagcttgcggttaactagagccaaagcatg pepAd downstream homology arm pepAa-sgRNA-F caccGTGGAACCGGTGCTCTGCAT pepAa site knockout plasmid pepAa-sgRNA-R aaacATGCAGAGCACCGGTTCCAC pepAa site knockout plasmid pepAb-sgRNA-F caCCACCCACGGCAAACGACACAG pepAb site knockout plasmid pepAb-sgRNA-R aaacCTGTGTCGTTTGCCGTGGGT pepAb site knockout plasmid pepAc-sgRNA-F caccTCAATGGCCAGACTAAACAG pepAc site knockout plasmid pepAc-sgRNA-R aaacCTGTTTAGTCTGGCCATTGA pepAc site knockout plasmid pepAd-sgRNA-F caccACTGACAAGGACAAGTACAC pepAd site knockout plasmid pepAd--sgRNA-R aaacGTGTACTTGTCCTTGTCAGT pepAd site knockout plasmid agdA-sgRNA-F CACCaaagtgcagcacaattcacg agdA site knockout plasmid agdA sgRNA-R AAACcgtgaattgtgctgcacttt agdA site knockout plasmid agdB-sgRNA-F CACCCTTCTACGATTGGTACACAG agdB site knockout plasmid agdB-sgRNA-R AAACCTGTGTACCAATCGTAGAAG agdB site knockout plasmid agdC-sgRNA-F CACCtagtagatgcatgccccggg agdC site knockout plasmid agdC-sgRNA-R AAACcccggggcatgcatctacta agdC site knockout plasmid agdD-sgRNA-F CACCacgtccccacaagtcgacat agdD site knockout plasmid agdD-sgRNA-R AAACatgtcgacttgtggggacgt agdD site knockout plasmid agdE-sgRNA-F CACCggatgagtcgagttcgtatg agdE site knockout plasmid agdE-sgRNA-R AAACcatacgaactcgactcatcc agdE site knockout plasmid agdF-sgRNA-F CACCtctgcgacataggagcgaag agdF site knockout plasmid agdF-sgRNA-R AAACcttcgctcctatgtcgcaga agdF site knockout plasmid agdG-sgRNA-F CACCtgagggccacaagtccgtgg agdG site knockout plasmid agdG-sgRNA-R AAACccacggacttgtggccctca agdG site knockout plasmid M13-F-Verification AGCTCTGGCTCTGGCAGCTCAA PCR verification of glucoamylase expression cassette The PCR reaction system for amplifying the upstream and downstream homology arms is shown in Table 8.

[0061] Table 8 PCR reaction system:

[0062] Reaction conditions: denaturation at 98°C for 2 min; then denaturation at 98°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; then extension at 72°C for 2 min; finally storage at 4°C and recovery.

[0063] The system of the above colony verification PCR reaction is shown in Table 9.

[0064] Table 9 PCR reaction system:

[0065] Reaction conditions: denaturation at 94°C for 2 min; then denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; then extension at 72°C for 2 min; finally storage at 4°C and recovery.

[0066] Example 2 This example uses the engineered strains GLA1-GLA13 constructed in Example 1 and the starting strain Aspergillus niger An41683 Glucoamylase was produced by fermentation and the activity of saccharifying enzyme in the fermentation broth was determined.

[0067] (1) The engineered strains GLA1 to GLA13 constructed in Example 1 and the starting strain were used to ferment and produce saccharifying enzymes in a shake flask. The specific steps are as follows: First, the colonies of each strain were inoculated into 50 mL CD liquid medium and cultured at 30°C for 3 days. Then, 20% of the colonies were inoculated into YPD liquid medium and cultured at 30°C and 180 r / min for 3 days. Then, the seed liquid was transferred to 50 mL corn steep liquor fermentation medium at an inoculation ratio of 10%, and cultured at 200 r / min and 34°C for 5 days. The fermentation supernatant was then collected.

[0068] (2) Determination of saccharifying enzyme activity of engineered strains The saccharifying enzyme activity in the fermentation supernatant of each engineered strain was determined by 3,5-dinitrosalicylic acid (DNS) method.

[0069] The determination method is as follows: Add 500 μL of 2% soluble starch solution and 100 μL of 0.05 M sodium acetate buffer at pH 4.6 to a 1.5 mL EP tube, mix well, and preheat in a 40°C warm water bath for 10 min; add 40 μL of the enzyme solution to be tested (fermentation solution centrifuged at 12000 r / min for 2 min), react for 30 min, and immediately add 20 μL of 1 mol / L NaOH to terminate the reaction. After mixing well, quickly put it in an ice water bath and cool it for 2 min; at the same time, add 40 μL of fermentation solution in which saccharifying enzyme was inactivated in a boiling water bath to the control tube as a blank control, and perform the same operation process. Pipette 50 μL of the reaction solution from each reaction tube and add it to a new 1.5 mL EP tube, add 100 μL of deionized water and 200 μL of DNS solution to each, react in a boiling water bath for 5 min, and immediately put it in an ice water bath for 2 min; take out 20 μL from each reaction tube, add it to a 96-well plate, add 250 μL of deionized water, and mix it by pipetting; measure the OD value at 520 nm with an enzyme reader; calculate the reducing sugar content according to the standard curve.

[0070] Definition of enzyme activity: 1g solid enzyme powder (or 1mL liquid enzyme) at 40℃ and pH 4.6 can decompose soluble starch to produce 1mg glucose in 1h, which is 1 enzyme activity unit, expressed as U / g (or U / mL).

[0071] The saccharifying enzyme activities in the fermentation supernatants of each engineered strain are shown in Table 10.

[0072] Table 10 Enzyme activity of starting bacteria and high-yielding saccharifying enzyme strains Strain name Enzyme activity (U / mL) Increase in enzyme activity (%) GLA 8369.75 - GLA1 9387.68 12.16 GLA2 9790.00 16.97 GLA3 9987.66 19.33 GLA4 9996.29 19.43 GLA5 11291.75 34.91 GLA6 9864.41 17.86 GLA7 9826.35 17.40 GLA8 9225.71 10.23 GLA9 10913.82 30.39 GLA10 10432.24 24.64 GLA11 10907.76 30.32 GLA12 10980.77 31.19 GLA13 11703.42 39.84 As shown in Table 10, the levels of saccharifying enzymes produced by different engineered strains are different, but they are all higher than the original strain GLA in terms of saccharifying enzyme activity. Among them, the saccharifying enzyme activities of engineered strains GLA5, GLA9, GLA11, GLA12 and GLA13 are 11291.75, 10913.82, 10907.76, 10980.77 and 11703.42 U / ml, respectively, which are 34.91%, 30.39%, 30.32%, 31.19% and 39.84% higher than the original strain (saccharifying enzyme activity is 8369.75U / ml). The saccharifying enzyme activities of other engineered strains have also increased by more than 10%.

[0073] (3) Determination of transaminase activity in fermentation broth of engineered strains and starting strains The fermentation supernatant of each engineered strain was collected, and the activity of transaminase in the fermentation supernatant was detected. The detection method was as follows: Take a 1.5 mL EP tube, add 0.4 mL of pH 4.8, 0.05 M sodium acetate buffer and 0.1 ml of diluted saccharification enzyme fermentation broth, mix well, then add 0.5 M maltose solution (dissolved with pH 4.8, 0.05 M sodium acetate buffer), blow and mix well, add the same volume of inactivated enzyme solution to the control tube; place it in a 37℃ water bath for 20 h, and immediately put it in boiling water for 10 min to inactivate the enzyme. The transaminase activity in the fermentation broth was analyzed by detecting the content of isomaltose in the product by HPLC. The chromatographic column was a sugar analysis column (PrevailCarbohydrate ES 5um, Grace Company), the mobile phase was 67% acetonitrile, the flow rate was 0.8 mL / min, the injection volume was 5 µL, the column temperature was 40℃, and the detector was an evaporative light scattering detector.

[0074] The result shows that in the starting strain, an obvious isomaltose peak will appear in HPLC, indicating that the fermentation liquid of the starting strain can hydrolyze maltose to generate isomaltose, indicating that the fermentation liquid of the starting strain will produce transglycosidic activity after hydrolyzing maltose. After the fermentation liquid of the saccharifying enzyme recombinant strain GLA1-4 hydrolyzes maltose, an isomaltose peak appears in HPLC, while the fermentation liquid of other saccharifying enzyme high-yield strains does not appear after hydrolyzing maltose. The content of isomaltose in the product is detected by HPLC to analyze the transglycosidic effect in the fermentation liquid, and the transglycosidic activity in the supernatant of the fermentation liquid of the starting strain is defined as 100%, and the transglycosidic activity of the fermentation liquid of each engineering strain after hydrolyzing maltose is calculated. The transglycosidic activity of the fermentation liquid of each engineering strain after hydrolyzing maltose is shown in Table 11.

[0075] Under the above experimental conditions, the transaminase activity was defined as 1 mL of liquid enzyme decomposing maltose to produce 1 mg of isomaltose at 37°C and pH 4.8 for 1 h, which was 1 transaminase activity unit and was expressed as U / mL.

[0076] Table 11 Transglycosidation activity of starting strain and engineered strain Strain name Transamination activity (U / mL) Decreased transamination activity (%) GLA 3.00 - GLA1 2.58 14.00 GLA2 1.15 63.33 GLA3 0.40 86.67 GLA4 0.20 93.33 GLA5 0.00 100 GLA6 0.00 100 GLA7 0.00 100 GLA8 0.00 100 GLA9 0.00 100 GLA10 0.00 100 GLA11 0.00 100 GLA12 0.00 100 GLA13 0.00 100 As can be seen from Table 11, the transaminase activity in the fermentation broth of the starting strain was 3.00 U / mL, while the transaminase activities in the fermentation broth of the engineered strains GLA1~GLA4 were 2.58 U / mL, 1.15 U / mL, 0.40 U / mL, and 0.20 U / mL, respectively. The transaminase activities in the supernatants of the fermentation broths of these strains decreased by 14.00%, 63.33%, 86.67%, and 93.33% respectively compared with those of the starting strains, indicating that with the gradual knockout of the α-glucosidase gene and the increase in the copies of the saccharifying enzyme gene without transaminase activity, the transaminase activity in the saccharifying enzyme fermentation broth gradually decreased; no transaminase activity was detected in the fermentation broth of the genetically engineered strains GLA5~GLA13, indicating that there was no α-glucosidase in the fermentation broth, so there was no need to consider removing the α-glucosidase in the fermentation broth, which can effectively reduce the separation and purification cost of the saccharifying enzyme after fermentation and improve the purity of the saccharifying enzyme.

[0077] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An engineered strain for high production of saccharifying enzymes, characterized in that: The engineered strain is based on Aspergillus niger as the starting strain, and the gene is knocked out. prt Use with glaA-M13 The expression cassette is constructed by replacing the gene to be knocked out in Aspergillus niger; The genes to be knocked out include genes racA ; glaA-M13 The expression cassette consists of a filamentous fungus promoter, a saccharifying enzyme gene glaA- M13 and a terminator; the saccharifying enzyme gene glaA-M13 Encodes the amino acid sequence shown in SEQ ID NO.

1.

2. The engineered strain according to claim 1, characterized in that The saccharifying enzyme gene glaA-M13 The nucleotide sequence is shown in SEQ ID NO.2; and / or The nucleotide sequence of the filamentous fungus promoter is shown in SEQ ID NO.3 or SEQ ID NO.4; and / or The terminator is terminator Tglucan693; and / or The Aspergillus niger is Aspergillus niger An41683, Aspergillus niger CBS 513.88 Aspergillus niger SH2 .

3. The engineered strain according to claim 1 or 2, characterized in that The gene to be knocked out also includes an α-glucosidase gene; and / or The genes to be knocked out also include pepsin-like genes.

4. The engineered strain according to claim 3, characterized in that The α-glucosidase gene includes the gene aiZd , agB , aiZd , aD , aiZd , f and aiD At least one of; and / or The pepsin-like gene includes a gene pepAa, pepAb, pepAc and pepAd At least one of .

5. The engineered strain according to claim 1 or 2, characterized in that The genes to be knocked out include genes racA ,Gene aiZd ,Gene agB and genes aiZd .

6. The engineered strain according to claim 1 or 2, characterized in that The genes to be knocked out include genes racA ,Gene aiZd ,Gene agB ,Gene aiZd ,Gene aD ,Gene aiZd ,Gene f and genes agdG.

7. The engineered strain according to claim 6, characterized in that The genes to be knocked out also include pepsin-like genes, and the pepsin-like genes include genes pepAa, pepAb, pepAc and pepAd At least one of .

8. The engineered strain according to claim 7, characterized in that The pepsin-like gene includes a gene pepAa, pepAb、pepAc and pepAd .

9. Use of the engineered strain according to any one of claims 1 to 8 in the fermentation production of saccharifying enzymes.

10. A method for producing saccharifying enzyme by fermentation, characterized in that: The engineered strain according to any one of claims 1 to 8 is used to ferment and produce saccharifying enzyme.

Images