Construction of inverter switch in corynebacterium glutamicum and applicable bidirectional promoter thereof

Abstract

The invention discloses a temperature-sensitive inverter for representing BDPs activity in corynebacterium glutamicum and a preparation method of the temperature-sensitive inverter, a switch of the temperature-sensitive inverter can accurately control genes according to temperature change, and expression of specific genes can be started or stopped in a proper time period; according to the regulation and control mode, the regulation and control process of different genes in different stages is simplified, so that more accurate and flexible control is realized in metabolic engineering; through temperature regulation, the activity of a key enzyme in a metabolic pathway can be effectively improved, and the synthesis amount of a target product is maximized.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to the construction of an inverter switch in Corynebacterium glutamicum and a bidirectional promoter applicable thereto. Background Art

[0002] Corynebacterium glutamicum is a Gram-positive bacterium that has become an important strain in the production of industrial amino acids (such as glutamate and lysine) due to its efficient metabolic capacity and strong tolerance. The advantages of this strain include: efficient carbon and nitrogen metabolic flux, good tolerance to a variety of metabolites, low by-product production, and stability suitable for large-scale fermentation, making it widely used in industrial production. However, compared with other microbial systems (such as Escherichia coli and Bacillus subtilis), C. glutamicum still has a series of technical defects and challenges in the construction of genetic circuits and genetic engineering applications, and these limitations need to be urgently addressed in synthetic biology and industrial applications. Compared with model strains (such as Escherichia coli), the natural promoters and regulatory elements of C. glutamicum are relatively limited and cannot fully meet the construction requirements of complex metabolic pathways. Although some progress has been made in the development of artificial synthetic promoter libraries, it is still challenging to achieve large-scale gene expression regulation. In addition, due to the lack of regulatory elements, the expression of exogenous genes is often not ideal, and a large number of experiments are required to optimize the expression level and stability.

[0003] Although Corynebacterium glutamicum has shown significant advantages in amino acid production, its application in genetic circuit construction is still limited by the efficiency of gene editing tools, insufficient regulatory elements, the impact of environmental stress, increased metabolic burden, and system stability issues. These challenges limit its potential for application in more complex synthetic biology projects and increase the time and cost of engineering development. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a bidirectional promoter for a temperature-sensitive inverter switch in Corynebacterium glutamicum.

[0007] To solve the above technical problems, the present invention provides the following technical solution: a bidirectional promoter of a temperature-sensitive inverter switch in Corynebacterium glutamicum, wherein the nucleotide sequence of the bidirectional promoter is as shown in SEQ ID NO: 1

[0008] Another object of the present invention is to provide a method for constructing a temperature-sensitive inverter switch plasmid.

[0009] As a preferred embodiment of the construction method of the present invention, the p19-0 plasmid is used as the plasmid backbone, the constitutive promoter H36 is tandemly linked to the temperature-sensitive transcription factor CI 857 The vector p19-H36-CI was constructed with red fluorescent protein RFP. 857 -RFP-GFP.

[0010] As a preferred embodiment of the construction method of the present invention, the method comprises:

[0011] Use primer CI 857 -F and CI 857 -R, with plasmid J23-CI 857 -T435 was used as template and CI was obtained by PCR amplification 857 fragment; among them, CI 857 The nucleotide sequence of -F is shown in SEQ ID NO: 2, 857 -R's nucleotide sequence is shown in SEQ ID NO: 3;

[0012] Primers RBG-RFP-F and RBG-RFP-R were used to amplify the RFP fragment using plasmid p19-RBG as a template; wherein the nucleotide sequence of RBG-RFP-F is shown in SEQ ID NO: 4, and the nucleotide sequence of RBG-RFP-R is shown in SEQ ID NO: 5;

[0013] Using primers RBG-backbone-F1 / RBG-backbone-R1, RBG-backbone-F2 / RBG-backbone-R2, RBG-backbone-F3 / RBG-backbone-R3, RBG-backbone-F4 / RBG-backbone-R4, RBG-backbone-F5 (nucleotide sequence as shown in SEQ ID NO: 14) / RBG-backbone-R5 (nucleotide sequence as shown in SEQ ID NO: 15), plasmid p19-BDP was used as a template to amplify backbone1 to backbone5 fragments; wherein the nucleotide sequence of RBG-backbone-F1 is shown in SEQ ID NO: 6, the nucleotide sequence of RBG-backbone-R1 is shown in SEQ ID NO: 7, the nucleotide sequence of RBG-backbone-F2 is shown in SEQ ID NO: 8, and the nucleotide sequence of RBG-backbone-R2 is shown in SEQ ID NO: 9. NO:9, the nucleotide sequence of RBG-backbone-F3 is shown in SEQ ID NO:10, the nucleotide sequence of RBG-backbone-R3 is shown in SEQ ID NO:11, the nucleotide sequence of RBG-backbone-F4 is shown in SEQ ID NO:12, the nucleotide sequence of RBG-backbone-R4 is shown in SEQ ID NO:13, the nucleotide sequence of RBG-backbone-F5 is shown in SEQ ID NO:14, and the nucleotide sequence of RBG-backbone-R5 is shown in SEQ ID NO:15;

[0014] The seven fragments were connected by Gibson assembly to obtain the plasmid vector p19-H36-CI 857 -RFP-GFP.

[0015] Another object of the present invention is to provide a method for verifying a temperature-sensitive inverter switch in Corynebacterium glutamicum.

[0016] As a preferred solution of the verification method of the present invention, it includes:

[0017] The bidirectional promoter BDPs described in claim 1 is inserted between the red fluorescent protein RFP and the green fluorescent protein GFP of the plasmid described in claim 2 to construct a temperature-sensitive plasmid;

[0018] The temperature-sensitive plasmid was electrotransformed into the competent cells of Corynebacterium glutamicum CGMCC 1.15647;

[0019] Fluorescence detection.

[0020] As a preferred embodiment of the verification method of the present invention, the fluorescence detection temperature is 27-36°C.

[0021] As a preferred embodiment of the verification method of the present invention, the fluorescence detection temperature is 30-36°C.

[0022] As a preferred embodiment of the verification method of the present invention, when the temperature is relatively low, the transcription factor binds, the bidirectional promoter is stuck, RFP is expressed, and GFP is not expressed; when the temperature rises, the transcription factor is unblocked, the GFP gene begins to express, and antisense transcription is performed on the left, interfering with CI 857 and RFP transcription, the red fluorescence weakened.

[0023] As a preferred embodiment of the verification method of the present invention, in the transformation of Corynebacterium glutamicum, the culture medium is LBHIS solid culture medium.

[0024] As a preferred embodiment of the verification method of the present invention, the formula of the LBHIS solid culture medium is 2.5 g / L yeast extract, 5 g / L tryptone, 5 g / L NaCl, 18.5 g / L brain heart infusion, 91 g / L sorbitol and 1.85% agar powder.

[0025] Another object of the present invention is to provide the use of a bidirectional promoter of a temperature-sensitive inverter switch in Corynebacterium glutamicum in improving enzyme activity in a metabolic pathway.

[0026] Beneficial effects of the present invention:

[0027] 1. The temperature-sensitive inverter switch of the present invention can accurately control genes according to temperature changes, and turn on or off the expression of specific genes at appropriate time periods. This regulation method simplifies the regulation process of different genes at different stages, thereby achieving more precise and flexible control in metabolic engineering; through temperature regulation, the activity of key enzymes in the metabolic pathway can be effectively improved, maximizing the synthesis of the target product.

[0028] 2. The present invention can quickly and effectively screen out highly active BDPs in Corynebacterium glutamicum.

[0029] 3. Compared with chemical inducers, temperature as a regulating factor is pollution-free and highly controllable; and temperature-sensitive inverter switches do not require the addition of additional chemical inducers, which significantly reduces production costs in large-scale industrial fermentation, reduces the generation and treatment of pollutants, reduces dependence on exogenous chemicals, and also helps to improve the environmental friendliness of production.

[0030] 4. The temperature-sensitive inverter switch control technology of the present invention is simple to operate and highly accurate, and is very suitable for the large-scale needs of industrial production. Through temperature control equipment, the production system can easily adjust the gene expression pattern of the strain, reducing the complexity and human errors of the manual control process. The efficient automated control method of the present invention not only improves production efficiency, but also improves the consistency and repeatability between batches.

[0031] 5. The present invention utilizes the development of BDPs to coordinate the expression of genes at both ends simultaneously, and can develop other biological elements. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0033] Figure 1 This is the construction and screening of the BDPs library in Example 1 of the present invention; wherein, a is the construction of 4 BDPs libraries; and b is the screening process for active BDPs.

[0034] Figure 2 The fluorescence and sequence of 77 BDPs units in E. coli in Example 1 of the present invention; wherein a is a box plot of 4 BDPs libraries; b is the fluorescence value of 77 BDPs units; and c is the sequencing result of BDPs with different activities.

[0035] Figure 3 The fluorescence and sequence of 8 BDPs (bidirectional promoters) STEP (transient fluorescent protein characterization sensor) units in Corynebacterium glutamicum in Example 2 of the present invention;

[0036] Figure 4 The red and green unit fluorescence of 8 BDPs in Corynebacterium glutamicum in Example 3 of the present invention;

[0037] Figure 5 Schematic diagram of the p19-H36-CI857-RFP-GFP plasmid and the temperature-sensitive inverter switch in Example 4 of the present invention;

[0038] Figure 6 The unit fluorescence values ​​of RFP (red fluorescent protein) and GFP (green fluorescent protein) in C. glutamicum at different temperatures in Example 5 of the present invention. DETAILED DESCRIPTION

[0039] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0040] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0041] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0042] The raw materials and reagents used in the present invention are: 2×PrimeSTAR Max DNA Polymerase, Bao Biotechnology (Dalian) Co., Ltd.; 2×Rapid Taq Master Mix, Nanjing Novogene Biotechnology Co., Ltd.; 2×MultiFSeamlessAssembly Mix, Wuhan Abotek Biotechnology Co., Ltd.; 2×Es Taq Master Mix (Dye), plasmid small-scale extraction kit and gel recovery kit, Taizhou Kangwei Century Co., Ltd. Primers, Suzhou GENEWIZ Biotechnology Co., Ltd.

[0043] Experimental methods used in the present invention:

[0044] Fluorescence detection:

[0045] Bacterial solution dilution: dilute the cultured bacterial solution to 10 times with culture medium to ensure that the initial OD value is between 0.4-0.6;

[0046] Determination method: The OD600 value and fluorescence intensity of the bacterial solution were determined using a BioTek multifunctional microplate reader (BioTek Instruments, Inc., USA). Specific parameters include: the excitation wavelength of STEP1 is 488 nm, and the emission wavelength is 520 nm; the excitation wavelength of GFP is 485 nm, and the emission wavelength is 515 nm; the excitation wavelength of RFP is 584 nm, and the emission wavelength is 607 nm.

[0047] LBB medium: 5g / L yeast extract, 10g / L tryptone, 10g / L NaCl, 10g / L brain heart infusion, used for recovery culture of C. glutamicum during electroporation.

[0048] LBHis medium: 2.5 g / L yeast extract, 5 g / L tryptone, 5 g / L NaCl, 18.5 g / L brain heart infusion, 91 g / L sorbitol, used for C. glutamicum plasmid construction. LBHis solid medium is made by adding 1.85% agar powder to LBHis liquid medium.

[0049] Example 1

[0050] Based on the BDPs in the E. coli core region reported in the literature, the conserved sequences in the -10 and -35 regions were retained, and primers were designed and synthesized by Suzhou Jinweizhi Company. Based on the vector p19-0, the gSTEP1 and STEPtag gene sequences were inserted into the vector, and a segment of M13 sequence (gtaaaacgacggccagtcccggggtcatagctgtttcctg) was retained in the middle as the homology arm required for inserting BDPs, and the p19-BDP plasmid was constructed. After the BDPs were inserted, the gSTEP1 and STEPtag genes were co-expressed at both ends of the vector to produce green fluorescence.

[0051] In order to screen for bilaterally active promoters (BDPs) in E. coli, two BDPs sequences with clear core regions from E. coli (wzxB, ygaQ) and one BDPs sequence from C. glutamicum (aceA) were selected. The sequences and gene descriptions are as follows: Figure 1 a, wzxB and ygaQ are genes with clear core regions in E. coli reported in the literature, among which the upstream and downstream sequences of the wzxB gene (encoding O-antigen flippase) overlap in region -10, which is called single-overlapping trans-Bidirectional Promoters (STB), and the upstream and downstream sequences of the ygaQ gene (coding unknown protein) overlap in region -35, which is called single-overlapping cis-Bidirectional Promoters (SCB). aceA (encoding isocitrate lyase) is a gene with clear core region in region -10 in C. glutamicum reported in the literature. syn is a symmetric sequence with overlapping region -35 designed based on the characteristic conserved sequence in C. glutamicum.

[0052] In addition, a fully synthetic BDPs sequence (syn) was designed based on the conserved sequence of the -35 region of the housekeeping gene promoter of C. glutamicum. It was transformed into E. coli DH5α and obtained a library of 4 1000 transformants. 77 BDPs with high fluorescence intensity were observed and screened on four plates and the unit fluorescence value of gSTEP1 / STEPtag was measured. The results are shown in Figure 1 As shown in b. Figure 2 a is a box plot of the four BDPs libraries, indicating that the four BDPs libraries all present strong diversity; Figure 2 b is the unit fluorescence values ​​of 77 BDPs, the unit fluorescence values ​​≥ 60000 belong to the high fluorescence area, and the unit fluorescence values ​​40000≤≤60000 belong to the medium fluorescence area, indicating that the unit fluorescence values ​​≤40000 belong to the low fluorescence area, and the highest value and the lowest value have a difference of about six times; Figure 2 c is the sequencing results of different active BDPs. The red mark is the sequence -35 region, and the blue mark is the sequence -10 region. The diversity of promoter sequences in the library was detected. Further, 3 promoters with the highest unit fluorescence values, 3 medium values, and 3 low values ​​were selected from the 77 promoters for sequencing. The sequencing results confirmed the sequence diversity in the library, and the promoter sequences in different libraries were also different.

[0053] The three promoters S4, W6, and Y19 with the highest unit fluorescence values ​​were selected for the subsequent plasmid construction of the temperature-sensitive inverter switch. The designed primers are shown in Table 1.

[0054]

[0055]

[0056] Example 2C. Screening of overlapping BDPs in the -10 region of glutamicum

[0057] 1. Using the Gibson double-fragment assembly method, primers SCBsyn-F (or SCBygaQ-F, STBaceA-F, STBwzxB-F) and BDP-backbone-R, BDP-backbone-F2 and BDP-backbone-R2 were used to perform circular splicing on the p19-BDP plasmid to construct four BDPs libraries; primers SCB0-F (or SCB1-F, SCB2-F, SCB3-F, SCB4-F, SCB5-F, SCB6-F) and BDP-backbone-R, BDP-backbone-F2 and BDP-backbone-R2 were used for circular splicing to construct seven symmetrical BDPs libraries. The designed primers are shown in Table 2.

[0058] 2. Transformation of Corynebacterium glutamicum

[0059] Transformation: Take out the prepared C.glutamicum CGMCC 1.15647 competent cells and thaw them on ice; add 500 ng of the target plasmid pre-cooled on ice, mix gently and place on ice for 15 minutes; transfer the competent cells to an electroporation cup, click twice at 1.8 kV and 5 ms; transfer to an EP tube containing 915 μl LBHis medium; incubate in a 46°C water bath for 6 minutes and shake at 30°C and 100 r / min for 2 hours; take an appropriate amount of bacterial solution and evenly spread it on an LBHis agar plate containing the corresponding antibiotics, and culture overnight at 30°C for 24-36 hours.

[0060] 3. Cultivation of Corynebacterium glutamicum

[0061] Culture: Pick a single colony of interest and streak it on a LBHis+CM agar plate. After culturing at 30°C for 24 hours, pick a colony of interest and inoculate it on a 24-deep-well plate containing LBHis+CM. After shaking at 30°C and 220 r / min for 24 hours, measure the fluorescence and OD values ​​and calculate the unit fluorescence value. After PCR, the bacterial solution was sent to Genewise for sequencing.

[0062] The results of plate screening of active BDPs in the 7 symmetric BDPs library are shown in Figure 2. Figure 3 As shown in a, 8 highly active BDPs were selected from the plate according to the fluorescence intensity and the unit fluorescence value ( Figure 3 b) and the sequence ( Figure 3 C) detection.

[0063] Table 2

[0064]

[0065]

[0066] Example 3 Detection of Bilateral Activity of BDPs

[0067] The STEP bimolecular fluorescence detection system was used to quickly screen out BDPs with high bilateral activity in the culture medium. In order to detect the activity of both sides of BDPs separately, a vector with RFP on the left and GFP on the right was constructed to obtain a new vector p19-RBG. Then, the red and green fluorescence values ​​of the left and right ends of BDPs were detected in E. coli and C. glutamicum, respectively.

[0068] The results are as follows Figure 4 As shown in the figure, the BDPs screened in C. glutamicum also have bilateral activity in E. coli, and the activity is higher, which shows that BDPs are universal and have different activities in different host bacteria. By comparing the unit fluorescence values ​​of different strains in the figure, it can be found that the common activity of BDPs on both sides is not proportional to the unilateral activity.

[0069] Based on the bilateral unit fluorescence values ​​in E. coli and C. glutamicum, the promoter SCB1-7 (nucleotide sequence shown in SEQ ID NO: 1) was selected for the subsequent plasmid construction of the temperature-sensitive inverter switch.

[0070] Example 4

[0071] 1. Plasmid construction of temperature-sensitive inverter switch

[0072] In order to construct a temperature-sensitive inverter switch, the temperature-sensitive transcription factor CI was selected 857 , constitutive promoter H36 tandem expression CI 857 with RFP.

[0073] Use primer CI 857 -F (nucleotide sequence as shown in SEQ ID NO: 2) and CI 857 -R (nucleotide sequence as shown in SEQ ID NO: 3), with plasmid J23-CI 857 -T435 was used as template and CI was obtained by PCR amplification 857 fragment; using primers RBG-RFP-F (nucleotide sequence as shown in SEQ ID NO: 4) and RBG-RFP-R (nucleotide sequence as shown in SEQ ID NO: 5), plasmid p19-RBG was used as a template to amplify the RFP fragment; using primers RBG-backbone-F1 (nucleotide sequence as shown in SEQ ID NO: 6) / RBG-backbone-R1 (nucleotide sequence as shown in SEQ ID NO: 7), RBG-backbone-F2 (nucleotide sequence as shown in SEQ ID NO: 8) / RBG-backbone-R2 (nucleotide sequence as shown in SEQ ID NO: 9), RBG-backbone-F3 (nucleotide sequence as shown in SEQ ID NO: 10) / RBG-backbone-R3 (nucleotide sequence as shown in SEQ ID NO: 11), RBG-backbone-F4 (nucleotide sequence as shown in SEQ ID NO: 12) / RBG-backbone-R4 (nucleotide sequence as shown in SEQ ID NO: 13) NO: 13), RBG-backbone-F5 (nucleotide sequence shown in SEQ ID NO: 14) / RBG-backbone-R5 (nucleotide sequence shown in SEQ ID NO: 15), using plasmid p19-BDP as a template, amplify backbone1 to backbone5 fragments. Connect the seven fragments by Gibson assembly to obtain the plasmid vector p19-H36-CI 857 -RFP-GFP.

[0074] When the temperature is relatively low, transcription factors bind, BDPs are stuck, RFP is expressed, and GFP is not expressed. The vector p19-H36-CI was constructed. 857 -RFP-GFP. When the temperature rises, the transcription factor is released, the GFP gene begins to express, and antisense transcription is carried out on the left, interfering with CI 857 and RFP transcription, the red fluorescence weakens, as shown in the schematic diagram Figure 3 The insertion sites of the regulatory regions are shown in Table 3-2. The 7 BDPs screened in Example 1 and Example 3 were inserted between the vector RFP and GFP genes to construct 7 temperature-sensitive plasmids, as shown in Table 2, where the italic parts are -10 and -35 core regions, the underlined parts are OR1, and the bold parts are OR2.

[0075] p19-H36-CI 857 -Schematic diagram of RFP-GFP plasmid and inverter switch Figure 5 shown.

[0076] Table 2

[0077]

[0078]

[0079] Example 5

[0080] 1. Verification of inverter switching in C. glutamicum

[0081] The seven temperature-sensitive plasmids constructed in Example 4 were electroporated into the competent cells of C. glutamicum CGMCC 1.15647, and five reaction temperatures were set, namely 27°C, 30°C, 33°C, 36°C, and 39°C.

[0082] The detection method is: after reacting at 27°C for 12 hours, transfer it to 30°C for 4 hours, and measure the RFP and GFP unit fluorescence values ​​of the bacterial solution at 27°C. Subsequently, after reacting at different temperatures for 4 hours as above, measure the RFP and GFP unit fluorescence values.

[0083] The results are as follows Figure 6 As shown, within the temperature range of 30 to 36°C, as the external ambient temperature increases, RFP weakens and GFP increases, and a temperature-sensitive inverter switch is successfully constructed in C. glutamicum.

[0084] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

[0085] synthetic construct

[0086] Sequence Listing

[0087] SEQ ID NO.1

[0088] Artificial sequence

[0089] TACCTCTGGCGGTGATAAATTAAGTATCATCATATAACACCGTGCGTGTTG

[0090] TTGGAAACAATCTGTATCACATTAATAACATATGATCGTCASEQ ID NO.2

[0091] GACTCTAGAGATGCCTCCACACCGCTCG

[0092] SEQ ID NO.3

[0093] GTCCTCCTTTTTAGCCGAAGGTTTCTTCAGGCCSEQ ID NO.4

[0094] CTTCGGCTAAAAGGAGGACAACTAATGGCGAGTAGCGAAGACGSEQ ID NO.5

[0095] GTCGTTTTACTTAAGCACCGGTGGAGTGACG

[0096] SEQ ID NO.6

[0097] CGGTGCTTAAGTAAAACGACGGCCAGTCCC

[0098] SEQ ID NO.7

[0099] GATCCAGTTCGATGTAACCC

[0100] SEQ ID NO.8

[0101] GGGTTACATCGAACTGGATC

[0102] SEQ ID NO.9

[0103] CACTAGTTCTCTTTGCCCAC

[0104] SEQ ID NO.10

[0105] GTGGGCAAAGAGAACTAGTG

[0106] SEQ ID NO.11

[0107] CACGTTCTTTCTTCCACTGA

[0108] SEQ ID NO.12

[0109] TCAGTGGAAGAAAGAACGTG

[0110] SEQ ID NO.13

[0111] GCCATCACGAGATTTCGATT

[0112] SEQ ID NO.14

[0113] AATCGAAATCTCGTGATGGC

[0114] SEQ ID NO.15

[0115] GTGGAGGCATCTCTAGAGTCGACCTGCAGG

Claims

1. A bidirectional promoter for a temperature-sensitive inverter switch in Corynebacterium glutamicum, characterized in that: The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO:

1.

2. A method for constructing a temperature-sensitive inverter switch plasmid, characterized in that: The p19-0 plasmid was used as the plasmid backbone, and the constitutive promoter H36 was tandemly linked to the thermosensitive transcription factor CI 857 The vector p19-H36-CI was constructed with red fluorescent protein RFP. 857 -RFP-GFP.

3. The construction method according to claim 2, characterized in that: include, Use primer CI 857 -F and CI 857 -R, with plasmid J23-CI 857 -T435 was used as template and CI was obtained by PCR amplification 857 fragment; among them, CI 857 The nucleotide sequence of -F is shown in SEQ ID NO: 2, 857 -R's nucleotide sequence is shown in SEQ ID NO: 3; Primers RBG-RFP-F and RBG-RFP-R were used to amplify the RFP fragment using plasmid p19-RBG as a template; wherein the nucleotide sequence of RBG-RFP-F is shown in SEQ ID NO: 4, and the nucleotide sequence of RBG-RFP-R is shown in SEQ ID NO: 5; Using primers RBG-backbone-F1 / RBG-backbone-R1, RBG-backbone-F2 / RBG-backbone-R2, RBG-backbone-F3 / RBG-backbone-R3, RBG-backbone-F4 / RBG-backbone-R4, and RBG-backbone-F5 / RBG-backbone-R5, and taking plasmid p19-BDP as a template, backbone1 to backbone5 fragments were amplified; wherein the nucleotide sequence of RBG-backbone-F1 is shown in SEQ ID NO: 6, the nucleotide sequence of RBG-backbone-R1 is shown in SEQ ID NO: 7, the nucleotide sequence of RBG-backbone-F2 is shown in SEQ ID NO: 8, the nucleotide sequence of RBG-backbone-R2 is shown in SEQ ID NO: 9, the nucleotide sequence of RBG-backbone-F3 is shown in SEQ ID NO: 10, and the nucleotide sequence of RBG-backbone-R3 is shown in SEQ ID NO: NO: 11, the nucleotide sequence of RBG-backbone-F4 is shown in SEQ ID NO: 12, the nucleotide sequence of RBG-backbone-R4 is shown in SEQ ID NO: 13, the nucleotide sequence of RBG-backbone-F5 is shown in SEQ ID NO: 14, and the nucleotide sequence of RBG-backbone-R5 is shown in SEQ ID NO: 15; The seven fragments were connected by Gibson assembly to obtain the plasmid vector p19-H36-CI 857 -RFP-GFP.

4. A method for verifying a temperature-sensitive inverter switch in Corynebacterium glutamicum, characterized in that: include, The bidirectional promoter BDPs described in claim 1 is inserted between the red fluorescent protein RFP and the green fluorescent protein GFP of the plasmid described in claim 2 to construct a temperature-sensitive plasmid; The temperature-sensitive plasmid was electrotransformed into the competent cells of Corynebacterium glutamicum CGMCC 1.15647; Fluorescence detection.

5. The verification method according to claim 4, characterized in that: The fluorescence detection temperature is 27-36°C.

6. The verification method according to claim 4 or 5, characterized in that: The fluorescence detection temperature is 30-36°C.

7. The verification method according to claim 4, characterized in that: When the temperature is relatively low, the transcription factor binds, the bidirectional promoter is stuck, RFP is expressed, and GFP is not expressed; when the temperature rises, the transcription factor is unblocked, the GFP gene begins to express, and antisense transcription is performed on the left, interfering with CI 857 and RFP transcription, the red fluorescence weakened.

8. The verification method according to claim 4, characterized in that: In the electrotransformation of Corynebacterium glutamicum, the culture medium is LBHIS solid culture medium.

9. The verification method according to claim 4 or 8, characterized in that: The formula of the LBHIS solid culture medium is 2.5 g / L yeast extract, 5 g / L tryptone, 5 g / L NaCl, 18.5 g / L brain heart infusion, 91 g / L sorbitol and 1.85% agar powder.

10. Use of the temperature-sensitive inverter switch bidirectional promoter in Corynebacterium glutamicum according to claim 1 in improving enzyme activity in a metabolic pathway.

Images