Hybridoma cell strain XXML-2G11A7 and its preparation method and application

Abstract

The present application relates to the field of detection, and particularly relates to a hybridoma cell strain XXML-2G11A7, a preparation method and application thereof; the hybridoma cell strain XXML-2G11A7 has a preservation number of CGMCC NO: 46139, a preservation date of November 21, 2024, and a preservation unit of China General Microbiological Culture Collection Center, and a preservation unit address of No. 3, Institute of Microbiology, Chinese Academy of Sciences, 1st North Chenxi Road, Chaoyang District, Beijing; the antibody secreted by the hybridoma cell strain XXML-2G11A7 of the present application can specifically detect enoxolone, has high sensitivity and good accuracy.

Description

Technical Field

[0001] This invention relates to the field of detection, and in particular to a hybridoma cell line XXML-2G11A7, its preparation method, and its application. Background Technology

[0002] Dimethomorph is a widely used fungicide that inhibits fungal cell wall formation and causes the decomposition of sporangium walls, leading to fungal death. It is particularly effective against fungi of the genera *Persona* and *Phytophthora*, and is mainly used on crops such as cauliflower, grapes, and potatoes. Although dimethomorph has low toxicity, its high frequency of use means that its residues in food are still a concern. The residue limits for dimethomorph vary greatly among some edible agricultural products, with a maximum difference of 4000 times, and some edible agricultural products have relatively low residue limits, thus placing high demands on detection technologies.

[0003] Currently, the main analytical methods for detecting dimethomorph residues include instrumental methods such as liquid chromatography, gas chromatography, liquid chromatography-mass spectrometry (LC-MS), and gas chromatography-mass spectrometry (GC-MS). However, these instrumental methods require expensive equipment, resulting in high testing costs and long processing times, making them unsuitable for rapid on-site detection of pesticide residues. Compared to instrumental analytical methods, immunoassay offers advantages such as speed, simplicity, real-time processing, ease of on-site detection, simple sample pretreatment, high sensitivity, strong selectivity, suitability for high-throughput analysis, and significant reduction in testing costs. Summary of the Invention

[0004] The purpose of this invention is to address the shortcomings of existing technologies by providing a hybridoma cell line XXML-2G11A7, its preparation method, and its applications.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] The first aspect of the present invention is to provide a hybridoma cell line XXML-2G11A7, with accession number CGMCC NO: 46139, accession date November 21, 2024, deposited by the China General Microbiological Culture Collection Center, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0007] Preferably, the nucleotide sequence of XXML-2G11A7-VH is as shown in SEQ ID NO: 1 (GAGGTGCAGCTTCAGGAGTCAGGACCTAGCCTCGTGAAACCTTCTCAGA CTCTGTCCCTCACCTGTTCTGTCACTGGCGACTCCATCACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGAAATTGAGTACATGGGGTATATCAGCTACAGTGGTAGAACTTACTACAATCCATCTCTCAAAAGTCGAATCTCCATCACTCGAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTAATGAAGACACAGCCACATATTACTGTTCAAGATCCAATATTATCTACGGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA), and the nucleotide sequence of XXML-2G11A7-VL is as shown in SEQ ID NO: 1 (GAGGTGCAGCTTCAGGAGATCAGGACCTAGCCAATATTATCTACGGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA). NO: 2(GATGTTGTGGTGACTCAAACTCCGCTTCCCTGCCTGTCAGTTTTGGAGA TCAAGTTTCTATCTCTTGCAGGTCTAGTCAGAGTCTTGCAAATAATTTTGGGAACACCTATTTGTCTTGGTACCTGCACAAGCCTGGCCAGTCTCCACAGCTCCTCATCTATGGGATTTCCAACAGATTTTCTGGGGTGCCAGAC AGGTTCAGTGGTAGTGGTTCAGGGACAGATTTCACACTCAAGATCAGCACAATAAAGCCTGAGGACTTGGGAATGTATTACTGCGTACAAGGTACACATCAGCCTCCCACGTTCGGAGGGGGGACCAAGCTGGAAAATAAAA).

[0008] A second aspect of the present invention is to provide a method for preparing the above-mentioned hybridoma cell line XXML-2G11A7, comprising the steps of:

[0009] S1. Prepare dimethomorph hapten A, dimethomorph hapten B, dimethomorph complete antigen C1 and dimethomorph complete antigen C2;

[0010] S2. The dimethomorpholine complete antigen C2 is emulsified and then used to immunize animals.

[0011] S3. After fusing the spleen cells and myeloma cells of the immunized animal, the cells are screened and cloned to obtain the hybridoma cell line XXML-2G11A7.

[0012] Preferably, the structural formula of the dimethomorpholine hapten A is shown in Formula I:

[0013]

[0014]

[0015] Preferably, the structural formula of the dimethomorpholine hapten B is shown in Formula II:

[0016]

[0017] More preferably, the preparation steps of the dimethomorpholine hapten B include: weighing the dimethomorpholine hapten A, N-hydroxysuccinimide and dicyclohexylcarbodiimide, dissolving them separately in anhydrous N,N-dimethylformamide, mixing and stirring for 4 hours, and centrifuging the reaction solution after the reaction is completed to obtain the dimethomorpholine hapten B.

[0018] Preferably, the structural formula of the dimethomorpholine complete antigen C2 is shown in Formula III:

[0019]

[0020] More preferably, the preparation steps of the dimethomorph complete antigen C2 include: weighing bovine serum albumin and dissolving it in PBS to obtain a bovine serum albumin solution; slowly adding the dimethomorph hapten B dropwise to the bovine serum albumin solution; reacting at room temperature for 4 hours; and then dialysis with PBS solution to obtain the dimethomorph complete antigen C2.

[0021] A third aspect of the present invention is to provide a dimethomorph monoclonal antibody, which is secreted by the hybridoma cell line XXML-2G11A7 described above or the hybridoma cell line XXML-2G11A7 prepared by the above method.

[0022] A fourth aspect of the present invention is to provide the use of the above-described hybridoma cell line XXML-2G11A7 or the hybridoma cell line XXML-2G11A7 prepared by the above-described preparation method or the above-described dimethomorph monoclonal antibody in the detection of dimethomorph.

[0023] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:

[0024] The antibody secreted by the hybridoma cell line XXML-2G11A7 of the present invention can specifically detect dimethomorphine with high sensitivity and good accuracy. Attached Figure Description

[0025] Figure 1 This is a standard curve diagram of dimethomorpholine in one embodiment of the present invention;

[0026] Figure 2 The results of the colloidal gold test strip in one embodiment of the present invention are shown.

[0027] Preservation Information

[0028] The hybridoma cell line XXML-2G11A7, with accession number CGMCC NO: 46139, was deposited on November 21, 2024, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0032] Example 1

[0033] This implementation provides dimethomorpholine hapten, dimethomorpholine complete antigen and their preparation methods.

[0034] 1. Dimethomorpholine hapten A

[0035] The structure is as follows:

[0036]

[0037] 2. Dimethomorph hapten B

[0038] The structure is as follows:

[0039]

[0040] The preparation method includes: weighing dimethomorpholine hapten A (0.0225 mmol), N-hydroxysuccinimide (NHS, 0.045 mmol) and dicyclohexylcarbodiimide (DCC, 0.045 mmol), dissolving them separately in 0.5 mL of anhydrous N,N-dimethylformamide (DMF), mixing them, stirring at room temperature for 4 h, and then centrifuging the reaction solution at 10000 rpm for 10 min. The supernatant obtained is the reaction product containing dimethomorpholine hapten B. This reaction product can be directly used for subsequent conjugation of carrier proteins.

[0041] 3. Dimethomorpholine complete antigen C1

[0042] The structure is as follows:

[0043]

[0044] Preparation methods include:

[0045] Weigh 20 mg of ovalbumin (OVA) and dissolve it in 5 mL of 0.01 M PBS with a pH of 7.4. Slowly add 300 μL of dimethomorph hapten B to the OVA solution (the ratio of dimethomorph hapten B to OVA is 30:1). After reacting at room temperature for 4 h, dialyze the resulting reaction solution with 0.01 M PBS with a pH of 7.4 to remove unreacted raw materials or byproducts, and obtain dimethomorph complete antigen C1.

[0046] 4. Dimethomorph complete antigen C2

[0047] The structure is as follows:

[0048]

[0049] Preparation methods include:

[0050] Weigh 20 mg of bovine serum albumin (BSA) and dissolve it in 5 mL of 0.01 M PBS with a pH of 7.4. Slowly add 200 μL of dimethomorph hapten B to the BSA solution (the ratio of dimethomorph hapten B to BSA is 30:1). After reacting at room temperature for 4 h, dialyze the resulting reaction solution with 0.01 M PBS with a pH of 7.4 to remove unreacted raw materials or byproducts, and obtain dimethomorph complete antigen C2.

[0051] Example 2

[0052] This embodiment provides a hybridoma cell line XXML-2G11A7 and its preparation method.

[0053] The steps include:

[0054] (1) Six BALB / C female mice aged 6-8 weeks were selected as experimental animals.

[0055] (2) Basic immunization: Mix 1 mL of dimethomorph complete antigen C2 solution (concentration of 1 mg / mL) with 1 mL of Freund's complete adjuvant, emulsify thoroughly with a magnetic stirrer, and then immunize mice by multiple subcutaneous injections into the peritoneum and back. The immunization dose is 0.1 mg antigen / mouse.

[0056] (3) Booster Immunization: Two weeks after the primary immunization, diluted dimethomorphic complete antigen C2 solution (concentration of 1 mg / mL) was emulsified with an equal volume of Freund's incomplete adjuvant using a magnetic stirrer and then injected into mice via multiple subcutaneous injections in the peritoneum and back. The immunization dose was 0.1 mg antigen per mouse. Booster immunizations were performed every two weeks. Starting from the third booster immunization, blood was collected from the orbital sinus on the 7th day after each immunization, and the antibody titer and inhibitory effect in the serum were detected by indirect competitive ELISA. The coating antigen used in the method was dimethomorphic complete antigen C1.

[0057] (4) Sprint immunization: Select mice with high titer and good inhibition and perform sprint immunization on the 10th day after the 5th booster immunization. 0.1 mg / mL 100 μL is injected intraperitoneally without adjuvant.

[0058] (5) Cell fusion

[0059] Hybridoma fusion was performed on the 3rd day after sprint immunization. Spleen cells from mice were fused with sp2 / 0 myeloma cells using the polyethylene glycol method. After one week of selective culture in 2% HAT medium, cell wells with high titers and good inhibition were screened using the indirect competitive ELISA method. Subcloning was then performed through limiting dilution to finally obtain the hybridoma cell line XXML-2G11A7.

[0060] Example 3

[0061] This embodiment provides the preparation and purification of dimethomorpholine monoclonal antibodies.

[0062] The procedure included: taking 6 female BALB / c mice aged 10-12 weeks and injecting them intraperitoneally with sterile paraffin oil, 0.3 mL / mouse; one week later, each mouse was intraperitoneally injected with the hybridoma cell line XXML-2G11A7, with approximately 10 cells injected per mouse. 6 Once the mice's abdomens swelled, ascites fluid was collected and purified using the saturated ammonium sulfate method before being stored at -20°C.

[0063] Example 4

[0064] Antibody titer, sensitivity and specificity detection.

[0065] The required buffer solution is prepared as follows:

[0066] (1) Coating buffer (pH 9.6 0.05M carbonate buffer): Na2CO3 1.5g; NaHCO3 2.94g, add pure water to make up to 1000mL;

[0067] (2) Phosphate-buffered saline (PBS) (pH 7.4 0.01M): KH2PO4 0.2g; NaCl 8g; NaH2PO4·12H2O 2.92g, add pure water to 1000mL;

[0068] (3) Washing buffer (PBST): Add 1 mL of Tween-20 to 1000 mL of prepared PBS solution;

[0069] (4) Sample dilution buffer (PBSTG): Add 1 mL Tween-20 and 1 g gelatin (melted by microwave heating) to the prepared PBS, and bring the volume up to 1000 mL;

[0070] (5) Substrate buffer (pH 5.5): Na2HPO4·12H2O 9.22g; citric acid monohydrate 2.55g; Tween-20 0.5mL, add pure water to 1000mL;

[0071] (6) Termination solution (2M H2SO4): 445.6mL of distilled water, add 54.4mL of concentrated sulfuric acid (98%) dropwise while stirring.

[0072] 1. Checkerboard test for antigen and antibody

[0073] 1) Wrapped in blankets:

[0074] Dimethomorphine complete antigen C1 (1 mg / mL) was serially diluted with coating buffer at concentrations of 1:500, 1:1000, 1:2000, and 1:4000 to obtain coating antigen solutions of different concentrations. 100 μL of the coating antigen solution was added to each well of a 96-well microplate and incubated overnight at 4°C. The plate was then washed three times with PBST.

[0075] 2) Competition:

[0076] Dilute the purchased 1 mg / mL dimethomorph standard from Tanmo Quality Inspection to 200 ng / mL using PBST. Add 50 μL of sample diluent to each zero well and 50 μL of the diluted 200 ng / mL dimethomorph standard solution to each inhibition well.

[0077] Dimethomorph antibody was serially diluted with PBST at 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, and 1:32000 to obtain dimethomorph antiserum dilution (50 μL / well). The solution was placed in a humidified chamber at 37°C for 30 min and washed 3 times.

[0078] 3) Add enzyme-labeled secondary antibody: Dilute goat anti-mouse enzyme-labeled secondary antibody (IgG-HRP, Jackson) 10,000 times with PBST, add 100 μL to each well, place in a humidified chamber at 37°C for 30 min, and wash the plate 3 times.

[0079] 4) Color development: The color development solution should be prepared fresh for use. Mix the prepared TMB solution with hydrogen peroxide in the specified ratio, add 100 μL to each well, and develop the color at room temperature in the dark for 10 min.

[0080] 5) Termination: Add 50 μL of 2M H2SO4 to each well and measure the OD value of each well at 450 nm using a microplate reader.

[0081] The formula for calculating the inhibition rate is: Inhibition rate = (B0-B) / B0×100%), where B0 is the OD value of the control well and B is the OD value of the inhibition well.

[0082] The results are shown in Table 1;

[0083] Table 1

[0084]

[0085]

[0086] Note: I represents the inhibition well in the ELISA plate, and C represents the control well in the ELISA plate.

[0087] The results in Table 1 show that when the coating antigen dilution is 1:4000 and the antibody dilution is 1:8000, the inhibition effect on dimethomorph is good, with an inhibition rate of 94.8%. This indicates that the antibody produced by the hybridoma cell line XXML-2G11A7 of the present invention can detect dimethomorph.

[0088] 2. Establishment of the standard curve for dimethomorph

[0089] The dimethomorph standard solution was diluted with sample diluent to the following concentrations: 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.12 ng / mL, 1.56 ng / mL, 0.78 ng / mL and 0.39 ng / mL.

[0090] (1) Coating of antigen: Dimethomorph complete antigen C1 was diluted at 1:4000 and added to the microplate, 100 μL per well, and placed in a humidified chamber at 4°C overnight; the solution in the microplate was poured off, the plate was washed 3 times with washing buffer, and then dried.

[0091] (2) Add 50 μL of the above-mentioned dimethomorph standard solutions (experimental wells) of different concentrations to each well, and add 50 μL of sample diluent to the control wells without adding dimethomorph standard solution.

[0092] (3) Add 50 μL of dimethomorph antibody dilution buffer (1:8000) to the experimental wells and control wells respectively, and incubate at 37°C for 30 min; pour off the solution in the microplate, wash the plate 3 times with washing buffer, and spin dry.

[0093] (4) Add 100 μL of IgG-HRP secondary antibody diluted 1:10000 to the experimental wells and control wells respectively, and incubate at 37℃ for 30 min; pour off the solution in the microplate, wash the plate 3 times with washing buffer, and spin dry;

[0094] (5) Add 100 μL of the prepared substrate buffer to each of the experimental and control wells, incubate at 37°C for 10 min, and then add 50 μL of 2.0 M sulfuric acid solution to each well to terminate the reaction.

[0095] (6) Measure the absorbance at 450 nm;

[0096] (7) Plotting the standard curve: Using dimethomorph standard solutions of different concentrations (ng / mL) as the X-axis and the ratio of absorbance values ​​(B / B0, where B is the average absorbance value of the dimethomorph standard solution and B0 is the average absorbance value of the control wells) as the Y-axis, a standard curve was plotted. The experiment was repeated three times, and the average value of the three experimental results was taken. The results are shown in Table 2, and the obtained standard curve is shown in Table 2. Figure 1 As shown.

[0097] Table 2

[0098]

[0099] The results showed that its sensitivity (IC50) was 2.47 ng / mL, and the detection range was 0.72 ng / mL–8.53 ng / mL. This indicates that the antibody obtained by immunizing mice with the dimethomorph complete antigen C2 has excellent detection performance and high sensitivity.

[0100] 3. Antibody specificity detection

[0101] Purchase standard samples of flumorpholine, pyrimethanil, thiabendazole, imazalil, difenoconazole, butylmorpholine, and metalaxyl from Tanmo Quality Inspection, and dilute the above seven analogues to the following concentrations using sample diluent: 3200 ng / mL, 1600 ng / mL, 800 ng / mL, 400 ng / mL, 200 ng / mL, 100 ng / mL, and 50 ng / mL.

[0102] Establish a standard curve and determine the IC50 (the concentration of the standard sample at which the inhibition rate reaches 50%). The method for establishing the standard curve is the same as that for establishing the dimethomorph standard curve described above.

[0103] Cross-reactivity rate (%) = (dimethomorpholine IC50) / (analyte IC50) × 100%.

[0104] The results are shown in Table 3;

[0105] Table 3

[0106]

[0107]

[0108] 4. Application of colloidal gold test strips

[0109] 1) Preparation of gold-labeled antibody pads: Take 1 mL of colloidal gold solution (30 nm) into a 2 mL centrifuge tube (rinse with pure water), add 3 μL of 0.2 M K2CO3 solution, then add 5 μL of 1 mg / mL antibody, and rotate in a 4D gyroscope for 20 min. Add 50 μL of 3% BSA blocking solution and rotate in a 4D gyroscope for 10 min. Then centrifuge the mixture at 10000 r / min for 10 min (4℃) using a high-speed refrigerated centrifuge. Discard the supernatant, add 0.4 mL of reconstitution solution (0.01 M PBS containing 3% sucrose) to the precipitate, spread the solution onto a 1 cm × 15 cm sample pad, and dry in a 37℃ oven (1.5 h).

[0110] 2) NC membrane streaking concentration: T line concentration is 1.0 mg / mL, C line concentration is 1.0 mg / mL.

[0111] 3) Results:

[0112] Extraction solvent ck: T / C = 779 / 159 = 4.899

[0113] 20ppb standard (sensitivity): T / C = 20⁵ / 20² = 1.015

[0114] 4) Test the ck, 1 / 2 MRL, and MRL of the substrates for cowpea, loofah, tomato, and eggplant.

[0115] Samples of cowpeas, loofah, tomatoes, and eggplants were collected from the supermarket and spiked for testing according to the maximum residue limits in GB2763-2021. The test results are shown in Table 4. Figure 2 As shown;

[0116] Table 4

[0117] matrix Method detection limit (mg / kg) ck 1 / 2MRL MRL cowpea 0.15 550 / 172＝3.198 290 / 250＝1.160 162 / 257＝0.630 loofah 0.5 566 / 163＝3.472 280 / 263＝1.065 135 / 196＝0.689 tomato 1 697 / 236＝2.953 262 / 204＝1.284 161 / 302＝0.533 eggplant 2 407 / 129＝3.155 183 / 200＝1.307 105 / 176＝0.597

[0118] 1 / 2 MRL was considered suspicious or negative, and MRL was positive, all meeting the testing requirements. This indicates that the method has good accuracy and can be used for the detection of dimethomorph in real samples, including loofah, tomato, and eggplant samples.

[0119] In summary, the antibody secreted by the hybridoma cell line XXML-2G11A7 of the present invention can specifically detect dimethomorphine with high sensitivity and good accuracy.

[0120] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. A hybridoma cell line XXML-2G11A7, characterized in that, The deposit number is CGMCC NO: 46139, the deposit date is November 21, 2024, the deposit unit is China General Microbiological Culture Collection Center, and the deposit unit address is No. 1, Xiliujia, Yuhuatai District, Nanjing, China.

2. The hybridoma cell line XXML-2G11A7 according to claim 1, characterized in that, The VH coding sequence of the antibody produced by XXML-2G11A7 is shown as SEQ ID NO: 1, and the VL coding sequence of the antibody produced by XXML-2G11A7 is shown as SEQ ID NO:

2.

3. A monoclonal antibody to an enaminocarbonyl, characterized in that, Obtained by secretion from the hybridoma cell strain XXML-2G11A7 according to any one of claims 1-2.

4. The use of the hybridoma cell strain XXML-2G11A7 according to any one of claims 1-2 or the oxymorpholine monoclonal antibody according to claim 3 in the detection of oxymorpholine.

Images