An expression vector of Noggin protein and its application
Through codon optimization and stable expression technology, the problem of unstable Noggin protein expression was solved, and efficient mass production and low-cost supply of Noggin protein were achieved to support the needs of various organoid cultures.
Patent Information
- Application Number
- CN202510215567.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-26
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2045-02-26
AI Technical Summary
Existing technologies make it difficult to achieve efficient, stable expression and mass production of Noggin protein, resulting in large differences between batches of factors in organoid culture, affecting the stability and reliability of experimental results.
The Noggin nucleic acid sequence was designed through codon optimization, the recombinant plasmid Noggin-pCDNA3.1 was constructed, and a stable expression cell line was established in 293 cells. The purification process was optimized to achieve efficient expression and mass production of Noggin protein.
It improves the expression and stability of Noggin protein, reduces batch-to-batch differences, provides high-quality cytokine support for organoid culture, is suitable for the culture of multiple organs, and reduces production costs.
Smart Images

Figure CN119736306B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the biological field, and particularly relates to an expression vector of Noggin protein and application thereof. Background Art
[0002] Noggin is a secreted homodimeric glycoprotein. Secreted Noggin is located close to the cell surface due to its association with heparin-containing proteoglycans and acts as an antagonist of bone morphogenetic proteins (BMPs). It is highly conserved among vertebrates, and mature human Noggin shares high homology with species such as mouse, rat, cattle, horse, and chicken. The human gene is located on chromosome 17q22, and on chromosome 11 in rat and mouse. Noggin was first discovered in 1992 during studies of African clawed frog embryonic development. The encoded polypeptide, which was named Noggin, was shown to influence head development in the frog. Subsequent studies of the dorsal region and notochord of the frog revealed high expression of Noggin, suggesting a role for dorsal development. Later, Noggin was also significantly expressed in the development of the mammalian nervous system. In-depth research found that Noggin can specifically bind to and inhibit BMPs, playing an important role in early embryonic development, limb formation and nervous system development. At the same time, it antagonizes BMPs and affects the normal development of the body's bones, cartilage and joints.
[0003] Due to the combined action of multiple signaling pathways, stem cells differentiate in multiple directions to maintain body homeostasis and fulfill their stem cell functions. Common signaling pathways regulated by Noggin include the Wnt, BMP, and Shh pathways. The Noggin gene exerts a feedback inhibitory mechanism on the BMP signaling pathway and a feedback activation mechanism on the Wnt signaling pathway. The BMP signaling pathway inhibitor, Noggin, mediates the suppression of BMP expression, leading to Shh signaling.
[0004] Noggin is a secreted protein that binds to ligands of the TGF-α family and regulates their activity by inhibiting their access to signaling receptors. As the knowledge of BMPs and their respective tissue targets deepens, so does our understanding of Noggin's function. Noggin was originally identified as a BMP-4 antagonist, playing a crucial role in the proper formation of the head and other dorsal structures. Consequently, Noggin has a high affinity for certain BMPs, such as BMP-4, but a lower affinity for BMP-7. It also exhibits strong associations with BMP-2, BMP-13, and BMP-14. During skeletal development, Noggin inhibits chondrocyte proliferation, thereby regulating normal joint formation. When human embryonic stem cells (hESCs) or neural stem cells are cultured under certain conditions in the adult central nervous system and peripheral tissues (such as the lung), the addition of Noggin to antagonize BMP activity allows the stem cells to proliferate while remaining undifferentiated or to differentiate into dopaminergic neurons. In Noggin-deficient mice, enhanced BMP activity causes a series of developmental abnormalities, including failure of neural tube formation, delayed hair follicle development, axial skeletal deformities and joint lesions.
[0005] The classic cytokine protocol for organoid culture is WNER (which stands for Wnt-3a, Noggin, EGF, and R-Spondins). Combinations of these four factors, including WNER, are applicable to nearly all organoid culture experiments. As a key regulator of Wnt and BMP signaling, Noggin plays a multifaceted role. It serves as a fundamental organoid culture factor in the culture of intestinal, gastric, liver, lung, pancreatic, prostate, breast, and brain organoids. Its high activity, batch-to-batch stability, and lack of contamination are crucial for successful organoid experiments, making high-quality cytokines essential for organoid culture. To assist researchers and pharmaceutical companies in studying the role of Noggin in organoid formation and the clinical application of target proteins in antibody therapeutics, high-activity Noggin protein products are available to facilitate research into Noggin's mechanisms and explore its potential clinical value. Summary of the Invention
[0006] The present invention aims to construct a plasmid containing a strong cell expression promoter, obtain a high-efficiency and stable expression 293 cell line through screening, and optimize the downstream purification process, thereby achieving mass production of Noggin recombinant protein.
[0007] In a first aspect of the present invention, a nucleic acid molecule Noggin is obtained by codon-optimizing the Noggin reference sequence SEQ ID NO: 1 provided by NCBI according to the 293 host to obtain a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 5.
[0008] A second aspect of the present invention discloses a method for constructing a recombinant plasmid Noggin-pCDNA3.1, comprising synthesizing a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 5 and inserting the nucleic acid molecule into expression plasmid V02 to obtain plasmid V02-Noggin-V3. The plasmid V02-Noggin-V3 and pCDNA3.1 are then simultaneously digested with HindIII / EcoRI, run on a gel, and the corresponding target fragments are recovered. The fragments are then ligated to obtain the recombinant plasmid Noggin-pCDNA3.1.
[0009] The third aspect of the present invention discloses a cell line expressing Noggin protein. The cell line is constructed by linearizing the recombinant plasmid Noggin-pCDNA3.1 with PvuI and then transfecting the 293 cells to obtain a cell line expressing Noggin protein.
[0010] Preferably, the obtained positive cell population is inoculated into a multi-well plate, and multiple passages are performed when the cell confluence reaches 80-90%. The supernatant is taken for protein quantitative detection to screen for cell lines that highly express Noggin protein.
[0011] Preferably, the obtained cell line Expi293-Noggin47-P6 OPM-RD2104 has a registration number of CGMCC NO.46023 in the General Microbiology Center of China Culture Collection Administration.
[0012] The fourth aspect of the present invention discloses a method for culturing the above-mentioned cell line, the specific method is as follows:
[0013] S1: Resuscitate the cells in culture medium and culture them for at least three passages before inoculation;
[0014] S2: After passage, the cells were diluted and transfected with the recombinant plasmid Noggin-pCDNA3.1;
[0015] S3: After transfection, centrifuge and change the medium every 3-5 days, and then transfer and culture. Fed-Batch and freeze;
[0016] S4: The cells frozen in S3 were revived and passaged until the viability was greater than 90%. Monoclonal clones were plated and the expression level of the cell supernatant was detected.
[0017] S5: Screening cell lines with high expression levels for suspension acclimation culture to obtain cell lines expressing Noggin protein.
[0018] Preferably, the culture conditions in S1 and S2 are 120 rpm, 37°C, 8% CO2, and 80% humidity in a shaking incubator.
[0019] Preferably, the Noggin-pCDNA3.1 plasmid in S22 is filtered through a 0.22 μm membrane and then added to OPM-293 CD05, and mixed and incubated with PEI diluted with OPM-293 CD05.
[0020] Preferably, the sugar content in the culture process of S4 is controlled at 2-8 g / L, and the cell viability is about 60% when the sample is collected by centrifugation, and the expression level in the supernatant is detected using ForteBio.
[0021] The fifth aspect of the present invention discloses the use of the aforementioned nucleic acid molecule, recombinant plasmid Noggin-pCDNA3.1 or the aforementioned cell line in producing a recombinant protein, wherein the recombinant protein is specifically Noggin protein.
[0022] The 293 stably expressed cell line obtained by the technical solution of the present invention can be grown in suspension culture in serum-free culture medium to express and produce cytokines. The volume can be expanded to 2L, 10L, or even 300L, breaking the small limitation of the well plate culture system, reducing the batch-to-batch variation of factor expression, and providing a basis for large-scale expression.
[0023] The 293 stably expressing cell line obtained using the technical solution of the present invention offers the following advantages over its transient expression counterpart: 1. It eliminates the need for large-scale plasmid preparation, reducing labor and material costs. 2. It significantly increases expression levels compared to transient expression. 3. The validation of purification methods and lyophilization processes provides a foundation for large-scale commercial production and shipping of finished products.
[0024] Deposit certificate: The cell line Expi293-Noggin47-P6 OPM-RD2104 belongs to human embryonic kidney cells. It was received and registered by the General Microbiology Center of the China Culture Collection Administration (CGMCC) on July 29, 2024. The registration number of the collection center is CGMCC No.46023. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is a graph showing the expression level detection results of different codon sequences in Example 3.
[0026] Figure 2 This is a graph showing the viability of Expi293 cells pressurized with different concentrations of G418 in Example 5.
[0027] Figure 3 This is a graph showing the protein concentration of the cell supernatant during plasmid transfection.
[0028] Figure 4 and Figure 5 This is a graph showing the protein concentration of cell supernatant during monoclonal plating.
[0029] Figure 6 The Noggin expression diagram of different cell lines in WB detection.
[0030] Figure 7 Detection diagram of Noggin expression in the cell lines screened by the present invention.
[0031] Figure 8 This is the chromatogram in Example 7.
[0032] Figure 9 This is a graph showing the protein activity detection of the expression products of different expression systems in Example 8. DETAILED DESCRIPTION
[0033] The present invention is further illustrated by way of examples below, but the invention is not limited to the scope of the examples described. The experimental methods in the following examples, unless otherwise specified, are conventional methods and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0034] Example 1 Designing Proteins
[0035] The Noggin sequence is a 205aa protein with a signal peptide added to the N-terminus to promote secretory expression. A six-histidine his tag is added after the signal peptide to facilitate purification. An enterokinase cleavage site is inserted between the his tag and the protein to facilitate tag removal when needed. The specific sequence is as follows:
[0036] hhhhhhDDDDK
[0037] qhy lhirpapsdn lplvdliehp dpifdpkekd lnetllrsll gghydpgfma tsppedrpgggggaaggaed laeldqllrq rpsgampsei kglefsegla qgkkqrlskk lrrklqmwlw sqtfcpvlyawndlgsrfwp ryvkvgscfs krscsvpegm vckpsksvhl tvlrwrcqrr ggqrcgwipi qypiiseckcsc (SEQ ID NO: 1);
[0038] The codon optimization of Noggin amino acid sequence was performed as follows:
[0039] Noggin-V0
[0040] cagcactatctccacatccgcccggcacccagcgacaacctgcccctggtggacctcatcgaacacccagaccctatctttgaccccaaggaaaaggatctgaacgagacgctgctgcgctcgctgctcgggggccactacgacccaggcttcatggccacctcgccccccgaggaccggcccggcgggggcgggggtgcagctgggggcgcggaggacctggcggagctggaccagctgctgcggcagcggccgtcgggggccatgccgagcgagatcaaagggctagagttctccgagggcttggcccagggcaagaagcagcgcctaagcaagaagctgcggaggaagttacagatgtggctgtggtcgcagacattctgccccgtgctgtacgcgtggaacgacctgggcagccgcttttggccgcgctacgtgaaggtgggcagctgcttcagtaagcgctcgtgctccgtgcccgagggcatggtgtgcaagccgtccaagtccgtgcacctcacggtgctgcggtggcgctgtcagcggcgcgggggccagcgctgcggctggattcccatccagtaccccatcatttccgagtgcaagtgctcgtgc (SEQ ID NO:2)
[0041] Noggin-V1
[0042] cagcactatctccacatccgcccggcgcccagcgacaacctgcccctggtggacctcatcgaacacccagaccctatctttgaccccaaggagaaggatctgaacgagacgctgctgcgctcgctgctcgggggccactacgacccgggcttcatggccacctcgccccccgaggaccggcccggcgggggcgggggtgcggctgggggcgcggaggacctggcggagctggaccagctgctgcggcagcggccgtcgggggccatgccgagtgagatcaaagggctagagttctccgagggcttggcccagggcaagaagcagcgcctgagcaagaagctgcggaggaagttacagatgtggctgtggtcgcagacgttctgccccgtgctgtacgcgtggaacgacctgggcagccgcttttggccgcgctacgtgaaggtgggcagctgcttcagtaagcgctcgtgctccgtgcccgagggcatggtgtgcaagccgtccaagtccgtgcacctcacggtgctgcggtggcgctgtcagcggcgcgggggccagcgctgcggctggattcccatccagtaccccatcatttccgagtgcaagtgctcgtgc (SEQ ID NO:3)
[0043] Noggin-V2
[0044] Cagcactatctccacatccgcccggcgcccagcgacaacctgcccctggtggacctcatcgaacacccagaccctatctttgaccccaaggagaaggatctgaacgagacgctgctgcgctcgctgctcgggggccactacgacccgggcttcatggccacctcgccccccgaggaccggcccggcgggggcgggggtgcggctgggggtgcggaggacctggcggagctggaccagctgctgcggcagcggccgtcgggggccatgccgagcgagatcaaagggctggagttctccgagggcttggcccagggcaagaagcagcgcctgagcaagaagctgcggaggaagttacagatgtggctgtggtcgcagaccttctgccccgtgctgtacgcgtggaacgacctgggctcacgcttttggccgcgctacgtgaaggtgggcagctgcttcagtaagcgctcgtgctccgtgcccgagggcatggtgtgcaagccgtccaagtccgtgcacctcacggtgctgcggtggcgctgtcagcggcgcgggggccagcgctgcggctggattcccatccagtaccccatcatttccgagtgcaagtgctcctgc (SEQ ID NO:4)
[0045] Noggin-V3
[0046] CAGCACTACCTGCACATCAGACCCGCCCCTAGCGACAACCTGCCCCTGGTGGACCTGATCGAGCACCCCGACCCCATCTTCGACCCCAAGGAGAAGGACCTGAACGAGACCCTGCTGAGATCCCTGCTGGGCGGCCACTATGACCCCGGCTTT ATGGCCACCTCCCCTCCCGAGGACAGACCTGGCGGGGGCGGCGGGGCCGCTGGGGGCGCCGAGGACCTGGCCGAGCTGGATCAGCTGCTGAGACAGAGACCTAGCGGCGCCATGCCTAGCGAGATCAAGGGCCTGGAGTTCAGCGAGGGCCTGG CCCAAGGCAAGAAGCAGAGACTGAGCAAGAAGCTGAGAAGAAAGCTGCAGATGTGGCTGTGGAGCCAAACCTTCTGCCCCGTGCTGTACGCCTGGAACGACCTGGGCAGCAGATTCTGGCCTAGATACGTGAAGGTGGGCAGCTGCTTCAGCAA GAGAAGCTGCAGCGTGCCCGAGGGCATGGTGTGCAAGCCTAGCAAGAGCGTGCACCTGACCGTGCTGAGATGGAGATGTCAGAGAAGAGGCGGGCAGAGATGCGGCTGGATCCCCATTCAGTACCCCATCATCAGCGAGTGCAAGTGCAGCTGC (SEQ ID NO: 5)
[0047] The above DNA sequences were synthesized by a synthesis company and inserted into expression plasmid V02 respectively to obtain plasmids V02-Noggin-V0, V02-Noggin-V1, V02-Noggin-V2, and V02-Noggin-V3. The expression levels were detected by transient transfection of 293 cells to determine the effect of codon optimization.
[0048] Example 2 Transient expression of foreign proteins in the 293 system
[0049] To transiently express foreign proteins in the 293 system, the specific steps are as follows:
[0050] The culture medium was OPM-293 CD05 Medium, stored in a refrigerator at 4°C and preheated in a 37°C water bath before use.
[0051] Cell Preparation: Resuscitate Expi293 cells into OPM-293 CD05 medium and culture in 30 mL of culture medium in a 125 mL shake flask at 120 rpm, 37°C, 8% CO2, and 80% humidity. After three or more passages, inoculate. After thawing, dilute the cells to a density of 0.4–0.7 × 106 cells / mL and culture in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity.
[0052] Cell transfection expression:
[0053] Cell transfection Day 0
[0054] The cell transfection density should be between 3-5×10 6 Cells were transfected at 400 μg / mL. Samples were collected for VCD and VIA analysis. If the cell density was too high, the cells were diluted to an appropriate density using CD05. For cell transfection, 0.03 mg of plasmid was filtered through a 0.22 μm filter and added to 1.5 mL of CD05 to prepare a plasmid dilution solution. 0.09 mg of PEI was added to 1.5 mL of CD05 to prepare a PEI dilution solution. The PEI dilution solution was added to the plasmid dilution solution, mixed, and allowed to stand at room temperature for 20 minutes. 3 mL of the DNA-PEI mixture was added to 30 mL of Expi293 cells, mixed thoroughly, and incubated in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity.
[0055] Protein expression Day 1-Day 7
[0056] 18-24 hours after transfection, add 5% of the initial volume of OPM-293 ProFeed and culture in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. Samples were taken regularly 2-5 days after transfection to record cell density and viability, and the glucose concentration in the culture medium was measured to maintain a constant glucose content of 2-8 g / L. Seven days after transfection, the cells were harvested by centrifugation, filtered, and aliquoted for storage at -80°C for subsequent experiments.
[0057] Example 3 Expression level detection:
[0058] Fortiebio
[0059] The experiment used the OctetRED96e (Sartorius) based on Bio-Layer Interferometry (BLI) technology for sample quantification. The experiment used 0.05% PBST as the dilution buffer. Before the experiment began, the HIS2 sensor was placed in the buffer to pre-wet for at least 10 minutes. V02-Noggin-V0, V02-Noggin-V1, V02-Noggin-V2, V02-Noggin-V3, and expression supernatant were added to the sample plate. After the experiment began, the sensor was combined with the sample for 180 seconds, and the signal value at the binding endpoint was compared. The detection results are shown in Figure 2. Figure 1 The higher the signal value, the higher the expression level, and this is used to roughly rank the expression levels of the four samples.
[0060] Detection results: The expression levels of V02-Noggin-V3>V02-Noggin-V0>V02-Noggin-V1>V02-Noggin-V2; and the codon sequence of V02-RSPO1-V3 is about twice that of other sequences.
[0061] Example 4 Construction of Noggin protein expression vector used in stable cell line construction
[0062] Based on the results of the codon optimization screening, the final optimized DNA sequence Noggin-V3 was ligated into the vector pcDNA3.1. The specific sequence is shown in SEQ ID NO: 5.
[0063] Example 5 Construction of a 293 cell line stably expressing Noggin protein.
[0064] Determine the optimal screening concentration of G418:
[0065] Experimental steps:
[0066] Expi293 cells were stressed with G418 (Gibco) at concentrations of 0, 100, 200, 400, and 800 μg / mL. The culture medium was OPM-293 CD05 Medium. The cells were centrifuged and the medium was changed every 3-5 days. Samples were taken and counted regularly. The working concentration was the G418 concentration that caused complete cell death within 7-10 days.
[0067] The experimental results are as follows Figure 2 As shown in the results, 200 and 400 ug / mL of G418 had good killing effect on Expi293 cells and could kill all Expi293 cells within 7-11 days. Therefore, 200 and 400 ug / mL of G418 were selected as the working concentrations.
[0068] 2. Preparation of recombinant pcDNA3.1:
[0069] The recombinant plasmid Noggin-pCDNA3.1 was confirmed to be correct by sequencing and then transformed into Escherichia coli for plasmid extraction. Finally, the recombinant plasmid Noggin-pCDNA3.1 was linearized with PvuI (NEB) and used for 293 cell transfection.
[0070] 3. Transfection of 293 cells with recombinant pcDNA3.1 and screening:
[0071] 3.1 Plasmid transfection
[0072] The linearized Noggin-pCDNA3.1 was transfected into Expi293 cells using PEI (Biohub). The cell density should be 3-5 × 10 6 Cells were transfected with the DNA-PEI mixture at a concentration of 100 μg / mL (100 μg / mL) and viability greater than 95%. The DNA-PEI mixture was added to Expi 293 cells, mixed thoroughly, and cultured in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. The day after transfection, 400 μg / mL or 200 μg / mL G418 was added for selection. Cell density and viability were recorded regularly from 1 to 26 days after transfection. The medium was centrifuged and replaced every 3-5 days, and the cells were then cultured in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. After viability and density were restored, the cells were expanded and fed-batch or frozen.
[0073] 3.2 Pool Fed-Batch Sample Preparation:
[0074] Cells were inoculated at 1E6 / mL in a total volume of 10mL. When the cell density reached 4-6E6 / mL, 5% OPM-293ProFeed was added. The sugar content was controlled at 2-8g / L during the entire culture process. When the cell viability reached about 60%, the samples were collected by centrifugation and the expression level in the supernatant was detected using ForteBio. Figure 3 As shown, the results showed that the expression level of Noggin was: 200ug / mL G418 pressurized sample (B1: Noggin-D7-200ug / mL G418) > transiently transfected sample (A1: Noggin-D7 transiently transfected sample) > 400ug / mL G418 pressurized sample (C1: Noggin-D7-400ug / mL G418).
[0075] 4. Monoclonal screening:
[0076] Based on the test results, cells were revived after transfection and pressurized with 200ug / mL and 400ug / mL G418, respectively. After passage until the viability exceeded 93%, single clones were plated at 0.5 cells / well using the limiting dilution method. Microscopic observation was performed on days 1, 4, 7, and 10 after plating, and wells with polyclonal clones were excluded, leaving only the wells with single clones for labeling. On day 20, single clones were selected and expanded into 24-well plates and then 6-well plates. Finally, the supernatant from the 6-well plate was collected for ForteBio analysis.
[0077] According to the ForteBio results, clones N2 / 14 / 28 / 31 / 39 / 44 / 47 / 3 / 12 / 23 / 26 with high expression levels were screened and transferred into shake tubes for suspension acclimation. After Fed-Batch, the expression levels were detected by ForteBio. Figure 4 and Figure 5 shown
[0078] Fed-Batch sample preparation for monoclonal cultures was as follows: cells were inoculated at 1E6 / mL in a total volume of 10 mL. When the cell density reached 4-6E6 / mL, 5% OPM-293 ProFeed was added. The glucose level was controlled at 2-8 g / L throughout the culture process. The cell viability was approximately 60%, and samples were collected by centrifugation on the 7th day.
[0079] Based on the ForteBio results and the cell growth of Fed-Batch, clones N3 / 14 / 26 / 31 / 39 / 47 with high expression levels were screened for WB detection of relative expression and protein location.
[0080] 5. Western blot detection of Noggin expression
[0081] Take 40 μL of cell supernatant and add 10 μL of 5× Sample Buffer, mix well, and heat at 95°C for 10 minutes. After mounting the precast gel plate in the electrophoresis apparatus, add MOPS Running Buffer and sequentially load 10 μL of protein marker and an appropriate amount of protein sample. Perform SDS-PAGE at 130 V for approximately 60-70 minutes until the protein marker runs to the bottom of the separation gel. Prepare for transfer to the membrane (pre-chill the transfer buffer at 4°C).
[0082] Transfer the protein to a PVDF (Millipore) membrane at a constant current of 400 mA for 70 minutes. After transfer, immerse the PVDF membrane in rapid blocking buffer and incubate at room temperature for 15-25 minutes. Dilute the primary antibody (Rabbit monoclonal [H169-1-5] Anti-His IgG Fc, Abcam) in rapid blocking buffer at a 1:25,000 concentration. Cut the membrane to the size of the target protein based on the position of the protein marker and place it in the diluted primary antibody. Incubate at 37°C for 1.5 hours. Rinse with TBST three times for 10 minutes each. Dilute the secondary antibody (goat anti-rabbit IgG H&L-HRP) in rapid blocking buffer at a 1:20,000 concentration. Place the PVDF membrane in the secondary antibody dilution and incubate at 37°C for 1.5 hours. Rinse with TBST three times for 10 minutes each. Mix the Enhancer Buffer Solution and Peroxide Buffer from the ECL kit in a 1:1 ratio. The PVDF membrane was fully soaked in the mixed solution and exposed in a fully automatic luminescence imaging system.
[0083] Noggin molecule FedBatch supernatant WB detection results are as follows Figure 6 As shown; combined with the results of Fortie and WB expression detection, the cell line with better Noggin expression is N47.
[0084] 6. Target gene detection
[0085] Combined with the cell growth and expression results, N47 was finally selected as the main clone, and the cell line was named Expi293-Noggin47-P6 OPM-RD2104 for target gene detection.
[0086] Experimental steps:
[0087] The Tiangen DNA Extraction Kit (DP304-02) was used to extract the genome after passage, and primers were designed to amplify the inserted sequence. The PCR product was run on a gel, excised, recovered, and sequenced.
[0088] The PCR amplification primer sequences are as follows:
[0089] pCDNA-F 5'- AATGGCGGTAGGCGTGTAC -3' (SEQ ID NO: 6) pCDNA-R 5'- AGGAAGGCACGGGGGAGGGG -3' (SEQ ID NO: 7)
[0090] The sequencing primer sequences are as follows:
[0091] pCDNA-F 5'- AATGGCGGTAGGCGTGTAC -3' (SEQ ID NO: 6) pCDNA-R 5'- AGGAAGGCACGGGGGAGGGG -3' (SEQ ID NO: 7)
[0092] The PCR amplification primer sequences used in the present invention are consistent with the sequencing sequences.
[0093] Experimental results:
[0094] The comparison results are as follows Figure 7 The results showed that it was consistent with the reference sequence.
[0095] Example 6 Comparison of transient expression and stable expression
[0096] Transiently express the exogenous protein Noggin in the Expi293 system. The specific steps are as follows:
[0097] The cell transfection density should be between 3-5×10 6 At a concentration of 1 cell / ml, 0.03 mg of plasmid, V02-Noggin-V3, was filtered through a 0.22 μm filter and added to 1.5 mL of CD05 to prepare a plasmid dilution. 0.09 mg of PEI was added to 1.5 mL of CD05 to prepare a PEI dilution. The PEI dilution was added to the plasmid dilution, mixed, and allowed to stand at room temperature for 20 min. 3 mL of the DNA-PEI mixture was added to 30 mL of Expi293 cells, mixed thoroughly, and cultured in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. 24 hours after transfection, 5% of the original volume of 293 ProFeed was added and cultured in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. Cell density and viability were recorded regularly 2-5 days after transfection, and the glucose concentration in the culture medium was measured to maintain a constant glucose content of 2-8 g / L. On the 7th day after transfection, the cell supernatant was harvested by centrifugation, filtered, aliquoted, and stored at -80°C for subsequent experiments.
[0098] The successfully constructed stably transfected 293 cell line was used to express the exogenous protein Noggin. The specific operation was as follows:
[0099] Resuscitate Expi293-Noggin47-P6 OPM-RD2104 cells in OPM-293 CD05 medium and culture 30 mL in a 125 mL shake flask at 120 rpm, 37°C, 8% CO2, and 80% humidity. Once the cell density reaches 3-5 × 106 cells / mL and cell viability exceeds 90%, subculture the cells every three days in OPM-293 CD05 medium at 0.5 × 106 cells / mL until the cell volume reaches 2 L. This day is designated as Day 0. Continue culturing until the cell density reaches 4-6 × 106 cells / mL and cell viability remains above 90%. Add 293 ProFeed at 5% of the initial culture volume and continue in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. During the culture process, samples were taken daily to record cell density and viability. Glucose and lactate concentrations in the cell suspension were measured, and the sugar content was controlled at 2-8 g / L. Sugar was supplemented on days 1 and 4 of culture. On day 7 of culture, when cell viability dropped to 60%, the cell supernatant was harvested by centrifugation and stored at -80°C.
[0100] Example 7: Purification of transient and stable expression supernatants using nickel fillers
[0101] Experimental reagents and consumables:
[0102] Ni-TED FF agarose purification resin was purchased from Jiaxing Qianchun Biotechnology Co., Ltd.; empty chromatography columns were purchased from Shanghai Huxi Analytical Instrument Factory Co., Ltd.; imidazole, sodium chloride, and Tris were purchased from Shanghai Sangon Biotechnology Co., Ltd.; equilibration buffer: 20 mM Tris 500 mM NaCl pH 8.0; elution buffer: 20 mM Tris 500 mM NaCl 500 mM imidazole pH 8.0.
[0103] The 6× His tag at the N-terminus of the Noggin target gene can bind to the Ni 2+ Specific binding.
[0104] Instant sample loading 1.6L 5cm 2 *13cmTED Stable loading 1.6L 10cm 2 *10cmTED
[0105] The experimental steps are as follows: pump 5 CV of affinity chromatography equilibration buffer into the chromatography column that has been washed with pure water to equilibrate the column. After the baseline is stable, load the sample at a flow rate of 5 mL / min, and then pump affinity chromatography equilibration buffer again for 5 CV. Set the linear elution of 0-500mM imidazole concentration for 15CV, and set the elution flow rate to 8 mL / min. Prepare samples of the starting protein solution, flow-through, and linear elution for SDS-PAGE analysis, as shown in Figure 2. Figure 8 After elution, rinse the column with deionized water until the conductivity is less than 1 s / m. Then, pump 2 CV of 1 mol / L NaOH solution to clean the column. Finally, rinse the column with pure water until the pH of the liquid in the column is neutral. Remove the column and store it upright in a refrigerator at 4°C. Protein was quantified using BCA, and the transient yield was calculated to be 3.45 mg / L cell supernatant. The stable yield was 20.33 mg / L cell supernatant.
[0106] Experimental Conclusion: After harvesting the cell supernatant and undergoing a series of purification methods, including affinity capture and chromatography, the target protein, Noggin, was concentrated. The transient expression system yielded 3.45 mg per liter of cell supernatant, while the stable expression system yielded 20.33 mg per liter of cell supernatant. The stable expression system achieved a much higher yield than the transient expression system.
[0107] Example 8 Activity testing of transiently and stably expressed proteins
[0108] Using mouse small intestinal organoids as a model to verify the biological activity of noggin
[0109] 1. Experimental Reagents
[0110] 1. Organoid Culture Medium: Organoid Culture Medium Composition: Advanced DMEM / F12, 10 mM HEPES, 100 μg / mL Primocin, 2 mM GlutaMax, 1 × N2, 1 × B27, 1 mM N-acetylcysteine, 50 ng / mL EGF, 100 ng / mL Noggin, 1 μg / mL R-spondin-1, 10 μM Y-27632.
[0111] When testing Noggin, different concentration gradients were set in the mouse small intestinal organoid culture medium: 100 ng / mL and 200 ng / mL, and a commercial similar product was used as a positive control (factor manufacturer: PeproTech, Noggin product number 250-38).
[0112] 2. Experimental Methods
[0113] 1. Isolate mouse small intestinal crypts. Calculate the volume of the selected fraction, which contains approximately 1500 crypts. Transfer the required volume to three correspondingly labeled 15 mL conical tubes and centrifuge at 300 g and 4°C for 5 minutes. Carefully aspirate and discard the supernatant.
[0114] 2. Matrigel plating and culture test. Add an appropriate amount of matrigel according to the amount of 5-10 crypts / μl (the pipette tip used in this step must be pre-chilled); let the culture plate stand at 37°C for 5 minutes to allow the Matrigel to completely solidify. Invert the plate and place it in the incubator at 37°C for 25 minutes. Then add preheated intestinal organoid culture medium. Add sterile PBS to the remaining wells that have not been inoculated to maintain humidity during culture. Take pictures on Day 3 and Day 6, as shown in the following figure. Figure 9 .
[0115] Conclusion: The biological activity of noggin purified from two different expression systems was tested in the mouse small intestinal organoid model, using imported noggin as a positive control. Based on the morphological observation, size and number analysis of the organoids on the third and sixth days, it can be inferred that noggin purified from the two different expression systems can both support the growth of mouse small intestinal organoids, and there is no significant difference compared with imported noggin.
[0116] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.
Claims
1. A nucleic acid molecule Noggin, characterized in that The codon-optimized nucleotide sequence is shown in SEQ ID NO: 5, and the expressed amino acid sequence is shown in SEQ ID NO:
1.
2. A recombinant plasmid Noggin-pCDNA3.1, characterized in that: The nucleic acid molecule according to claim 1 is ligated to the vector pCDNA3.
1.
3. A cell line expressing Noggin protein, characterized in that: The cell line is constructed by linearizing the recombinant plasmid Noggin-pCDNA3.1 according to claim 2 with PvuI and then transfecting the 293 cells to obtain a cell line expressing Noggin protein.
4. The cell line expressing Noggin protein according to claim 3, wherein Its registration number at the General Microbiology Center of China Culture Collection Administration is CGMCC NO.46023.
5. The method for constructing a cell line expressing Noggin protein according to claim 3, wherein: S1: Resuscitate the cells in culture medium and culture them for at least three passages before inoculation; S2: After the passaged cells are diluted, the cells are transfected with the recombinant plasmid Noggin-pCDNA3.1 according to claim 2; S3: After transfection, the medium is changed by centrifugation every 3-5 days. After the transfer culture is completed, Fed-Batch and cryopreservation are performed; S4: The cells frozen in S3 were revived and passaged until the viability was greater than 90%. Monoclonal clones were plated and the expression level of the cell supernatant was detected. S5: Screening cell lines with high expression levels for suspension acclimation culture to obtain cell lines expressing Noggin protein.
6. The method for constructing a cell line expressing Noggin protein according to claim 5, characterized in that: The culture conditions for S1 and S2 were 120 rpm, 37°C, 8% CO2, and 80% humidity in a shaking incubator.
7. The method for constructing a cell line expressing Noggin protein according to claim 5, characterized in that: The recombinant plasmid Noggin-pCDNA3.1 in S2 was filtered through a 0.22 μm membrane and then introduced into OPM-293 CD05 and incubated with PEI diluted with OPM-293 CD05.
8. The method for constructing a cell line expressing Noggin protein according to claim 5, characterized in that: During the culture process of S4, the sugar content was controlled at 2-8 g / L. When the cell viability was about 60%, the sample was collected by centrifugation and the supernatant was used to detect the expression level using ForteBio.
9. Use of the nucleic acid molecule Noggin according to claim 1, the recombinant plasmid Noggin-pCDNA3.1 according to claim 2, or the cell line according to any one of claims 3 to 4 in producing Noggin protein.
Citation Information
Patent Citations
Barhl2 proteins, genes encoding the same and uses thereof
CA2455659A1
Codon-optimized REP1 gene and application thereof
CN116806158A