Method for constructing RNAi expression vector based on peanut fragrance related betaine aldehyde dehydrogenase gene AhBADH1

Abstract

The invention discloses a method for constructing an RNAi expression vector based on a betaine aldehyde dehydrogenase gene AhBADH1 related to peanut fragrance, and relates to the technical field of plant molecular biology, and the key points of the technical scheme are as follows: extracting RNA of young leaves of peanuts, and obtaining a complete coding sequence of the AhBADH1 gene by utilizing an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification technology; according to a complete coding sequence of an AhBADH1 gene, a specific RNAi target sequence aiming at the gene is designed and synthesized, and the RNAi target sequence is inserted into an RNAi expression vector to form a recombinant RNAi expression vector. According to the present invention, the peanut fragrance related betaine aldehyde dehydrogenase gene AhBADH1 is cloned, and the RNA interference (RNAi) expression vector is constructed based on the gene so as to lay the foundation for the subsequent regulation of the AhBADH1 gene expression in the peanut through the gene silencing technology, influence on the 2-acetyl-1-pyrroline (2-AP) content in the peanut, and further regulation of the peanut fragrance characteristic.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, and more specifically, to a method for constructing an RNAi expression vector based on a peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1. Background Art

[0002] Peanut, formerly known as groundnut (Arachis hypogaea L.), is an annual herbaceous plant of the Leguminosae family, and its total output ranks first among my country's oil crops. The main nutrients of peanut kernels include protein, fat, total carbohydrates and ash. Its nutrients are easily digested and absorbed by the human body, and have the effects of nourishing and prolonging life, so it is called "longevity fruit".

[0003] Peanuts are loved by consumers for their rich nutrition and unique aroma quality. The formation of peanut aroma is a complex process, which is affected by genetic and environmental factors. There are many and complex aroma substances in peanuts. With the development of science and technology, the extraction and identification of peanut aroma substances have become more accurate and faster. The peanut aroma substances that have been identified so far include pyrazines, pyrroles, furans, pyridines, aldehydes, ketones, alcohols, hydrocarbons, aromatics, etc., and different volatile substances have different aromas. 2-Acetyl-1-pyrroline (2-AP) is a natural aroma substance that is easily soluble in hot water, ethanol and ether. It is the characteristic compound and main aroma contributor of fragrant rice aroma, and it is easily perceived and detected, which determines the aroma of almost all fragrant rice varieties. 2-AP has been proven to be an important aroma substance component in many crops, including rice, corn, pumpkin, etc. In 2008, Greene et al. identified 2-AP in roasted peanut kernels by gas chromatography-olfaction method. In 2010, Ji Xiaodong et al. also identified 2-AP in stir-fried peanut kernels.

[0004] Imran et al. (2023) proposed that the 2-AP biosynthesis process can proceed through two pathways based on different precursor molecules: non-enzymatic pathway and enzymatic pathway. The non-enzymatic pathway starts with precursors such as proline, ornithine and glutamate, while the enzymatic pathway starts with ornithine (Imran et al., 2023). After the 2-AP biosynthesis intermediates Δ1-pyrroline-5-carboxylic acid (P5C) and gamma-aminobutyraldehyde (GABald), the former is converted to 2-AP, while the latter forms 2-AP or gamma-aminobutyric acid (GABA). The rice genome contains the betaine acetaldehyde dehydrogenase gene OsBADH2, which produces BADH protein with normal enzyme catalytic activity, catalyzing the conversion of the important intermediate GABAld into GABA. The participation of the enzyme greatly accelerates the reaction process, far exceeding the conversion of GABAld into Δ1-pyrroline, thereby inhibiting the biosynthesis of 2-AP (Imran et al., 2023). In contrast, the mutation of OsBadh2 in aromatic rice inactivates BADH2, hindering the conversion of GABald to GABA, leading to the accumulation of GABald and the formation of Δ1-pyrroline, which is then catalyzed by acetyltransferase to add an acetyl group to form 2-AP; the entire process is defined as the enzyme pathway for 2-AP biosynthesis.

[0005] Genetically, the formation of rice aroma has been attributed to the loss of function of the flavor gene OsBADH2, which leads to a specific accumulation of 2-AP. So far, OsBADH2 knockout and OsP5CS overexpression mutants have been created, demonstrating their efficacy in increasing 2-AP content in rice (Ashokkumar et al., 2020; Bao et al., 2023; Niu et al., 2008). Recently, fragrant corn (Wang et al., 2021) and fragrant sorghum (Zhang et al., 2022) were obtained by CRISPR-Cas9-mediated BADH2 gene editing.

[0006] There are many varieties of peanuts in my country, and the aromas of the varieties vary greatly. The study of the accumulation of aroma substances in different peanut varieties is helpful to fully understand the aroma substances of peanuts, explore high-quality fragrant peanut varieties, and provide a basis for exploring the genetic mechanism of the formation of peanut aroma quality. At present, people have a preliminary understanding of the composition of peanut aroma substances, but the positioning and mining of peanut aroma-related genes and the research on their regulation of peanut aroma have not been reported; therefore, the present invention aims to provide a method for constructing an RNAi expression vector based on the peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1, by cloning the AhBADH1 gene involved in regulating the content of the aroma substance 2-AP from peanuts, and constructing a double-stranded RNAi plant expression vector of the AhBADH1 gene, so as to provide a theoretical basis for the subsequent use of plant genetic engineering to create high-quality fragrant peanut germplasm, and promote the high-quality development of the peanut industry. Summary of the invention

[0007] The purpose of the present invention is to provide a method for constructing an RNAi expression vector based on the peanut flavor-related betaine aldehyde dehydrogenase gene AhBADH1. The present invention clones the peanut flavor-related betaine aldehyde dehydrogenase gene AhBADH1 and constructs an RNA interference (RNAi) expression vector based on the gene, thereby laying a foundation for subsequently regulating the expression of the AhBADH1 gene in peanuts through gene silencing technology, affecting the content of 2-AP in peanuts, and further regulating the flavor characteristics of peanuts.

[0008] The above technical objectives of the present invention are achieved through the following technical solutions: A method for constructing an RNAi expression vector based on the peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1, comprising the following steps:

[0009] S1. Extract RNA from young peanut leaves and obtain the complete coding sequence of AhBADH1 gene using RT-PCR amplification technology;

[0010] S2. Based on the complete coding sequence of AhBADH1 gene, design and synthesize a specific RNAi target sequence for the gene, insert the RNAi target sequence into the RNAi expression vector to form a recombinant RNAi expression vector.

[0011] The present invention is further configured as follows: the recombinant RNAi expression vector formed in step S2 comprises an RNAi target sequence element, a promoter element and a terminator element, and is used to express RNAi molecules in plant cells, thereby specifically silencing the AhBADH1 gene.

[0012] The present invention is further configured as follows: the method further comprises sequencing and verifying the complete coding sequence of the AhBADH1 gene and the recombinant RNAi expression vector to ensure the correctness of the complete coding sequence of the AhBADH1 gene and the recombinant RNAi expression vector.

[0013] In summary, the present invention has the following beneficial effects:

[0014] The present invention obtains the complete coding region sequence of the peanut flavor regulation-related gene AhBADH1 gene by cloning, and constructs a peanut AhBADH1 gene RNAi plant expression vector, which provides new ideas and gene resources for the genetic engineering improvement of peanut flavor quality, promotes the subsequent regulation of AhBADH1 gene expression in peanuts through gene silencing technology, and further can accurately regulate the flavor characteristics of peanuts; the new peanut strong-flavor variety subsequently created by the present invention has a wider application prospect in the food, beverage and other industries, and can be used to produce high-quality peanut products, thereby improving the market value and consumer acceptance of peanut products. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a diagram showing the results of RNA electrophoresis and RT-PCR amplification of peanut AhBADH1 gene from young peanut leaves in an embodiment of the present invention;

[0016] Figure 2 The peanut AhBADH1 gene ORF sequence and its encoded protein sequence diagram in the embodiment of the present invention;

[0017] Figure 3 This is a flowchart of the construction of the peanut aroma-related gene AhBADH1 RNAi plant binary expression vector in the embodiment of the present invention;

[0018] Figure 4 It is a framework diagram of the peanut aroma-related gene AhBADH1 RNAi plant binary expression vector in the embodiment of the present invention. DETAILED DESCRIPTION

[0019] The following is combined with Figure 1-4 The present invention is described in further detail.

[0020] Embodiment: A method for constructing an RNAi expression vector based on the peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1, comprising the following contents:

[0021] 1) Cloning of peanut AhBADH1 gene

[0022] RNA was extracted from young peanut leaves, and the integrity of the extracted RNA was tested by electrophoresis. A pair of primers, badh-F and badh-R, were designed and amplified using RT-PCR to obtain the complete coding sequence of the AhBADH1 gene, about 1600 bp. Figure 1 As shown (M1 is DL15000 DNA marker (TaKaRa), M2 is DL5000 DNA marker (TaKaRa)); the amplified gene fragment was connected to the cloning vector and sequenced to ensure the correctness of the gene sequence.

[0023] In this example, a pair of primers badh-F (AGGCACAGCAACACTGCG) and badh-R (CCTTATCGGATCTCAGATTCC) were used to clone the peanut aroma-related gene AhBADH1 1600 bp sequence for the first time using RT-PCR technology, which includes an open reading frame (ORF) of 1512 bp, encoding the AhBADH1 protein composed of 503 amino acid residues ( Figure 2 ), its molecular weight is 54.55kD and its isoelectric point is 5.34.

[0024] 2) Construction of AhBADH1 gene RNAi plant expression vector

[0025] like Figure 3 As shown, in this embodiment, according to the sequence of AhBADH1, a peanut flavor-related gene, verified by sequencing, primers RNAi-S1 and RNAi-S2, as well as RNAi-AS1 and RNAi-AS2 were designed to amplify the 276 bp fragment at the 3' end of the AhBADH1 gene, and restriction sites Xho I, Kpn I, HindIII, and Cla I were introduced into the 5' ends of the above four primers, respectively. The two PCR products were cloned into the pMD 19-T (Simple) vector (TaKaRa), and positive clones (containing pMD-RNAiS and pMD-RNAiAS plasmids, respectively) were obtained by PCR, restriction enzyme detection and sequencing verification.

[0026] The two plasmids, pHANNIBAL and pMD-RNAiS, were double-digested with two restriction endonucleases, Xho I and Kpn I, and the AhBADH1 gene fragments of the double-digested pHANNIBAL plasmid and the pMD-RNAiS plasmid were respectively recovered, and the fragments were connected to construct an intermediate RNAi plasmid pK-RNAiS; the two plasmids, pK-RNAiS and pMD-RNAiAS, were double-digested with two restriction endonucleases, HindIII and Cla I, and the AhBADH1 gene fragments of the double-digested pK-RNAiS plasmid and the pMD-RNAiAS plasmid were respectively recovered, and the fragments were connected to construct an intermediate RNAi plasmid pK-RNAi-AhBADH1.

[0027] The 35S::AhBADH1RNAi expression frame was then cut from the pK-RNAi-AhBADH1 plasmid using Not I and inserted into the NotI site of the plant binary expression vector pART27. After PCR, restriction enzyme detection and sequencing verification, the peanut AhBADH1 gene RNAi plant binary expression vector pART-RNAi-AhBADH1 ( Figure 4 ).

[0028] in conclusion:

[0029] In this example, a method for cloning a peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1 is provided, the complete coding region sequence of the peanut aroma-related gene AhBADH1 is obtained, and a peanut AhBADH1 gene RNAi plant binary expression vector is constructed, which provides genetic resources and a theoretical and technical basis for the subsequent regulation of AhBADH1 gene expression in peanuts through gene silencing technology, affecting the content of 2-AP in peanuts, and creating high-quality strong-flavor peanut germplasm, and contributes to promoting the application and development of genetic engineering technology in the field of peanut aroma quality improvement, which is conducive to promoting the high-quality development of the peanut industry.

[0030] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A method for constructing an RNAi expression vector based on the peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1, characterized in that: The following steps are involved: S1. Extract RNA from young peanut leaves and obtain the complete coding sequence of AhBADH1 gene using RT-PCR amplification technology; S2. Based on the complete coding sequence of AhBADH1 gene, design and synthesize a specific RNAi target sequence for the gene, insert the RNAi target sequence into the RNAi expression vector to form a recombinant RNAi expression vector.

2. The method for constructing an RNAi expression vector based on the peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1 according to claim 1, characterized in that: The recombinant RNAi expression vector formed in step S2 comprises an RNAi target sequence element, a promoter element and a terminator element, and is used to express RNAi molecules in plant cells, thereby specifically silencing the AhBADH1 gene.

3. The method for constructing an RNAi expression vector based on the peanut aroma-related betaine aldehyde dehydrogenase gene AhBADH1 according to claim 1, characterized in that: The method further comprises sequencing and verifying the complete coding sequence of the AhBADH1 gene and the recombinant RNAi expression vector to ensure the correctness of the complete coding sequence of the AhBADH1 gene and the recombinant RNAi expression vector.

Images