Method and device for screening PCR (Polymerase Chain Reaction) primer design template and application

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method and device for screening a PCR primer design template and application. By using the method for screening the PCR primer design template, various PCR primer design templates can be screened in a broad-spectrum manner, and the situation that the available PCR primer design template cannot be screened due to various reasons such as multiple mutations and conservative property is avoided.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to a method, a device and an application of screening a PCR primer design template. Background Art

[0002] Polymerase Chain Reaction (PCR) is a molecular biological technique for amplifying specific DNA fragments in vitro. Each amplification uses the previous amplification product as a template for exponential amplification to achieve the goal of enriching the target DNA fragment in a short period of time. As one of the most basic molecular biological experimental methods, PCR is widely used in genetic engineering, microbial diagnosis and other fields.

[0003] At present, the screening of suitable PCR primers often relies on experience, literature retrieval or similarity comparison of DNA sequences with high credibility of the target species. The same fragments contained in all or most of the sequences are screened as the conserved fragments of the species, and the appropriate regions are selected in the conserved fragments as amplicons to design primers. Commonly used multiple sequence alignment software such as Muscle, MAFFT, ClustalW, T-Coffee, etc. use different alignment strategies to achieve the final global alignment. When the sequence is short and the number of sequences is small, it can be better used for the analysis of sequence conserved segments. However, with the rapid development of sequencing, the number of species sequences is increasing, and the time spent on conventional multiple sequence alignment has been counted in days, which cannot meet the analysis needs.

[0004] However, some existing primer template screening methods, such as the Kmer segmentation method, usually cannot output results when faced with pathogens with more mutations. Therefore, it is necessary to develop a new method for screening PCR primer design templates that can screen primer templates of pathogens in a broad spectrum. Summary of the invention

[0005] In view of this, in a first aspect, the present invention provides a method for screening PCR primer design templates, comprising:

[0006] Obtain target sequence data;

[0007] The target sequence data is split into constant lengths, the starting sites of the split sequences are counted and a total sequence file is constructed;

[0008] Screen the sequences in the total sequence file for conservation;

[0009] Perform specific screening on the sequences in the total sequence file;

[0010] The sequences in the total sequence file were screened for primers;

[0011] If a sequence exists after screening, it is used as a template for PCR primer design. If a sequence does not exist, a PCR primer design template is constructed as follows:

[0012] Use the target sequence as a template to perform alignment with the sequence in the total sequence file, and count the base information at each position of the sequence;

[0013] According to the base information, a reference sequence of the merged bases is reconstructed, which includes:

[0014] When the base frequency percentage of the target position is not less than a preset value M, the base is the base at the corresponding position of the reconstructed sequence, where the value range of M is ≥80;

[0015] When no single base at the target position satisfies the preset value M, the total frequency percentage of the two bases with the highest depth is calculated to see if it is not less than the preset value M. If so, the merged base corresponding to the two bases is the base at the corresponding position of the reconstructed sequence; if neither is satisfied, the position is an "N" base.

[0016] By using the method for screening PCR primer design templates described in the present invention, various PCR primer design templates can be screened more broadly, avoiding the inability to screen usable PCR primer design templates due to various reasons, such as multiple mutations, conservatism, etc.

[0017] Furthermore, the target sequence data obtained includes reference sequence and target total genome nucleic acid sequence data.

[0018] Furthermore, the target may be a species, a complex group, a genus, a subspecies, or a gene, etc.

[0019] Furthermore, when the target is a complex group, the sequences of all species in the complex group are integrated into one sequence as the target sequence data.

[0020] In some specific implementation schemes, when acquiring data, the sequence source is required to be a target genome of the complete level in the Refseq database. If the number is <20, it is relaxed to all target genomes in the Refseq database.

[0021] Furthermore, the target sequence data is segmented into segments of a constant length, wherein the constant length is 100 to 400 bp, preferably 150 to 250 bp.

[0022] Furthermore, the sequences in the total sequence file are screened for conservatism, including comparing the sequences in the total sequence file with the target total genome nucleic acid sequence. If the following screening conditions are met, the sequence is judged to be conservative and retained:

[0023] The number of mismatches was ≤5 bp and the coverage rate was >90%.

[0024] Preferably, the number of mismatches is ≤2 bp.

[0025] Furthermore, the sequences in the total sequence file are screened for specificity, including comparing the sequences in the total sequence file with all non-target pathogen sequences. If the following screening conditions are met, the sequence specificity is judged to be unsatisfactory and the sequence is not retained:

[0026] The sequence identity is >70% and the coverage is >60%.

[0027] Optionally, the conditions also include:

[0028] E value ≤ 0.1.

[0029] Furthermore, the sequences in the total sequence file were screened by primers, and if the following screening conditions were met, the sequence was retained:

[0030] Coverage ≥ 90%, 35 ≤ GC% ≤ 65%.

[0031] In a second aspect, the present invention provides a device for screening PCR primer design templates, comprising:

[0032] An acquisition module, used to acquire target sequence data;

[0033] The segmentation module is used to segment the target sequence data into constant lengths, count the starting positions of the segmented sequences and construct a total sequence file;

[0034] A screening module is used to screen the sequences in the total sequence file for conservatism; to screen the sequences in the total sequence file for specificity; and to screen the sequences in the total sequence file for primers; and

[0035] The construction module is used to construct a PCR primer design template as follows:

[0036] Use the target sequence as a template to perform alignment with the sequence in the total sequence file, and count the base information at each position of the sequence;

[0037] According to the base information, a reference sequence of the merged bases is reconstructed, which includes:

[0038] When the base frequency percentage of the target position is not less than a preset value M, the base is the base at the corresponding position of the reconstructed sequence, where the value range of M is ≥80;

[0039] When no single base at the target position satisfies the preset value M, the total frequency percentage of the two bases with the highest depth is calculated to see if it is not less than the preset value M. If so, the merged base corresponding to the two bases is the base at the corresponding position of the reconstructed sequence; if neither is satisfied, the position is an "N" base.

[0040] Furthermore, the acquisition module includes reference sequence and target total genome nucleic acid sequence data.

[0041] Furthermore, the target may be a species, a complex group, a genus, a subspecies, or a gene, etc.

[0042] Furthermore, when the target is a complex group, the sequences of all species in the complex group are integrated into one sequence as the target sequence data.

[0043] In some specific implementation schemes, when acquiring data, the sequence source is required to be a target genome of the complete level in the Refseq database. If the number is <20, it is relaxed to all target genomes in the Refseq database.

[0044] Furthermore, the constant length in the segmentation module is 100 to 400 bp, preferably 150 to 250 bp.

[0045] Furthermore, in the screening module, the sequences in the total sequence file are screened for conservatism, including comparing the sequences in the total sequence file with the target total genome nucleic acid sequence. If the following screening conditions are met, the sequence is judged to be conservative and retained:

[0046] The number of mismatches was ≤5 bp and the coverage rate was >90%.

[0047] Preferably, the number of mismatches is ≤2 bp.

[0048] Furthermore, in the screening module, the sequences in the total sequence file are screened for specificity, including comparing the sequences in the total sequence file with all non-target pathogen sequences. If the following screening conditions are met, it is determined that the sequence specificity is not met and the sequence is not retained:

[0049] The sequence identity is >70% and the coverage is >60%.

[0050] Optionally, the conditions also include:

[0051] E value ≤ 0.1.

[0052] Furthermore, in the screening module, the sequences in the total sequence file are screened by primers, and if the following screening conditions are met, the sequence is retained:

[0053] Coverage ≥ 90%, 35 ≤ GC% ≤ 65%.

[0054] In a third aspect, the present invention provides a method or device for screening PCR primer design templates as described above for use in preparing a kit or device for screening PCR primer design templates.

[0055] In a fourth aspect, the present invention provides a device, comprising:

[0056] at least one processor; and

[0057] a memory communicatively connected to at least one of the processors; wherein,

[0058] The memory stores instructions that can be executed by the processor, and the instructions are used to be executed by the processor to implement any of the above-mentioned methods for screening PCR primer design templates.

[0059] In some embodiments, the device further includes at least one input device and at least one output device; in the device, the processor, memory, input device, and output device are connected via a bus.

[0060] In a fifth aspect, a storage medium is provided, wherein the storage medium stores computer instructions, and the computer instructions are used to be executed by the computer to implement the method for screening PCR primer design templates as described in any one of the above items.

[0061] In some embodiments, the storage medium is a computer-readable storage medium. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 is a schematic diagram of the template screening method of the present invention;

[0063] Figure 2 This is the result of the detection of viridans hemolytic streptococci 200 copies / mL;

[0064] Figure 3 This is the specific result diagram of viridans hemolytic streptococci;

[0065] Figure 4 This is the result of detection of oral streptococcus 200 copies / mL;

[0066] Figure 5 This is a specific result diagram for oral streptococci;

[0067] Figure 6 This is the BK virus detection result diagram;

[0068] Figure 7 The specific results of BK virus are shown in Figure 2. DETAILED DESCRIPTION

[0069] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0070] The schematic flow chart of the present invention is as follows Figure 1 As shown, for example, a DNA sequence set of a target species is obtained, and then segmented to construct a total input sequence. The segmented sequences are screened for conservation, specificity, and primers. If they meet the screening requirements, a PCR primer design template is generated. If they do not meet the screening requirements, a mutation analysis is performed and the template is reconstructed.

[0071] Example 1: Primer Template Screening for Viridans Hemolytic Streptococcus Complex

[0072] Taking the common targets of Streptococcus-anginosus, Streptococcus-constellatus, and Streptococcus-intermedius in the viridans hemolytic streptococcus complex as an example, viridans hemolytic streptococci are distinguished from other streptococci by hemolysis, and it is difficult to find a target region with high conservation and specificity that meets the requirements from the sequence. A total of 48 genome sequences related to streptococci of pharyngitis, constellatus, and intermedius were downloaded from the NCBI database.

[0073] The method of the present invention is used to design primers for the data set, which specifically includes the following steps:

[0074] (a) Select Streptococcus anginosus GCF_900636475.1, Streptococcus constellatus GCF_016725005.1, and Streptococcus intermedius GCF_900475975.1 from the 48 sequences downloaded above, and merge these three reference sequences into one, and randomly divide them into 200,000 sequences with a length of 200 bp. Use BWA software to build an index for a total of 46 related genomic sequences, and then align the divided sequences. The results are counted and screened, and the total number of sequences on each sequence alignment that passes the screening is calculated to obtain the coverage of each sequence, and the threshold screening (conservative screening) is set according to Table 1;

[0075] Table 1, conservative sequence screening criteria:

[0076] project By Standard Number of mismatches ≤2 Coverage >90％

[0077] (b) The selected conservative sequences are aligned to the specific alignment database through blastn, and the alignment results are filtered according to the set threshold to screen out the sequences that meet the conditions described in Table 2 and do not belong to the composite bacterial community (specific screening).

[0078] Table 2. Screening criteria for specific comparison results:

[0079]

[0080]

[0081] (c) The basic information of the target species sequence that meets the conservation and specificity (coverage, length, CG%, sequence starting position, specificity, etc.) is collected, as shown in Table 3, and further screened (primer screening) is performed using the conditions described in Table 4.

[0082] Table 3. Examples of conservative and specific sequences and basic information:

[0083]

[0084]

[0085] Note: The above table shows the results of segmenting some sequences from high to low coverage.

[0086] Table 4, Primer screening criteria:

[0087] project By Standard Coverage ≥90 GC% 35 ≤ GC% ≤ 65%

[0088] (d) The target species sequence in Table 3 was judged by the screening conditions in Table 4, and no template was screened. Therefore, all randomly cut sequences obtained in step (c) were remade into fa files, and the sequences of the target species genome sequence library were aligned with this file using blast, and arranged in descending order according to coverage and GC content as reference sequences. The reference sequences were then taken one by one, and finally the alignment of each base site in the reference sequence was counted using samtools software according to the alignment results. The basic data such as insertion / deletion frequency, base ratio, etc. of each position of the reference sequence were further counted to construct a reference sequence with degenerate bases, as shown in Table 5 for example. After screening, a 198bp fragment with a coverage of 100% that met the requirements was found:

[0089] ATCAAAAATTTGGTAAAAAATAAAACAGATTGAGGTARGATAGAACTCGA

[0090] TTGGCAGCACCAGTCGAGTTCTATATTTTAGAMAAAGGAGRCTCTGATGA

[0091] CTACACAACAACAGCCACGTAAAGCATTGCTGCTCTCCCTCATCCCAGGA

[0092] CTTGGGCAAATTTATAATAAACAAAAAGCAAAAGGGGCTATCTTTTTA (SEQ ID NO: 1).

[0093] Table 5

[0094]

[0095] Note: Position: reference sequence position, Ref: reference sequence base type at the specified position, Count: number of aligned sequences, "+": insertion, "-": deletion, A, C, G, T (%): frequency and overall proportion of four base types. "M" in the above table means that the probability of A and G appearing at base 85 is 100%, so the degenerate base "M" is output at this position.

[0096] (e) The primers and probes designed based on the above selected primer design template are shown in Table 6 below.

[0097] Table 6

[0098]

[0099] (f) The designed primers were subjected to simulated PCR in the nucleic acid sequence database to detect the primer specificity. The matching results of the primers in Table 6 are shown in Table 7.

[0100] Table 7

[0101]

[0102] *Other: represents other non-target species matching situations;

[0103] From the results in Table 6, it can be seen that the primer design template screening method proposed in the present application is feasible, and the simulated PCR results show that the designed primers have good specificity and amplification efficiency.

[0104] Experimental Results

[0105] The primers designed from the above-screened primer templates as shown in Table 6 were used to detect viridans hemolytic streptococci, and were specifically detected with common pathogens and other pathogens with similar infection symptoms (Enterococcus faecalis, Staphylococcus aureus, Salmonella typhi, Salmonella paratyphi, Salmonella enteritidis, Yersinia intestinalis, Shigella, Campylobacter, Escherichia coli O157, Clostridium difficile, Capsule bacillus perfringens, Helicobacter pylori, enterovirus 71, astrovirus, norovirus, rotavirus, enteroadenovirus), with no cross reaction. The test results are as follows: Figures 2-3 As shown in the figure, it can be seen that the accuracy and specificity of the primer template screened by the present invention meet the detection requirements.

[0106] Example 2: Primer Template Screening for Oral Streptococcus

[0107] A total of 22 oral streptococcus related genome sequences were downloaded from the NCBI database. Using oral streptococcus GCF_900637025.1 as a template, 200bp length was randomly divided into 200,000 sequences. BWA software was used to build an index for a total of 22 related genome sequences, and then the divided sequences were aligned. The results were counted and screened, and the total number of sequences on each sequence alignment that passed the screening was calculated to obtain the coverage of each sequence, and the threshold was set according to Table 1 for screening;

[0108] The selected conservative sequences were aligned to the specific alignment database by blastn, and the alignment results were screened according to the threshold set in Table 2. Only the sequence of oral Streptococcus txid was aligned in the statistical results.

[0109] The basic information of the target species sequence that meets the conservation and specificity (coverage, length, CG%, sequence starting position, specificity, etc.) is statistically analyzed, as shown in Table 8, and further screening (primer screening) is performed using the conditions described in Table 4.

[0110] Table 8

[0111]

[0112]

[0113] After the above three screenings, no templates were found. Therefore, all randomly segmented sequences obtained in this step of Table 8 were re-made into fa files, and the sequences of the target species genome sequence library were aligned to this file using blast. The samtools software was used to count the alignment of each base site in the reference sequence based on the alignment results. After screening, two 200bp fragments with a coverage rate of 100% that met the requirements were found:

[0114] >Consensus1

[0115] TGCTACACCACCGATAATCCATGCTTTTTTACTCATCTTTTTCTCCTTAGTTTTCAAGCGCTTCTCTCACCCACTGGATACGTTCAACTGCGATATCACTTGGAATGGTACAATCYGCAAGTACCAAGCCCTGTTCCCCAGCTTCTGCAACTAGTTTCTTTGCYTCAGCCTGAATGGCRTCCTTGCTACCAGTATA (SEQ ID NO: 5);

[0116] >Consensus2

[0117] TTCCAGTTGGATCTGATTTCAGACCGYCGRGTTATCGCTGGTGAYTACGATACTTCCTTCTTGATGGAAACTTTCTTGCCAMAATACCAAGAAAAGAATAGACTTTCAAABAGTATGAGAACTAAAAGGGGGAGTTATGGCTCTATTTAGTAAAAAGGATAAGTATATTCGGATCAATCCTAAHCGTTCCGTAAGGCAG (SEQ ID NO: 6).

[0118] The primers and probes designed for a selected primer design template are shown in Table 9 below.

[0119] Table 9

[0120]

[0121] The designed primers were subjected to simulated PCR in the nucleic acid sequence database to detect primer specificity. The matching status of the primers in Table 9 is shown in Table 10.

[0122] Table 10

[0123]

[0124] *Other: represents other non-target species matching situations;

[0125] From the results in Table 10, it can be seen that the primer design template screening method proposed in the present application is feasible, and the simulated PCR results show that the designed primers have good specificity and amplification efficiency.

[0126] Experimental Results

[0127] The primers designed from the above-screened primer templates as shown in Table 9 were used to detect oral streptococci, and specific detection was performed with common pathogens and other pathogens with similar infection symptoms (Enterococcus faecalis, Staphylococcus aureus, Salmonella typhi, Salmonella paratyphi, Salmonella enteritidis, Yersinia intestinalis, Shigella, Campylobacter, Escherichia coli O157, Clostridium difficile, Capsule bacillus perfringens, Helicobacter pylori, enterovirus 71, astrovirus, norovirus, rotavirus, enteroadenovirus), and there was no cross reaction. The test results were as follows: Figures 4-5 As shown in the figure, it can be seen that the accuracy and specificity of the primer template screened by the present invention meet the detection requirements.

[0128] Example 3: Primer Template Screening for BK Virus

[0129] A total of 519 BK virus-related genome sequences were downloaded from the NCBI database. Using NC_001538.1 of BK virus as a template, 200bp length was randomly divided into 100,000 sequences. BWA software was used to build an index for a total of 519 related genome sequences, and then the divided sequences were aligned. The results were counted and screened, and the total number of sequences on each sequence alignment that passed the screening was calculated to obtain the coverage of each sequence, and the threshold was set according to Table 1 for screening;

[0130] The selected conservative sequences were aligned to the specific alignment database by blastn, and the alignment results were screened according to the threshold set in Table 2. Only the sequence of BK virus txid was aligned in the statistical results.

[0131] The basic information of the target species sequence that meets the conservation and specificity (coverage, length, CG%, sequence starting position, specificity, etc.) is statistically analyzed, as shown in Table 11, and further screening (primer screening) is performed according to the conditions described in Table 4.

[0132] Table 11

[0133]

[0134] After the above three types of screening, no templates were screened. Specifically, during conservative screening, segments with too many mutations will be screened out. Therefore, for pathogens with more mutations, Kmer cannot be used for analysis. The BK virus may have different mutation characteristics in patient groups in different regions due to differences in environmental factors, infection history, and genetic background of the population. There are very few regions with less than 2 mutations in the sequence divided by 200bp. Sequences with more mutations will be discarded during alignment, and conservative screening will filter these sequences.

[0135] However, all the sequences (including the selected and unselected sequences) will be retained in the gene library, and all the data will be taken out for mutation analysis. Therefore, the sequence obtained in the step of obtaining Table 11 was remade into a fa file, and the sequence of the target species genome sequence library was aligned with this file using blast, and arranged in descending order according to coverage and GC content as reference sequences. The reference sequences were then taken one by one, and finally the alignment of each base site in the reference sequence was counted according to the alignment results using samtools software. After screening, a 166bp fragment with a coverage of 96% that met the requirements was obtained:

[0136] >Consensus1

[0137] YCTTAATCTWAGCTGACABAGCATGCAAGGGCAGTGCACWGAAGGCTTTTTGGAACAAATAGGCCAWTCCTTGCAGTACAGGGTATCTGGGCAAAGAGGAAAATCAGCACAAACCTCTGAGCTACTCCAGGTTCCAAAATCAGGCTGRTGRGCTACCTTTACATCY (SEQ ID NO: 10).

[0138] Table 12

[0139]

[0140] The designed primers were subjected to simulated PCR in the nucleic acid sequence database to detect primer specificity. The matching status of the primers in Table 12 is shown in Table 13.

[0141] Table 13

[0142]

[0143] *Other: represents other non-target species matching situations;

[0144] From the results in Table 13, it can be seen that the primer design template screening method proposed in the present application is feasible, and the simulated PCR results show that the designed primers have good specificity and amplification efficiency.

[0145] Experimental Results

[0146] The primers designed from the above-screened primer templates as shown in Table 12 were used to detect oral streptococci, and specific detection was performed with common pathogens or other pathogens with similar infection symptoms (JC virus, human tubular virus (HPyV2), monkey polyomavirus (SV40), human polyomavirus 7 (HPyV7), human polyomavirus 6 (HPyV6), EB, HIV, HEV, HCV), and there was no cross reaction. The test results were as follows: Figures 6-7 As shown in the figure, it can be seen that the accuracy and specificity of the primer template screened by the present invention meet the detection requirements.

[0147] Example 4: Primer Template Screening for Actinococcosis stutzeri

[0148] A total of 10 genome sequences related to Actinomycetes Steinernema were downloaded from the NCBI database. The length of the reference sequence GCF_000724605.1 of Actinomycetes Steinernema is 2159306bp, which was randomly divided into 200,000 sequences at a length of 150bp. The BWA software was used to construct an index for a total of 10 genome sequences related to Actinomycetes Steinernema, and then the divided sequences were aligned. The results were counted and screened, and the total number of sequences on each sequence alignment that passed the screening was calculated to obtain the coverage of each sequence, and the threshold was set according to Table 1 for screening;

[0149] The selected conservative sequences were aligned to the specific alignment database by blastn, and the alignment results were screened according to the threshold set in Table 2. In the statistical results, only the sequence of Actinococcosis stutzeri txid was aligned.

[0150] The basic information of the target species sequence that meets the conservation and specificity (coverage, length, CG%, sequence starting position, specificity, etc.) is statistically analyzed, as shown in Table 14, and further screening (primer screening) is performed according to the conditions described in Table 4.

[0151] Table 14

[0152]

[0153] After the above three screenings, two available templates were screened: GCF_000724605.1-35140 and GCF_000724605.1-96248 primer design templates. Corresponding primers were designed based on the templates, as shown in Table 15.

[0154] Table 15

[0155]

[0156]

[0157] The designed primers were subjected to simulated PCR in the nucleic acid sequence database to detect primer specificity. The matching status of the primers in Table 15 is shown in Table 16.

[0158] Table 16

[0159]

[0160] *Other: represents matches of other non-target species.

[0161] The artificially synthesized plasmids of the Actinococcidioides sequence designed by the present invention and the Actinococcidioides sequence disclosed in the comparative example (see Table 17) were mixed and gradiently diluted to 4.00E+02 copies / mL using negative samples as the test samples, and the three were tested, and the results are shown in Table 18. As can be seen from the table, when the concentration is 4.00E+02 copies / mL, the detection rate of the primers and probes designed according to the new target of the present invention is 100%, but the detection rate of the primers and probes designed according to the conventional primers is only 70%, which shows that the sensitivity of the new target primers designed by the present method is much higher than that of the conventional target.

[0162] Table 17

[0163]

[0164] Table 18

[0165]

[0166]

Claims

1. A method for screening PCR primer design templates, comprising: Obtain target sequence data; The target sequence data is split into constant lengths, the starting sites of the split sequences are counted and a total sequence file is constructed; Screen the sequences in the total sequence file for conservation; Perform specific screening on the sequences in the total sequence file; The sequences in the total sequence file were screened for primers; If a sequence exists after screening, it is used as a template for PCR primer design. If a sequence does not exist, a PCR primer design template is constructed as follows: Use the target sequence as a template to perform alignment with the sequence in the total sequence file, and count the base information at each position of the sequence; According to the base information, a reference sequence of degenerate bases is reconstructed, which includes: When the base frequency percentage of the target position is not less than a preset value M, the base is the base at the corresponding position of the reconstructed sequence, where the value range of M is ≥80; When no single base at the target position satisfies the preset value M, the total frequency percentage of the two bases with the highest depth is calculated to see if it is not less than the preset value M. If so, the degenerate bases corresponding to the two bases are the bases at the corresponding position of the reconstructed sequence; if neither is satisfied, the position is an "N" base.

2. The method according to claim 1, characterized in that The conservative screening of the sequences in the total sequence file includes comparing the sequences in the total sequence file with the target total genome nucleic acid sequence. If the following screening conditions are met, the conservativeness of the sequence is determined to be met and the sequence is retained: The number of mismatches was ≤5 bp and the coverage rate was >90%.

3. The method according to claim 1, characterized in that The specificity screening of the sequences in the total sequence file includes comparing the sequences in the total sequence file with all non-target pathogen sequences. If the following screening conditions are met, it is determined that the sequence specificity is not met and the sequence is not retained: The sequence identity is >70% and the coverage is >60%.

4. The method according to claim 1, characterized in that: The sequences in the total sequence file are screened by primers, and if the following screening conditions are met, the sequence is retained: Coverage ≥ 90%, 35 ≤ GC% ≤ 65%.

5. The method according to claim 1, characterized in that: The target sequence data is segmented into constant lengths, wherein the constant length is 100 to 400 bp.

6. The method according to any one of claims 1 to 5, characterized in that: The target is one or more of a species, a complex group, a genus, a subspecies, or a gene.

7. A device for screening PCR primer design templates, comprising: An acquisition module, used to acquire target sequence data; The segmentation module is used to segment the target sequence data into constant lengths, count the starting positions of the segmented sequences and construct a total sequence file; A screening module is used to screen the sequences in the total sequence file for conservation; Perform specific screening on the sequences in the total sequence file; and performing primer screening on the sequences in the total sequence file; as well as The construction module is used to construct a PCR primer design template as follows: Use the target sequence as a template to perform alignment with the sequence in the total sequence file, and count the base information at each position of the sequence; According to the base information, a reference sequence of the merged bases is reconstructed, which includes: When the base frequency percentage of the target position is not less than a preset value M, the base is the base at the corresponding position of the reconstructed sequence, where the value range of M is ≥80; When no single base at the target position satisfies the preset value M, the total frequency percentage of the two bases with the highest depth is calculated to see if it is not less than the preset value M. If so, the merged base corresponding to the two bases is the base at the corresponding position of the reconstructed sequence; if neither is satisfied, the position is an "N" base.

8. Use of the method according to any one of claims 1 to 6 in preparing a kit or device for screening PCR primer design templates.

9. A device comprising: at least one processor; as well as a memory communicatively connected to at least one of the processors; wherein, The memory stores instructions executable by the processor, and the instructions are used to be executed by the processor to implement the method for screening PCR primer design templates according to any one of claims 1 to 6.

10. A storage medium storing computer instructions, wherein the computer instructions are used to be executed by the computer to implement the method for screening PCR primer design templates according to any one of claims 1 to 6.

Images