Anti-mesothelin single-chain antibody, mRNA and application thereof, and nucleic acid drug

Abstract

The invention provides an anti-mesothelin single-chain antibody, mRNA (messenger Ribonucleic Acid), application of mRNA and a nucleic acid drug, and relates to the technical field of biology. The anti-mesothelin single-chain antibody provided by the invention can specifically recognize mesothelin, and is strong in specificity and high in sensitivity. The mRNA provided by the invention can express an anti-mesothelin single-chain antibody, and the mRNA is introduced into T cells, so that the recognition and killing ability of the T cells to over-activated gastric cancer cells can be improved, and the mRNA can be used for preparing drugs for treating gastric cancer. According to the nucleic acid medicine provided by the invention, the mRNA for expressing the single-chain antibody for resisting mesothelin is delivered to the T cell, so that the T cell expresses the single-chain antibody for resisting mesothelin, and the recognition and killing capabilities of the T cell on over-activated gastric cancer cells are further improved, so that the treatment of gastric cancer is realized.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an anti-mesothelin single-chain antibody, mRNA and application thereof, and a nucleic acid drug. Background Art

[0002] Gastric adenocarcinoma is the fifth most commonly diagnosed cancer in the world and is a malignant tumor with a very high incidence worldwide. Gastric cancer has always been a key disease for research, and scholars at home and abroad have been working hard to explore new diagnostic and treatment methods.

[0003] Chimeric antigen receptor T cell (CAR-T) immunotherapy has achieved great results in the clinical treatment of hematological tumors. However, its role in solid tumors is still under study. This is mainly due to the complex tumor microenvironment of solid tumors and the presence of multiple immunosuppressive factors, which will inhibit the activity and function of CAR-T cells and reduce the therapeutic effect. Secondly, the high heterogeneity of solid tumors is also a reason that hinders its application. In addition, the inherent safety issues of CAR-T will also be further reflected in solid tumors.

[0004] Mesothelin (MSLN) is a cell surface glycoprotein. Its expression in normal tissues is relatively limited, but it is highly expressed in certain tumor cells, such as malignant mesothelioma, pancreatic cancer, ovarian cancer, etc. It is a potential target for the treatment of gastric cancer using CAR-T technology. As a tumor-associated antigen, mesothelin has become an important target for tumor immunotherapy. Researchers have tried to use the immune system to attack and eliminate tumor cells expressing mesothelin by developing therapeutic methods such as antibodies, vaccines, and chimeric antigen receptor T cells (CAR-T) targeting mesothelin. Due to the specific expression of mesothelin in tumor cells, treatment methods targeting it are expected to improve the effect of tumor treatment to a certain extent, while reducing side effects on normal tissues. In-depth research on mesothelin provides new ideas and strategies for the diagnosis and treatment of tumors.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The first object of the present invention is to provide an anti-mesothelin single-chain antibody.

[0007] The second object of the present invention is to provide a nucleic acid.

[0008] The third object of the present invention is to provide a carrier.

[0009] A fourth object of the present invention is to provide a cell.

[0010] The fifth object of the present invention is to provide an mRNA.

[0011] The sixth object of the present invention is to provide the use of the above mRNA in the preparation of drugs for treating gastric cancer.

[0012] The seventh object of the present invention is to provide a nucleic acid drug to solve the above-mentioned technical problems.

[0013] In order to achieve the above objectives, the following technical solutions are adopted:

[0014] In a first aspect, the present invention provides an anti-mesothelin single-chain antibody, the amino acid sequence of the single-chain antibody is shown in SEQ ID NO.1.

[0015] In a second aspect, the present invention provides a nucleic acid comprising a nucleotide sequence encoding the anti-mesothelin single-chain antibody.

[0016] In a third aspect, the present invention provides a vector carrying the nucleic acid.

[0017] In a fourth aspect, the present invention provides a cell, wherein the cell carries the nucleic acid, or contains the vector, or expresses the anti-mesothelin single-chain antibody.

[0018] As a further technical solution, the cells include T cells.

[0019] In a fifth aspect, the present invention provides an mRNA, wherein the mRNA expresses the single-chain antibody;

[0020] The mRNA includes 5'UTR, coding region, 3'UTR and PoLy A tail in sequence from 5' to 3';

[0021] The nucleic acid sequence of the coding region is shown in SEQ ID NO.2.

[0022] As a further technical solution, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.3;

[0023] The nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.4;

[0024] The nucleic acid sequence of the PoLy A tail is shown in SEQ ID NO.5.

[0025] In a sixth aspect, the present invention provides the use of the above mRNA in the preparation of a drug for treating gastric cancer.

[0026] In a seventh aspect, the present invention provides a nucleic acid drug, comprising a delivery vector and the mRNA;

[0027] The delivery vector is loaded with the mRNA and is used to deliver the mRNA to T cells.

[0028] As a further technical solution, the delivery carrier includes ionizable lipids, neutral lipids, cholesterol and MAL-modified long-circulating lipids;

[0029] The molar ratio of the ionizable lipid, the neutral lipid, the cholesterol and the MAL-modified long-circulating lipid is (45-55):(9-11):(37-40):(1.3-1.7).

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The anti-mesothelin single-chain antibody provided by the present invention can specifically recognize mesothelin and has strong specificity and high sensitivity.

[0032] The mRNA provided by the present invention can express a single-chain antibody against mesothelin. The mRNA is introduced into T cells to improve the recognition and killing ability of T cells to overactivated gastric cancer cells, and can be used to prepare drugs for treating gastric cancer.

[0033] The nucleic acid drug provided by the present invention delivers mRNA expressing anti-mesothelin single-chain antibody to T cells, causing the T cells to express the anti-mesothelin single-chain antibody, thereby improving the T cells' ability to recognize and kill overactivated gastric cancer cells, thereby achieving the treatment of gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0035] Figure 1 The affinity results of antibodies of different colonies are shown;

[0036] Figure 2 The particle size of LNP-mRNA and LNP-mRNA (new) was measured by nanoparticle size analyzer;

[0037] Figure 3 Zeta potential analyzer was used to detect the potential of LNP-mRNA and LNP-mRNA (new);

[0038] Figure 4 To detect the structural features of LNP-mRNA and LNP-mRNA (new) by transmission electron microscopy;

[0039] Figure 5 is the standard curve;

[0040] Figure 6 Flow cytometry was used to verify the transfection efficiency of MSLN in mouse T cells in each treatment group; *: P<0.05, indicating that there is a significant statistical difference between the groups;

[0041] Figure 7 CCK8 was used to detect the proliferation activity of MFC cells in each group; *: P<0.05, ***: P<0.001, indicating that there were significant statistical differences between the groups;

[0042] Figure 8 Flow cytometry was used to detect the apoptosis level of MFC cells in each group; **: P<0.01, ***: P<0.001, indicating that there were significant statistical differences among the groups. DETAILED DESCRIPTION

[0043] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0044] Generally, the nomenclature and its technology used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally carried out according to conventional methods as well-known in the art, and as described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's specifications, as generally achieved in the art, or as described herein. The nomenclature and its laboratory procedures and technology used in conjunction with analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0045] The "variable region" or "variable domain" of an antibody refers to the domain at the amino terminus of the heavy chain or light chain of the antibody that recognizes and binds to the antigen. The composition and arrangement of the amino acids in this region determine the specificity of the antibody in recognizing the antigen. The heavy chain variable region may be referred to as "VH". The light chain variable region may be referred to as "VL". These domains are usually the most variable parts of the antibody and contain the antigen binding site.

[0046] The term "vector" refers to a nucleic acid delivery vehicle into which a nucleotide can be inserted. When a vector can express a protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries are expressed in the host cell.

[0047] The vector is well known to those skilled in the art, including but not limited to: plasmid; phagemid; cosmid; artificial chromosome, such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or P1-derived artificial chromosome (PAC); bacteriophage such as lambda phage or M13 phage and animal virus, etc. Animal viruses that can be used as vectors include but are not limited to retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (such as herpes simplex virus), poxvirus, baculovirus, papillomavirus, papillomavirus. In some embodiments, the vector of the present invention contains regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES) and other expression control elements (such as transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

[0048] In a first aspect, the present invention provides an anti-mesothelin single-chain antibody, the amino acid sequence of the single-chain antibody is shown in SEQ ID NO.1:

[0049] *SGYPGPGP AGRHSERLSGAGSEHAGSAERHPVPAGPGPGADRAGAAAGEHPG (SEQ ID NO. 1).

[0050] The anti-mesothelin single-chain antibody provided by the present invention can specifically recognize mesothelin and has strong specificity and high sensitivity.

[0051] In a second aspect, the present invention provides a nucleic acid comprising a nucleotide sequence encoding the anti-mesothelin single-chain antibody.

[0052] In a third aspect, the present invention provides a vector carrying the nucleic acid.

[0053] In a fourth aspect, the present invention provides a cell, wherein the cell carries the nucleic acid, or contains the vector, or expresses the anti-mesothelin single-chain antibody.

[0054] The nucleic acid, vector and cell can be used to prepare an anti-mesothelin single-chain antibody or mRNA expressing an anti-mesothelin single-chain antibody.

[0055] In some alternative embodiments, the cells include T cells.

[0056] The CAR-T cell can express the above-mentioned anti-mesothelin single-chain antibody, has an antigen receptor with mesothelin as a specific target, can specifically recognize gastric cancer cells, and thus achieve the treatment of gastric cancer.

[0057] In a fifth aspect, the present invention provides an mRNA, wherein the mRNA expresses the single-chain antibody;

[0058] The mRNA includes 5'UTR, coding region, 3'UTR and PoLy A tail in sequence from 5' to 3';

[0059] The nucleic acid sequence of the coding region is shown in SEQ ID NO.2:

[0060]

[0061] The mRNA provided by the present invention can express a single-chain antibody against mesothelin, and introducing the mRNA into T cells can improve the recognition and killing capabilities of T cells against overactivated gastric cancer cells.

[0062] In some optional embodiments, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.3:

[0063] GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAC CCCGGCGCC (SEQ ID NO. 3).

[0064] The nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.4:

[0065] GCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCC CCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUG AAUAAAGUCUGAGUGGGCGGCA (SEQ ID NO. 4).

[0066] The nucleic acid sequence of the PoLy A tail is shown in SEQ ID NO.5:

[0067] AAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO. 5).

[0068] In a sixth aspect, the present invention provides the use of the above mRNA in the preparation of a drug for treating gastric cancer.

[0069] The mRNA provided by the present invention can express a single-chain antibody against mesothelin. The mRNA is introduced into T cells to improve the recognition and killing ability of T cells to overactivated gastric cancer cells, and can be used to prepare drugs for treating gastric cancer.

[0070] In a seventh aspect, the present invention provides a nucleic acid drug, comprising a delivery vector and the mRNA;

[0071] The delivery vector is loaded with the mRNA and is used to deliver the mRNA to T cells.

[0072] The nucleic acid drug provided by the present invention delivers mRNA expressing anti-mesothelin single-chain antibody to T cells, causing the T cells to express the anti-mesothelin single-chain antibody, thereby improving the T cells' ability to recognize and kill overactivated gastric cancer cells, thereby achieving the treatment of gastric cancer.

[0073] In some optional embodiments, the delivery vehicle comprises ionizable lipids, neutral lipids, cholesterol, and MAL-modified long-circulating lipids;

[0074] The molar ratio of the ionizable lipid, the neutral lipid, the cholesterol and the MAL-modified long-circulating lipid may be, for example, but not limited to, 45:11:37:1.7, 50:10:38.5:1.5 or 55:9:40:1.3.

[0075] In some optional embodiments, the ionizable lipid comprises SM-102, ALC0315 or DLin-MC3-DMA;

[0076] The neutral lipids include DSPE, DSPC or DOPE;

[0077] The MAL-modified long-circulating lipids include DMG-PEG-MAL or DSPE-PEG-MAL.

[0078] It should be noted that the nucleic acid drug provided by the present invention has the following differences and advantages compared with mRNA vaccine technology:

[0079] Compared with mRNA vaccine technology, first of all, the main purpose of mRNA vaccine technology is to deliver mRNA encoding antigens to antigen presenting cells (such as dendritic cells). After these cells take up mRNA, they translate and produce antigen proteins in the cells, which are then processed and presented on the cell surface, activating the immune system to produce an immune response to the antigen, usually producing antibodies and cytotoxic T lymphocytes (CTL) to fight pathogens such as viruses. The LNP (liposome)-carrying mRNA technology of the present invention is to deliver mRNA encoding chimeric antigen receptors (CAR) to T lymphocytes in the patient's body. In T cells, mRNA translation produces CAR protein, so that CAR is expressed on the surface of T cells, thereby reprogramming T cells into CAR-T cells. These CAR-T cells can specifically recognize tumor-associated antigens and exert anti-tumor activity.

[0080] Second, LNP-carrying mRNA vaccines target antigen-presenting cells, which have the function of taking up and processing foreign antigens in the immune system. LNP is taken up by binding to receptors on the surface of antigen-presenting cells or through mechanisms such as phagocytosis. LNP-carrying mRNA in vivo generates CAR-T targeting T lymphocytes. This involves the use of markers or receptors specific to the surface of T cells to achieve more precise delivery.

[0081] Third, LNP-carrying mRNA vaccines encode pathogen-associated antigens, which can simulate pathogen invasion and trigger the body's immune defense response. LNP-carrying mRNA in situ in vivo CAR-T technology encodes the CAR structure, which generally includes an extracellular antigen binding domain (such as a single-chain antibody scFv), a transmembrane domain, and an intracellular signal transduction domain. Its structure and function are far more complex than general vaccine mRNA.

[0082] Compared with mRNA vaccines, the first LNP-carrying mRNA technology has great potential for personalization. For each patient's tumor cells, the surface antigens may be different. Through in situ generation of CAR-T technology in vivo, the corresponding mRNA can be designed and used to encode specific CARs according to the specific conditions of the patient's tumor antigens. This personalized treatment method can better adapt to the heterogeneity of tumors and improve treatment effects.

[0083] Compared with traditional CAR-T, the present invention has better safety and timeliness. Compared with traditional CAR-T cell therapy, in situ generation of CAR-T in vivo avoids complex in vitro cell engineering processes. In vitro preparation of CAR-T cells requires extraction of T cells from the patient's body and gene editing and other operations, which may cause cell function damage or introduce other uncertainties. In vivo in situ generation can reduce these risks and can produce CAR-T cells in a short time to play a therapeutic role, which is very important for some rapidly progressing tumor patients. Secondly, it is easy to adjust and optimize. If it is found during the treatment process that the design of CAR needs to be improved, or CAR for different tumor antigens needs to be replaced, it is relatively easy to achieve by changing the sequence of mRNA. Once the traditional CAR-T cells are prepared, it is difficult to modify their CAR structure. For example, when tumor cells escape antigens, that is, tumor cells no longer express the original target antigens, new mRNA encoding CAR for new antigens can be quickly designed to continue treatment.

[0084] The present invention is to prepare a CAR-T cell LNP delivery mRNA drug, and realize in situ CAR-T activation in vivo by pre-preparation. The mRNA entering the T cell is directly translated into protein and localized to the surface of the T cell, forming MSLN antibodies on the surface of the T cell, killing gastric cancer cells expressing MSLN.

[0085] The present invention is further described below by means of specific examples and comparative examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0086] Test Example 1

[0087] 1. Construction of ScFv display library

[0088] Total RNA was extracted from immunized T lymphocytes, specifically: monocytes were isolated from mouse peripheral blood, GM-CSF (800 ng / ml) and IL-4 (50 ng / ml) were added to promote dendritic cell differentiation, and TNF-α (20 ng / ml) was used to promote in vitro induced maturation. Dendritic cells were incubated with gastric cancer cell lysate (containing MSLN antigen) to allow the dendritic cells to take up MSLN antigen. Dendritic cells loaded with MSLN were co-cultured with mouse T cells to activate T cell immunity. Total RNA was extracted using an RNA extraction kit. cDNA was synthesized using a reverse transcription kit. Scfv gene fragments were amplified from cDNA using PCR technology: specific primers were designed to amplify gene fragments containing the heavy chain variable region (VH), the light chain variable region (VL), and the connecting peptide connecting the two.

[0089] Specifically: VH forward: 5'-CAG GTG CAG CTG GTG GAG TCT GG-3' (SEQ ID NO. 6);

[0090] VH reverse: 5′-GGT GAC CAG GGT TCC CTC AGC-3′ (SEQ ID NO. 7).

[0091] VL: kappa chain forward primer: 5'-GAC ATC CAG ATG ACC CAG TCT CCA-3' (SEQ ID NO. 8);

[0092] κ chain reverse primer: 5′-TGA GGA GAC GGT GAC CAG GGT-3′ (SEQ ID NO. 9);

[0093] λ chain forward primer: 5′-CAG TCT GTG CTG ACT CAG CCA-3′ (SEQ ID NO. 10);

[0094] λ chain reverse primer: 5′-TGA GGA GAC GGT GAC CAG GGT-3′ (SEQ ID NO. 11).

[0095] The amplified Scfv gene fragment is inserted into the phage coat protein gene to display Scfv on the phage surface and construct a Scfv display library.

[0096] 2. Phage library display

[0097] The target antigen protein MSLN is fixed on a solid phase carrier, and the phage library and the antigen-solid phase carrier are incubated in a solution containing a buffer solution (PBS, pH 7.2-7.4) at or at room temperature with gentle shaking for 2 hours to allow Scfv to specifically bind to the antigen. After the incubation is completed, the solid phase carrier is thoroughly washed with a washing buffer to remove phages that are not bound to the antigen or irrelevant components in other display systems. The washed solid phase carrier is mixed with Escherichia coli to allow the phage bound to the antigen to infect the bacteria, and then cultured on a culture plate to form a single colony. The bacteria in each colony contain a phage gene that can express Scfv that binds to the antigen. The three Escherichia coli colonies screened by phage display were selected, and their antigen affinity was tested by ELISA technology. The results are as follows Figure 1 shown. Figure 1 The #1 colony gene antibody shown in has the most significant affinity to the target MSLN antigen.

[0098] Extract the ScFv gene sequence from plasmid #1. Design sequencing primers based on the vector sequence information and known primer sequences, and determine the complete sequence of the ScFv gene by Sanger sequencing or next-generation sequencing (NGS). Determine the corresponding mRNA sequence based on the gene sequence, as shown below:

[0099] From 5' to 3', mRNA includes 5'UTR, coding region, 3'UTR and PoLy A tail;

[0100] The nucleic acid sequence of the coding region is shown in SEQ ID NO.2;

[0101] The nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.3;

[0102] The nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.4;

[0103] The nucleic acid sequence of the PoLy A tail is shown in SEQ ID NO.5.

[0104] Example 1

[0105] an mRNA (MSLN CAR mRNA), which includes, from 5' to 3', a 5'UTR, a coding region, a 3'UTR, and a PoLy A tail;

[0106] The nucleic acid sequence of the coding region is shown in SEQ ID NO.2;

[0107] The nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.3;

[0108] The nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.4;

[0109] The nucleic acid sequence of the PoLy A tail is shown in SEQ ID NO.5.

[0110] Comparative Example 1

[0111] A reported mRNA (MSLN CAR mRNA) expressing the chimeric antigen receptor in Patent Example 2 with application number 201811101203.4.

[0112] Example 2

[0113] A nucleic acid drug (LNP-mRNA (new)), the preparation method is as follows:

[0114] Ionizable lipid SM-102 (5.79 mg), DMG-PEG-maL (0.64 mg), DSPC (1.29 mg), and cholesterol (2.43 mg) were dissolved in anhydrous ethanol and stirred to form a transparent solution A;

[0115] The MSLN CAR mRNA provided in Example 1 was dissolved in a 100 mM acetic acid / sodium acetate buffer solution at pH = 4.7 to form a solution B;

[0116] Solution A and solution B were mixed using a microfluidic mixer to obtain LNPs. Subsequently, the LNPs were dialyzed against Tris-HCl buffer with sucrose in a dialysis cassette. After dialysis, the LNPs were passed through a 0.22 μm filter to prepare LNP-mRNA (new).

[0117] Comparative Example 2

[0118] A nucleic acid drug (LNP-mRNA), which is different from Example 2 in that the mRNA in Example 1 is replaced by the mRNA in Comparative Example 1.

[0119] Test Example 2

[0120] 1. Characterize the two LNP drugs provided in Example 2 and Comparative Example 2.

[0121] Zetasizer Nano ZS (MaLvern Instruments, MaLvernμK) was used to characterize the liposome nanoparticles loaded with MSLN CARmRNA by dynamic light scattering, and the hydrodynamic diameter, concentration, and Zeta potential of the nanoparticles were detected. Experimental steps: The nanoparticles (LNP-mRNA or LNP-mRNA (new)) were suspended in PBS buffer, and nanoparticles without RNA loading were set as controls (Blank LNP), added to the sample pool, and the sample pool was placed on the sample stage of the Zetasizer instrument, and it was ensured that the sample completely covered the measurement light path. The measurement requirements, hydrodynamic diameter, and Zeta potential were selected, and the instrument automatically measured and the data was saved for subsequent analysis. Transmission electron microscopy irradiation: A small amount of nanoparticles were dispersed and dropped on the copper mesh. After drying, uranyl acetate dye was added for 3-5 minutes, and then the excess dye was absorbed with filter paper. After drying, it was placed under a transmission electron microscope for observation and photography.

[0122] The particle size and Zeta potential analyzer test results are as follows Figure 2-Figure 3 The particle morphology was observed by transmission electron microscopy. Figure 4 shown.

[0123] 2. Using Qμant-iT TM The RiboGreen RNA assay kit was used to detect the mRNA content in Example 2 and Comparative Example 2, and the encapsulation efficiency was calculated. Take 6 μL of the RNA standard provided in the kit, add 294 μL of TE buffer, and prepare a 2 μg / mL RNA stock solution. Dilute to 0 / 10 / 25 / 50 / 100 / 250 / 500 / 750 / 1000 ng / mL with TE buffer, and add to a 96-well plate at a volume of 100 μL, respectively. Take 1 μL of Ribogreen dye from each well and dilute to 100 μL with TE buffer, add to the above sample, and incubate at room temperature for 5 minutes. Use an enzyme reader, set the excitation wavelength to 485 nm, the emission wavelength to 528 nm, detect, and record the data to draw a standard curve of fluorescence signal intensity VS mRNA concentration ( Figure 5 ) and the linear regression equation (F = 33534.38C-1350000, R 2 is 0.99564).

[0124] 50 μL of the nanoparticles provided in Example 2 and Comparative Example 2 were mixed with 50 μL of TE buffer and added to a 96-well plate, 1 μL of Ribogreen dye was diluted to 100 μL with TE buffer in each well, added to the above samples, and incubated at room temperature for 5 min. The free RNA concentration (denoted as Cfree) was detected using an ELISA instrument.

[0125] 50 μL of the nanoparticles provided in Example 2 and Comparative Example 2 were mixed with 50 μL of TE-Triton100 (1xTE buffer: Triton = 49:1) and added to a 96-well plate. 1 μL of Ribogreen dye was diluted to 100 μL using TE buffer in each well and added to the above sample, and incubated at room temperature for 5 min. The total RNA concentration (Ctotal) was detected using an ELISA reader.

[0126] LNP-mRNA: Encapsulated RNA concentration (Cencapsulated) = Ctotal - Cfree = 342.95-27.33 = 315.62 ng / μL.

[0127] Encapsulation efficiency (%) = C encapsulation / C total * 100% = 92.03%;

[0128] LNP-mRNA (new): Encapsulated RNA concentration (Cencapsulated) = Ctotal - Cfree = 356.52-30.14 = 326.38 ng / μL.

[0129] Encapsulation efficiency (%) = C encapsulation / C total * 100% = 91.55%.

[0130] 3. In order to compare the difference in application between the MSLN mRNA sequence screened by the present invention and the reported sequence, the transfection efficiency of LNP-encapsulated MSLN CAR mRNA (Example 2 and Comparative Example 2) was studied.

[0131] 3.1 In vitro experimental studies

[0132] Mouse T cell extraction: Mouse T cells were isolated from wild-type 10-14 week old male mice, activated using CD3 / CD28 Dynabeads (Gibco 11453D) and expanded using 100 units / ml recombinant mouse interleukin-2 (R&D Systems 402-ML). T cells were cultured in RPMI 1640 (Invitrogen 11875085) containing 10% fetal bovine serum (AtLanta BioLogicaLs S11150), 4mM glutamine (Invitrogen 25030081), penicillin / streptomycin (Invitrogen 15140122), 1mM sodium pyruvate (Invitrogen 11360079) and 50μM 2-mercaptoethanol (Gibco 21985023).

[0133] 3.2 Verification of transfection efficiency of LNP delivery of MSLN CAR to T cells

[0134] Mouse T cells were incubated with nanoparticles and the treatment groups were as follows:

[0135] (1) Mouse T cells + LNP (liposomes without nucleic acid loading);

[0136] (2) mouse T cells + LNP-mRNA;

[0137] (3) Mouse T cells + LNP-mRNA (new).

[0138] Flow cytometry was used to detect the percentage of T cells transfected with MSLN CAR. The isolated T cells were washed with phosphate buffer. The cell pellet was resuspended in an appropriate amount of PBS, centrifuged (300-500g, 10 minutes), and the supernatant was discarded. The washing step was repeated 2-3 times to remove impurities, cell debris, and residual culture medium components. The washed T cells were counted using an automatic cell counter. According to the requirements of flow cytometry detection, the cell concentration was adjusted to the range of 1×10-1×10 cells / mL. The cells were digested with 0.25% trypsin without EDTA, collected after digestion, centrifuged at 1500 rpm for 5 min, supernatant was discarded, and cells were collected; the cells were resuspended twice with pre-cooled PBS, centrifuged at 1500 rpm for 5 min, and the cells were washed; 5 μL of His-tagged recombinant MSLN was added, mixed, protected from light, and incubated at room temperature for 15 min; 10 μL of Rabbit-anti-His-PE was added, mixed, protected from light, and incubated at room temperature for 15 min, and detected by flow cytometry.

[0139] The percentage of total CD8+T cells was calculated by calculating the results of His+ and CD8+. Figure 6 As shown in Figure 2, LNPs carrying MSLNCAR can significantly improve the transfection efficiency of T cells. At the same time, the transfection efficiency of LNP-mRNA (new) on MSLN is significantly higher than that of LNP-mRNA. Figure 6 shown.

[0140] 4. The killing function of T cells incubated with LNP-mRNA drugs in vitro against mouse gastric cancer cells (MFC cells).

[0141] The T cells incubated in the treatment groups in Section 3.2 (respectively denoted as LNP_T, LNP-mRNA-CAR_T, and LNP-mRNA (new)-CAR_T) were co-cultured with mouse gastric cancer MFC cells for 48 hours. CCK8 technology was used to detect cell proliferation in each group, and flow cytometry combined with Annexin V-FITC / PI double staining kit was used to detect the apoptosis level of MFC cells in each group. The results are as follows Figure 7-Figure 8As shown. The CCK8 proliferation results showed that the mouse T cells treated with LNP-mRNA drugs had a significant inhibitory effect on MFC cells, and the inhibitory effect of LNP-mRNA (new) was significantly higher than that of LNP-mRNA drugs ( Figure 7 ). Flow apoptosis results showed that mouse T cells treated with LNP-mRNA drugs significantly increased the apoptosis level of MFC cells, among which LNP-mRNA (new) increased the killing activity of MFC cells by more than 10% compared with T cells treated with LNP-mRNA, showing a significantly better effect.

[0142] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An anti-mesothelin single-chain antibody, characterized in that The amino acid sequence of the single-chain antibody is shown in SEQ ID NO.

1.

2. A nucleic acid, characterized in that The nucleic acid comprises a nucleotide sequence encoding the anti-mesothelin single-chain antibody according to claim 1.

3. A carrier, characterized in that The vector carries the nucleic acid according to claim 2.

4. A cell, characterized in that The cell carries the nucleic acid of claim 2 , or contains the vector of claim 3 , or expresses the anti-mesothelin single-chain antibody of claim 1 .

5. The cell according to claim 4, characterized in that The cells include T cells.

6. An mRNA, characterized in that The mRNA expresses the single-chain antibody according to claim 1; The mRNA includes 5'UTR, coding region, 3'UTR and PoLy A tail in sequence from 5' to 3'; The nucleic acid sequence of the coding region is shown in SEQ ID NO.

2.

7. The mRNA according to claim 6, characterized in that The nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.3; The nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.4; The nucleic acid sequence of the PoLy A tail is shown in SEQ ID NO.

5.

8. Use of the mRNA according to claim 6 or 7 in the preparation of a drug for treating gastric cancer.

9. A nucleic acid drug, characterized in that: Comprising a delivery vector and the mRNA of claim 6 or 7; The delivery vector is loaded with the mRNA and is used to deliver the mRNA to T cells.

10. The nucleic acid drug according to claim 9, characterized in that: The delivery vector includes ionizable lipids, neutral lipids, cholesterol and MAL-modified long-circulating lipids; The molar ratio of the ionizable lipid, the neutral lipid, the cholesterol and the MAL-modified long-circulating lipid is (45-55):(9-11):(37-40):(1.3-1.7).

Images