Uranyl ion rapid detection biosensor, detection kit and detection method

Abstract

The invention relates to a uranyl ion rapid detection biosensor, a detection kit and a detection method.According to the uranyl ion rapid detection biosensor, a Y-shaped rolling loop mediated triple Walker serves as a signal amplifier, and UO2 < 2 + > is detected through signal amplification; the Y-shaped rolling loop mediated triple Walker comprises an E1 / E2 / E3 / Asist compound, a UO2 < 2 + >-dependent DNAzyme substrate chain, colloidal gold and a buffer solution, the E1 / E2 / E3 / Asist compound comprises a UO2 < 2 + >-dependent DNAzyme enzyme chain and an auxiliary chain Asist, the UO2 < 2 + >-dependent DNAzyme substrate chain contains a fluorescent group, a fluorescence quenching group and rA base co-modification, and the E1 / E2 / E3 / Asist compound contains a fluorescence quenching group and A base co-modification. The kit and the method have high sensitivity and high specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of analysis and detection, and in particular to a uranyl ion rapid detection biosensor, a detection kit and a detection method. Background Art

[0002] Uranium is a naturally occurring radioactive metal with high chemical toxicity and radioactivity and a long half-life. It is often used as a fuel for nuclear energy and weapons production, and is also widely used in industry and medicine. Among the various oxidation states of uranium, the uranyl ion (UO2 2 + ) is the most stable form of uranium in the environment. It can easily penetrate into the soil, contaminate groundwater, and eventually enter the food chain, causing long-term impacts on ecosystems and human health. Therefore, the United States Environmental Protection Agency (USEPA) has determined the maximum contaminant level (MCL) of uranium to be 130nM.

[0003] Currently, conventional UO2 2+ The main detection methods include atomic emission spectroscopy (AES), inductively coupled plasma mass spectrometry (ICP-MS), atomic fluorescence spectroscopy (AFS) and X-ray absorption spectroscopy. These technologies require complex sample pretreatment and expensive equipment, which is not conducive to rapid on-site detection.

[0004] In recent years, the method of using deoxyribozymes (DNAzymes) to detect targets has attracted much attention. Analytical techniques such as fluorescence, electrochemistry, and colorimetry have been established, but most of them show low sensitivity, which limits the widespread application of these technologies.

[0005] Chinese patent document CN 110702760 A discloses a nanogold-DNA mesh electrochemical biosensor for detecting uranyl ions, and its preparation method and application, wherein the biosensor comprises a gold electrode, MCH, thiolated DNAS1 or DNAS2, AuNPs modified with thiolated DNAS1, and AuNPs modified with thiolated DNAS2. The technical solution is to realize double amplification of signals by forming a nanogold-DNA mesh structure on the surface of the gold electrode, and to realize detection of uranyl ions by utilizing the specific cutting of DNAzyme by uranyl ions.

[0006] Therefore, it is urgent to develop a UO2 2+ The detection method makes the detection process simple and fast, reduces costs and is easy to promote. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a rapid detection biosensor for uranyl ions, and to construct a UO2 2+The detection method has a simple and rapid detection process, reduces costs and is easy to promote.

[0008] In order to solve the above technical solution, the technical solution of the present invention is: the uranyl ion rapid detection biosensor uses a Y-shaped rolling ring-mediated triple Walker as a signal amplifier to achieve signal amplification detection of UO2 2+ .

[0009] Preferably, the Y-shaped rolling circle mediated triple Walker includes E1 / E2 / E3 / Assist complex, UO2 2+ Dependent DNAzyme substrate strand, colloidal gold (AuNPs), buffer solution, wherein the E1 / E2 / E3 / Assist complex includes UO2 2+ Dependent DNAzyme enzyme strand Enzyme strand and auxiliary strand Assist, the UO2 2+ The dependent DNAzyme substrate strand contains a fluorescent group (FAM) and a fluorescent quenching group (BHQ1) and is co-modified with an rA base, and the E1 / E2 / E3 / Assist complex contains a fluorescent quenching group (BHQ1) and is co-modified with an A base.

[0010] Preferably, the UO2 2+ The sequence of the dependent DNAzyme substrate strand is shown in SEQ ID NO.1; SEQ ID NO.1 is:

[0011] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'.

[0012] Preferably, the sequence of the E1 / Assist complex is as shown in SEQ ID NO.2, which is:

[0013] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'.

[0014] Preferably, the sequence of the E2 / Assist complex is as shown in SEQ ID NO.3, which is:

[0015] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'.

[0016] Preferably, the sequence of the E3 / Assist complex is as shown in SEQ ID NO.4, which is:

[0017] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'.

[0018] Preferably, rA in the sequence SEQ ID NO.1 is a cleavage site, T(FAM) represents the T base labeling quencher group FAM; T(BHQ1) in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represent the T base labeling fluorescent group BHQ1.

[0019] Preferably, the buffer solution comprises a 50 mM MES buffer solution, wherein the 50 mM MES buffer solution contains 300 mM NaCl and has a pH of 5.5. This simulates physiological conditions for base pairing. The composition, type and pH of the buffer solution may fluctuate within a small range, but are generally stable.

[0020] The reaction principle in this technical solution is: in the presence of UO2 2+ When the target UO2 2+ Specific binding to UO2 2+ The DNA strand is dependent on the DNAzyme strand and activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the Walker to bind to the UO2 adjacent to the ternary 2+ The dependent DNAzyme substrate strand track (state II.) is synchronously bound. The activated Walker can hydrolyze UO2 2+The phosphodiester bond on the substrate strand track of the dependent DNAzyme causes the broken substrate strand to separate the fluorescent group FAM (λex=485nm, λem=525nm; λex is the excitation light wavelength, λem is the emission light wavelength peak) from the quenching group BHQ1 and release it from the AuNPs surface to produce strong fluorescence (state III.). By binding to the ternary new track, the released Y-shaped DNA Walker can start the triple DNAzyme cutting cycle again and gradually walk on the AuNPs surface (states IV.-VIII.). When there is no UO2 in the biosensor system 2+ Since BHQ1 and FAM (state I.) are very close, the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained. DNA Walker mainly consists of three basic components, namely the walking chain, the walking track and the driving motor. The walking chain can be combined with the track and move along the track, and the driving motor provides power for the movement of the walking chain.

[0021] Under optimal conditions, the linear range of the method was from 0.01nM to 1000nM, with a detection limit of 1.8pM. The method also showed significant selectivity for other possible analogs. Actual sample UO2 in environmental water 2+ The analysis showed that this method had good precision and accuracy.

[0022] The technical problem that the present invention also solves is to provide a label-free fluorescence detection method for UO2 2+ The detection kit can detect UO2 with excellent selectivity 2+ The detection has high sensitivity and specificity, the detection process is simple and fast, the cost is reduced, and it is easy to promote.

[0023] In order to solve the above technical solution, the technical solution of the present invention is: the label-free fluorescence detection of UO2 2+ The components of the test kit include: E1 / Assist complex, E2 / Assist complex, E3 / Assist complex, UO2 2+ A dependent DNAzyme substrate strand and a buffer solution, wherein the buffer solution comprises a MES buffer solution, pH=5.5; the sequence of the dependent DNAzyme substrate strand is shown in SEQ ID NO.1; the sequence of the E1 / Assist complex is shown in SEQ ID NO.2; the sequence of the E2 / Assist complex is shown in SEQ ID NO.3; the sequence of the E3 / Assist complex is shown in SEQ ID NO.4;

[0024] Wherein, SEQ ID NO.1 is:

[0025] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3';

[0026] SEQ ID NO.2 is:

[0027] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3';

[0028] SEQ ID NO.3 is:

[0029] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3';

[0030] SEQ ID NO.4 is:

[0031] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'.

[0032] The technical problem to be solved by the present invention is to provide a method for detecting UO2 by using label-free fluorescence. 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The method has high sensitivity, simple and rapid detection process, reduces costs and is easy to promote.

[0033] In order to solve the above technical solution, the technical solution of the present invention is: the label-free fluorescence detection of UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The specific steps are:

[0034] Formation of S1E1 / E2 / E3 / Assist complex: E1, E2 and E3 are mixed in a ratio (1:1:1-1:4:1) (nM) (different mixing ratios will give different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental results); then mixed in MES buffer solution (300 mM NaCl, pH 5.5), heated at 95°C for 5-10 minutes; then slowly cooled to room temperature to form an E1 / E2 / E3 / Assist complex;

[0035] S2Y-shaped rolling circle-mediated triple Walker formation: The E1 / E2 / 3 / Assist complex and the fluorescein FAM / BHQ-labeled substrate chain (FAM-S) were mixed with AuNPs and shaken at 4°C for 24 h; after that, the solution was centrifuged at 13,000 rpm for 25 min and washed three times with sodium phosphate buffer (PBS, 5 M NaCl, 200 mM Na2HPO4 and NaH2PO4, 0.05% Tween 20, pH 7.4); the solution was resuspended in 50 mM MES buffer; the target UO2 2+ After adding to the above mixture, the mixture is incubated for 60 to 120 minutes;

[0036] S3UO2 2+ Detection: The Y-shaped rolling circle-mediated triple Walker was incubated with AuNPs at room temperature for 60 to 120 minutes and the fluorescence signal value was measured; the concentration of the substrate strand cleaved by the enzyme was linearly related to the fluorescence intensity (λex = 485nm, λem = 525nm), thus realizing the detection of UO2 2+ A large number of experiments have shown that each experimental condition has a great influence on the experimental results; the optimal condition of each reaction condition is the corresponding signal-to-noise ratio reaches the maximum; in this way, under the optimal conditions, the experimental effect is achieved.

[0037] The E1 / E2 / E3 / Assist complex, UO2 2+ The dependent DNAzyme substrate strand, colloidal gold (AuNPs) and buffer solution were all used for label-free fluorescence detection of UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ Any of the methods described in .

[0038] UO2 exists 2+ When the target UO2 2+ Specific binding to UO2 2+ The DNA strand is dependent on the DNAzyme strand and activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the Walker to bind to the UO2 adjacent to the ternary2+ Dependent DNAzyme substrate strand track (state II.) Synchronous binding; activated Walker can hydrolyze UO2 2+ The phosphodiester bond on the substrate strand track of the dependent DNAzyme causes the broken substrate strand to separate the fluorescent group FAM (λex=485nm, λem=525nm; λex is the excitation light wavelength, λem is the emission light wavelength peak) from the quenching group BHQ1 and release it from the AuNPs surface to produce strong fluorescence (state III.). By binding to the ternary new track, the released Y-shaped DNA Walker can start the triple DNAzyme cutting cycle again and gradually walk on the AuNPs surface (states IV.-VIII.). When there is no UO2 in the biosensor system 2+ When BHQ1 and FAM (state I) are in close proximity, the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained.

[0039] Compared with the prior art, the present invention has the following beneficial effects: the method calculates UO2 2+ The concentration makes the detection process fast and simple, with high sensitivity, specificity and excellent selectivity; it can also reduce costs and be easy to promote, while also being able to detect UO2 in the environment. 2+ Rapid detection is of great significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The present invention adopts label-free fluorescence detection of UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ Schematic diagram of the method;

[0041] Figure 2 The present invention adopts label-free fluorescence detection of UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The method was used to analyze the different concentrations of UO2 2+ The test result diagram; A is the different UO2 under the condition of λex=485nm 2+ The emission spectrum corresponding to the concentration; B is the emission spectrum of F under the condition of λex=485nm λem = Fluorescence standard curve obtained at 525 nm;

[0042] Figure 3 The present invention adopts label-free fluorescence detection of UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+The method is used to analyze the different concentrations of UO2 2+ The specific detection experimental results are shown in Figure 2; A is the concentration of strontium ions (Sr 2+ ), cesium ion (Cs 2+ ), cadmium ion (Cd 2+ ), manganese ion (Mn 2+ ), copper ion (Cu 2+ ), zinc ion (Zn 2+ ), chromium ion (Cr 3+ ), lead ion (Pb 2+ ), thiamethoxam (TMX), atrazine (AT) and penicillin (PCN); B is the fluorescence standard curve of Figure 3 The fluorescence value corresponding to A at 525nm. DETAILED DESCRIPTION

[0043] In order to deepen the understanding of the present invention, the present invention will be further described in detail below in conjunction with embodiments. The embodiments are only used to explain the present invention and do not limit the protection scope of the present invention.

[0044] Example: The uranyl ion rapid detection biosensor uses a Y-shaped rolling circle-mediated triple Walker as a signal amplifier to achieve signal amplification detection of UO2 2+ The Y-shaped rolling ring-mediated triple Walker includes E1 / E2 / E3 / Assist complex, UO2 2+ Dependent DNAzyme substrate strand, colloidal gold (AuNPs), buffer solution, wherein the E1 / E2 / E3 / Assist complex includes UO2 2+ Dependent DNAzyme enzyme strand Enzyme strand and auxiliary strand Assist, the UO2 2+ The dependent DNAzyme substrate strand contains a fluorescent group (FAM) and a fluorescent quenching group (BHQ1) and is co-modified with the rA base, and the E1 / E2 / E3 / Assist complex contains a fluorescent quenching group (BHQ1) and is co-modified with the A base;

[0045] The UO2 2+ The sequence of the dependent DNAzyme substrate strand is shown in SEQ ID NO.1; SEQ ID NO.1 is:

[0046] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3';

[0047] The sequence of the E1 / Assist complex is shown in SEQ ID NO.2, which is:

[0048] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3';

[0049] The sequence of the E2 / Assist complex is shown in SEQ ID NO.3, which is:

[0050] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3';

[0051] The sequence of the E3 / Assist complex is shown in SEQ ID NO.4, which is:

[0052] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3';

[0053] The rA in the sequence SEQ ID NO.1 is a cleavage site, and T (FAM) represents the T base-labeled quenching group FAM; the T (BHQ1) in the sequence SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represent the T base-labeled fluorescent group BHQ1;

[0054] The buffer solution includes a 50 mM MES buffer solution, wherein the 50 mM MES buffer solution contains 300 mM NaCl and has a pH of 5.5, which simulates physiological conditions for base pairing. The composition, type and pH of the buffer solution may fluctuate within a small range, but are generally stable.

[0055] like Figure 1 As shown, the reaction principle of this technical solution is: in the presence of UO2 2+ When the target UO2 2+ Specific binding to UO2 2+The DNA strand is dependent on the DNAzyme strand and activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the Walker to bind to the UO2 adjacent to the ternary 2+ The dependent DNAzyme substrate strand track (state II.) is synchronously bound. The activated Walker can hydrolyze UO2 2+ The phosphodiester bond on the substrate strand track of the dependent DNAzyme causes the broken substrate strand to separate the fluorescent group FAM (λex=485nm, λem=525nm; λex is the excitation light wavelength, λem is the emission light wavelength peak) from the quenching group BHQ1 and release it from the AuNPs surface to produce strong fluorescence (state III.). By binding to the ternary new track, the released Y-shaped DNA Walker can start the triple DNAzyme cutting cycle again and gradually walk on the AuNPs surface (state IV-VIII.). When there is no UO2 in the biosensor system 2+ When BHQ1 and FAM (state I) are in close proximity, the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained.

[0056] Under optimal conditions, the linear range of the method was from 0.01nM to 1000nM, with a detection limit of 1.8pM. The method also showed significant selectivity for other possible analogs. Actual sample UO2 in environmental water 2+ The analysis showed that this method had good precision and accuracy.

[0057] Example 1: Label-free fluorescence detection of UO2 2+ The components of the test kit include: E1 / Assist complex, E2 / Assist complex, E3 / Assist complex, UO2 2+ A dependent DNAzyme substrate strand and a buffer solution, wherein the buffer solution includes a MES buffer solution, pH=5.5; the sequence of the dependent DNAzyme substrate strand is shown in SEQ ID NO.1; the sequence of the E1 / Assist complex is shown in SEQ ID NO.2; the sequence of the E2 / Assist complex is shown in SEQ ID NO.3; the sequence of the E3 / Assist complex is shown in SEQ ID NO.4;

[0058] Wherein, SEQ ID NO.1 is:

[0059] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3';

[0060] SEQ ID NO.2 is:

[0061] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3';

[0062] SEQ ID NO.3 is:

[0063] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3';

[0064] SEQ ID NO.4 is:

[0065] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3';

[0066] The label-free fluorescence detection of UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The specific steps are:

[0067] Formation of S1E1 / E2 / E3 / Assist complex: E1, E2 and E3 were mixed in a ratio (1:1:1-1:4:1) (nM) (different mixing ratios will give different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental results); then mixed in MES buffer solution (300 mM NaCl, pH 5.5), heated at 95°C for 5-10 minutes; then slowly cooled to room temperature to form an E1 / E2 / E3 / Assist complex;

[0068] S2Y-shaped rolling circle-mediated triple Walker formation: E1 / E2 / 3 / Assist complex and fluorescein FAM / BHQ-labeled substrate chain (FAM-S) were mixed with AuNPs at a molar ratio of 50:150:1 and shaken at 4°C for 24 h; after that, the solution was centrifuged at 13,000 rpm for 25 min and washed three times with sodium phosphate buffer (PBS, 5 M NaCl, 200 mM Na2HPO4 and NaH2PO4, 0.05% Tween 20, pH 7.4); the solution was resuspended in 50 mM MES buffer; the target UO2 2+ After adding to the above mixture, the mixture was incubated for 80 minutes;

[0069] S3UO2 2+ Detection: The Y-shaped rolling circle-mediated triple Walker was incubated with AuNPs at room temperature for 80 minutes and the fluorescence signal value was measured; the concentration of the substrate strand cleaved by the enzyme was linearly related to the fluorescence intensity (λex=485nm, λem=525nm), thus realizing the detection of UO2 2+ The Aptamer / Catalyst, Initiator 1 / Initiator 2 / Assist, Magnesium ion-dependent DNAzyme enzyme strand, Magnesium ion-dependent DNAzyme substrate strand, and buffer system are as described in any of the above items. 2+ When the target UO2 2+ Specific binding to UO2 2+ The DNA strand is dependent on the DNAzyme strand and activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the Walker to bind to the UO2 adjacent to the ternary 2+ Dependent DNAzyme substrate strand track (state II.) Synchronous binding; activated Walker can hydrolyze UO2 2+ The phosphodiester bond on the substrate strand track of the dependent DNAzyme causes the broken substrate strand to separate the fluorescent group FAM (λex=485nm, λem=525nm; λex is the excitation light wavelength, λem is the emission light wavelength peak) from the quenching group BHQ1 and release it from the AuNPs surface to produce strong fluorescence (state III.). By combining with the ternary new track, the released Y-shaped DNA Walker can start the triple DNAzyme cutting cycle again and gradually walk on the AuNPs surface (state IV.-VIII.). When there is no UO2 in the biosensor system2+ When BHQ1 and FAM (state I) are in close proximity, the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained.

[0070] Example 2: Using label-free fluorescence to detect UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The method was used to analyze the different concentrations of UO2 2+ To conduct the test, the specific steps are as follows:

[0071] First, prepare UO2 2+ Standard solutions, with concentrations of 0, 0.1nM, 0.5nM, 1nM, 100nM, 200nM, 300nM, 400nM, 500nM, 700nM, 900nM, 1000nM, 2000nM and 5000nM, stored at 4°C;

[0072] Different concentrations of UO2 2+ The solutions were added to the reaction system described in Example 1, and the fluorescence intensity was observed after sufficient reaction. Figure 2 ( Figure 2 A: Under the condition of λex=485nm, different UO2 2+ Emission spectrum corresponding to the concentration; Figure 2 B in: Under the condition of λex=485nm, F λem =525nm fluorescence standard curve), 1.8pM UO2 2+ It can produce obvious fluorescence changes, indicating that its detection limit is 1.8pM. 2+ As the concentration increases, the fluorescence intensity also increases and gradually approaches saturation.

[0073] Example 3: Using label-free fluorescence to detect UO2 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The method was used to analyze the different concentrations of UO2 2+ The specific detection steps are as follows:

[0074] Prepare 0, 100nM, 200nM, and 500nM standard solutions of other metal ions and small molecules that may coexist in water environments. They are strontium ion (Sr 2+ ), cesium ion (Cs 2+ ), cadmium ion (Cd 2+ ), manganese ion (Mn 2+ ), copper ion (Cu 2+ ), zinc ion (Zn 2+ ), chromium ion (Cr 3+ ), lead ion (Pb2+ ), thiamethoxam (TMX), atrazine (AT), and penicillin (PCN);

[0075] The interfering substance standard solutions of different concentrations (0, 100 nM, 200 nM, 500 nM) and UO2 2+ The solutions were added to the reaction system of the method in Example 1, and the fluorescence intensity change was observed after sufficient reaction. The fluorescence intensity change was as follows: Figure 3 As shown, Figure 3 A in the figure is the standard fluorescence curve. Figure 3 B in Figure 3 The fluorescence value of A at 525 nm is Figure 3 Both A and B in Figure 1 show different concentrations of strontium ions (Sr 2+ ), cesium ion (Cs 2+ ), cadmium ion (Cd 2+ ), manganese ion (Mn 2+ ), copper ion (Cu 2 + ), zinc ion (Zn 2+ ), chromium ion (Cr 3+ ), lead ion (Pb 2+ ), thiamethoxam (TMX), atrazine (AT) and penicillin (PCN) were much lower than that of UO2 2+ This proves that this method is effective for UO2 2+ The detection has good specificity.

[0076] For those skilled in the art, the above embodiments are merely illustrative descriptions of the present invention, and the above embodiments are preferred implementations of the present invention. Obviously, the specific implementation of the present invention is not limited to the above methods, and any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are within the protection scope of the present invention.

[0077]

Claims

1. A biosensor for rapid detection of uranyl ions, characterized in that: The uranyl ion rapid detection biosensor uses a Y-shaped rolling circle-mediated triple Walker as a signal amplifier to achieve signal amplification detection of UO2 2+ .

2. The uranyl ion rapid detection biosensor according to claim 1, characterized in that: The Y-shaped rolling ring-mediated triple Walker includes E1 / E2 / E3 / Assist complex, UO2 2+ Dependent DNAzyme substrate chain Substratestrand, colloidal gold, buffer solution, wherein the E1 / E2 / E3 / Assist complex includes UO2 2+ Dependent DNAzyme enzyme strand Enzyme strand and auxiliary strand Assist, the UO2 2+ The dependent DNAzyme substrate strand contains a fluorescent group FAM and a fluorescent quenching group BHQ1 and is co-modified with an rA base, and the E1 / E2 / E3 / Assist complex contains a fluorescent quenching group BHQ1 and is co-modified with an A base.

3. The uranyl ion rapid detection biosensor according to claim 2, characterized in that: The UO2 2+ The sequence of the dependent DNAzyme substrate strand is shown in SEQ ID NO.1; SEQ ID NO.1 is: 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'.

4. The uranyl ion rapid detection biosensor according to claim 3, characterized in that: The sequence of the E1 / Assist complex is shown in SEQ ID NO.2, which is: 5'- GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'.

5. The uranyl ion rapid detection biosensor according to claim 4, characterized in that: The sequence of the E2 / Assist complex is shown in SEQ ID NO.3, which is: 5'- GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'.

6. The uranyl ion rapid detection biosensor according to claim 5, characterized in that: The sequence of the E3 / Assist complex is shown in SEQ ID NO.4, which is: 5'- GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAATCCTCTAGTACTCAAAAAAAA-3'.

7. The uranyl ion rapid detection biosensor according to claim 6, characterized in that: The rA in the sequence SEQ ID NO.1 is a cleavage site, and T (FAM) represents the T base-labeled quenching group FAM; the T (BHQ1) in the sequence SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represent the T base-labeled fluorescent group BHQ1.

8. The uranyl ion rapid detection biosensor according to claim 2, characterized in that: The buffer solution includes a 50 mM MES buffer solution, wherein the 50 mM MES buffer solution contains 300 mM NaCl and has a pH of 5.

5.

9. A label-free fluorescence detection method for UO2 2+ The detection kit is characterized in that The label-free fluorescence detection of UO2 2+ The components of the test kit include: E1 / Assist complex, E2 / Assist complex, E3 / Assist complex, UO2 2+ A dependent DNAzyme substrate strand and a buffer solution, wherein the buffer solution comprises a MES buffer solution, pH=5.5; the sequence of the dependent DNAzyme substrate strand is shown in SEQ ID NO.1; the sequence of the E1 / Assist complex is shown in SEQ ID NO.2; the sequence of the E2 / Assist complex is shown in SEQ ID NO.3; the sequence of the E3 / Assist complex is shown in SEQ ID NO.4; Wherein, SEQ ID NO.1 is: 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'; SEQ ID NO.2 is: 5'- GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'; SEQ ID NO.3 is: 5'- GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'; SEQ ID NO.4 is: 5'- GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAATCCTCTAGTACTCAAAAAAAA-3'.

10. A method for detecting UO2 using label-free fluorescence 2+ Label-free fluorescence detection of UO2 using a detection kit 2+ The method is characterized in that The specific steps are: S1 Formation of E1 / E2 / E3 / Assist complex: E1, E2 and E3 are mixed in proportion; then mixed in MES buffer solution, heated at 95°C for 5-10 minutes; then slowly cooled to room temperature, so that E1 / E2 / E3 / Assist complex is formed; S2 Y-shaped rolling circle-mediated triple Walker formation: The E1 / E2 / 3 / Assist complex and the fluorescein FAM / BHQ-labeled substrate chain FAM-S were mixed with AuNPs and shaken at 4°C for 24 h; then, the solution was centrifuged at 13,000 rpm for 25 min and washed three times with sodium phosphate buffer; the solution was resuspended in 50 mM MES buffer; the target UO2 2+ After adding to the above mixture, the mixture is incubated for 60 to 120 minutes; S3UO2 2+ Detection: Y-shaped rolling circle-mediated triple Walker was incubated with AuNPs at room temperature for 60-120 minutes and the fluorescence signal value was measured; the concentration of the substrate strand cleaved by enzyme was linearly related to the fluorescence intensity, thus realizing the detection of UO2 2 + purpose.

Images