Uranyl Ion Rapid Detection Biosensor, Detection Kit and Detection Method
Through the Y-shaped rolling ring-mediated triple Walker signal amplifier and UO22+-dependent DNAzyme substrate chain, the complex and cost-effective uranyl ion detection in the prior art is solved, and fast, simple and highly sensitive uranyl ion detection is achieved.
Patent Information
- Application Number
- CN202411957459.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2044-12-30
AI Technical Summary
The existing uranyl ion detection methods require complex sample pretreatment and expensive equipment, are not suitable for rapid on-site inspection, and have low sensitivity, making them difficult to widely use.
Using a Y-shaped rolling ring-mediated triple Walker as a signal amplifier, UO22+-dependent DNAzyme substrate chain and colloidal gold detects uranyl ions through fluorescent signals, and a detection method with high sensitivity and excellent selectivity is constructed.
It realizes rapid and simple detection of uranyl ions, reduces costs, has high sensitivity and specificity, and is suitable for promotion and application.
Smart Images

Figure CN119757300B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of analytical detection, and particularly to a rapid detection biosensor for uranyl ions, a detection kit, and a detection method. Background Art
[0002] Uranium is a natural radioactive metal with high chemical toxicity, radioactivity, and a long half-life. It is often used as a fuel for nuclear energy and weapon production and also has extensive applications in industrial and medical fields. Among various oxidation states of uranium, uranyl ion (UO2 2 + 2+) is the most stable form of uranium in the environment. It can easily penetrate into the soil, contaminate groundwater, and ultimately enter the food chain, causing long-term impacts on the ecosystem and human health. Therefore, the US Environmental Protection Agency (USEPA) has determined the maximum contaminant level (MCL) of uranium to be 130 nM.
[0003] Currently, conventional methods for UO2 2+ detection mainly include atomic emission spectroscopy (AES), inductively coupled plasma mass spectrometry (ICP-MS), atomic fluorescence spectrometry (AFS), and X-ray absorption spectroscopy. These techniques require complex sample pretreatment and expensive equipment, which are not conducive to rapid on-site detection.
[0004] In recent years, methods for detecting target substances using deoxyribozyme (DNAzyme) have received much attention, and analytical techniques such as fluorescence, electrochemistry, and colorimetry have been established. However, most of them show low sensitivity, thus limiting the wide application of these techniques.
[0005] Chinese Patent Document CN 110702760 A discloses a nano-gold_DNA network structure electrochemical biosensor for detecting uranyl ions, its preparation method, and application. The biosensor includes a gold electrode, MCH, thiolated DNAS1 or DNAS2, AuNPs modified with thiolated DNAS1, and AuNPs modified with thiolated DNAS2. This technical solution realizes double amplification of signals by forming a nano-gold-DNA network structure on the surface of the gold electrode and detects uranyl ions by the specific cleavage of DNAzyme by uranyl ions.
[0006] Therefore, there is an urgent need to develop a detection method for UO2 2+ with high sensitivity and excellent selectivity, making the detection process simple, rapid, reducing costs, and being easy to promote. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to provide a rapid detection biosensor for uranyl ions, which constructs a UO2 2+Detection method, with a simple and rapid detection process, low cost, and easy to promote.
[0008] To solve the above technical problems, the technical solution of the present invention is: The rapid uranium ion detection biosensor uses Y-shaped rolling circle-mediated triple Walker as a signal amplifier to achieve signal amplification for detecting UO2 2+ .
[0009] Preferably, the Y-shaped rolling circle-mediated triple Walker includes E1 / E2 / E3 / Assist complex, UO2 2+ -dependent DNAzyme substrate strand Substrate strand, colloidal gold (AuNPs), and buffer solution, wherein the E1 / E2 / E3 / Assist complex includes UO2 2+ -dependent DNAzyme enzyme strand Enzyme strand and assist strand Assist, and the UO2 2+ -dependent DNAzyme substrate strand Substrate strand is co-modified with a fluorophore (FAM), a fluorescence quenching group (BHQ1), and rA bases, and the E1 / E2 / E3 / Assist complex is co-modified with a fluorescence quenching group (BHQ1) and A bases.
[0010] Preferably, the sequence of the UO2 2+ -dependent DNAzyme substrate strand Substrate strand is as shown in SEQ ID NO.1; SEQ ID NO.1 is:
[0011] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'.
[0012] Preferably, the sequence of E1 is as shown in SEQ ID NO.2, and SEQ ID NO.2 is:
[0013] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'.
[0014] Preferably, the sequence of E2 is as shown in SEQ ID NO.3, and SEQ ID NO.3 is:
[0015] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'.
[0016] Preferably, the sequence of the E3 is as shown in SEQ ID NO.4, and SEQ ID NO.4 is:
[0017] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'.
[0018] Preferably, rA in the sequence SEQ ID NO.1 is the cleavage site, and T(FAM) represents that the T base is labeled with the quenching group FAM; T(BHQ1) in the SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represents that the T base is labeled with the fluorescent group BHQ1.
[0019] Preferably, the buffer solution includes a 50 mM MES buffer solution. The 50 mM MES buffer solution contains 300 mM NaCl, and its pH is 5.5. This simulates physiological conditions for base pairing. The composition, type and pH of the buffer solution can fluctuate within a small range, but are generally basically stable.
[0020] The reaction principle in this technical solution is: when there is UO2 2+ the target UO2 2+ specifically binds to the UO2 2+ -dependent DNAzyme enzyme strand Enzyme strand and activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the synchronous binding of the Walker to the UO2 2+ -dependent DNAzyme substrate strand Substrate strand track (state II.). The activated Walker can hydrolyze UO2 2+The phosphodiester bond on the substrate strand of the DNAzyme-dependent substrate strand causes the broken substrate strand to separate the fluorophore FAM (λex = 485 nm, λem = 525 nm; λex is the excitation wavelength and λem is the peak emission wavelength) from the quencher BHQ1 and release it from the surface of AuNPs simultaneously, generating strong fluorescence (State III.). By binding to the ternary new track, the released Y-shaped DNA Walker can restart the triple DNAzyme cleavage cycle and gradually move on the AuNPs surface (States IV.-VIII.). When there is no UO2 in the biosensing system 2+ At this time, since BHQ1 and FAM (State I.) are very close, the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained. The DNA Walker mainly consists of three basic components, namely the walking strand, the walking track, and the driving motor. The walking strand can bind to the track and move along the track, and the driving motor provides power for the movement of the walking strand.
[0021] Under the optimal conditions, the linear range of this method is from 0.01 nM to 1000 nM, and the detection limit is 1.8 pM. This method also shows significant selectivity for other possible analogues. For the actual sample of environmental water sample UO2 2+ Analysis shows that this method has good precision and accuracy.
[0022] Another technical problem to be solved by the present invention is to provide a label-free fluorescence detection kit for UO2 2+ which can detect UO2 with excellent selectivity 2+ and has high sensitivity and specificity in detection. The detection process is simple, fast, reduces costs, and is easy to promote.
[0023] To solve the above technical solutions, the technical solution of the present invention is: The components of the label-free fluorescence detection kit for UO2 2+ include: E1, E2, E3, the UO2 2+ -dependent DNAzyme substrate strand and a buffer solution. The buffer solution includes MES buffer solution with pH = 5.5; the sequence of the UO2
[0024] -dependent DNAzyme substrate strand is as shown in SEQ ID NO.1; the sequence of E1 is as shown in SEQ ID NO.2; the sequence of E2 is as shown in SEQ ID NO.3; the sequence of E3 is as shown in SEQ ID NO.4;
[0025] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3';
[0026] SEQ ID NO.2 is:
[0027] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3';
[0028] SEQ ID NO.3 is:
[0029] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3';
[0030] SEQ ID NO.4 is:
[0031] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'.
[0032] The technical problem to be solved by the present invention is to provide a method for label-free fluorescence detection of UO2 2+ using a label-free fluorescence detection kit for UO2 2+ with high sensitivity, simple and rapid detection process, reduced cost and easy to promote.
[0033] To solve the above technical problem, the technical solution of the present invention is: the method for label-free fluorescence detection of UO2 2+ using a label-free fluorescence detection kit for UO2 2+ specifically comprises the following steps:
[0034] Formation of S1 E1 / E2 / E3 / Assist complex: Mix E1, E2, and E3 in proportion (1:1:1 - 1:4:1) (nM) (different mixing ratios will result in different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental result); then mix in MES buffer solution (300 mM NaCl, pH 5.5), heat at 95 °C for 5 - 10 minutes; subsequently cool slowly to room temperature to form the E1 / E2 / E3 / Assist complex;
[0035] S2 Formation of Y-shaped rolling circle-mediated triple Walker: Mix the E1 / E2 / E3 / Assist complex and the substrate strand labeled with fluorescein FAM / BHQ (FAM-S) with AuNPs, and shake at 4 °C for 24 h; then, centrifuge the solution at 13,000 rpm for 25 minutes and wash 3 times with sodium phosphate buffer (PBS, 5M NaCl, 200 mM Na2HPO4 and NaH2PO4, 0.05% Tween 20, pH 7.4); resuspend the solution in 50 mM MES buffer; After adding the target UO2 2+ to the above mixture, incubate the mixture for 60 - 120 minutes;
[0036] S3 UO2 2+ Detection: Measure the fluorescence signal value after incubating the Y-shaped rolling circle-mediated triple Walker with AuNPs at room temperature for 60 - 120 minutes; According to the linear relationship between the concentration of the digested substrate strand Substrate strand and the fluorescence intensity (λex = 485 nm, λem = 525 nm), the detection of UO2 2+ is achieved. A large number of experiments have shown that each experimental condition has a great impact on the experimental result; the optimal condition for each reaction condition is that the corresponding signal-to-noise ratio reaches the maximum; thus, under the optimal conditions, the experimental effect is achieved.
[0037] The E1 / E2 / E3 / Assist complex, UO2 2+ -dependent DNAzyme substrate strand Substrate strand, colloidal gold (AuNPs), and buffer solution are all described in any of the methods for label-free fluorescence detection of UO2 2+ using a label-free fluorescence detection kit for UO2 2+ described.
[0038] In the presence of UO2 2+ the target UO2 2+ specifically binds to UO2 2+The dependent DNAzyme enzyme strand activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the synchronous binding of the Walker to the ternary adjacent UO2 2+ dependent DNAzyme substrate strand orbit (state II.); the activated Walker can hydrolyze the phosphodiester bond on the UO2 2+ dependent DNAzyme substrate strand orbit, resulting in the broken substrate strand that separates the fluorophore FAM (λex = 485 nm, λem = 525 nm; λex is the excitation wavelength, λem is the peak emission wavelength) from the quencher BHQ1 and releases it from the AuNPs surface simultaneously, generating strong fluorescence (state III.). By binding to the ternary new trajectory, the released Y-shaped DNA Walker can initiate the triple DNAzyme cleavage cycle again and gradually walk on the AuNPs surface (states IV.-VIII.). When there is no UO2 2+ in the biosensing system, due to the very close proximity of BHQ1 and FAM (state I.), the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained.
[0039] Compared with the prior art, the beneficial effects of the present invention are: this method calculates the UO2 2+ concentration through the fluorescence signal, making the detection process fast, simple, with high sensitivity, specificity and excellent selectivity; and it can reduce costs, is easy to promote, and is of great significance for the rapid detection of UO2 2+ in the environment. Brief Description of the Drawings
[0040] Figure 1 It is the schematic diagram of the method for label-free fluorescence detection of UO2 2+ using the detection kit of the present invention; 2+ the method for label-free fluorescence detection of UO2
[0041] Figure 2 It is the result diagram of the method for label-free fluorescence detection of UO2 2+ using the detection kit of the present invention for detecting different concentrations of UO2 2+ ; among them, A is the emission optical spectrum diagram corresponding to different UO2 2+ concentrations under the condition of λex = 485 nm; B is the fluorescence standard curve diagram obtained at F 2+ = 525 nm under the condition of λex = 485 nm; λem = 525 nm;
[0042] Figure 3This invention uses a label-free fluorescence detection kit for UO2 2+ to perform label-free fluorescence detection of UO2 2+ The method for the specific detection experiment results of UO2 at different concentrations 2+ ; where A is the fluorescence standard curves of strontium ions (Sr 2+ ), cesium ions (Cs 2+ ), cadmium ions (Cd 2+ ), manganese ions (Mn 2+ ), copper ions (Cu 2+ ), zinc ions (Zn 2+ ), chromium ions (Cr 3+ ), lead ions (Pb 2+ ), thiamethoxam (TMX), atrazine (AT) and penicillin (PCN); B is Figure 3 the fluorescence value corresponding to A in at 525 nm. Detailed implementation manners
[0043] To deepen the understanding of this invention, the following will further describe this invention in detail with reference to embodiments. These embodiments are only used to explain this invention and do not limit the protection scope of this invention.
[0044] Embodiment: The rapid detection biosensor for uranyl ions uses a Y-shaped rolling circle-mediated triple Walker as a signal amplifier to achieve signal amplification detection of UO2 2+ ; The Y-shaped rolling circle-mediated triple Walker includes an E1 / E2 / E3 / Assist complex, a UO2 2+ -dependent DNAzyme substrate strand Substrate strand, colloidal gold (AuNPs), and a buffer solution. Among them, the E1 / E2 / E3 / Assist complex includes a UO2 2+ -dependent DNAzyme enzyme strand Enzyme strand and an assist strand Assist. The UO2 2+ -dependent DNAzyme substrate strand Substrate strand is co-modified with a fluorescent group (FAM), a fluorescence quenching group (BHQ1), and rA bases. The E1 / E2 / E3 / Assist complex is co-modified with a fluorescence quenching group (BHQ1) and A bases;
[0045] The sequence of the UO2 2+ -dependent DNAzyme substrate strand Substrate strand is shown in SEQ ID NO.1; SEQ ID NO.1 is:
[0046] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3';
[0047] The sequence of E1 is shown in SEQ ID NO.2, and SEQ ID NO.2 is:
[0048] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3';
[0049] The sequence of E2 is shown in SEQ ID NO.3, and SEQ ID NO.3 is:
[0050] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3';
[0051] The sequence of E3 is shown in SEQ ID NO.4, and SEQ ID NO.4 is:
[0052] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3';
[0053] The rA in the sequence SEQ ID NO.1 is the cleavage site, and T(FAM) represents the T base labeled with the quenching group FAM; T(BHQ1) in the SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represents the T base labeled with the fluorescent group BHQ1;
[0054] The buffer solution includes a 50 mM MES buffer solution. The 50 mM MES buffer solution contains 300 mM NaCl and has a pH of 5.5; this is to simulate physiological conditions for base pairing. The composition, type and pH of the buffer solution can fluctuate within a small range, but are generally basically stable.
[0055] As Figure 1 shown, the reaction principle of this technical solution is: in the presence of UO2 2+ the target UO2 2+Specifically bind to UO2 2+ Dependent DNAzyme enzyme strand and activate the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the synchronous binding of the Walker to the ternary adjacent UO2 2+ Dependent DNAzyme substrate strand track (state II.). The activated Walker can hydrolyze the phosphodiester bond on the UO2 2+ Dependent DNAzyme substrate strand track, resulting in the broken substrate strand that separates the fluorophore FAM (λex = 485nm, λem = 525nm; λex is the excitation wavelength, λem is the peak emission wavelength) from the quencher BHQ1 and releases it from the AuNPs surface simultaneously, generating strong fluorescence (state III.). By binding to the ternary new track, the released Y-shaped DNA Walker can initiate the triple DNAzyme cleavage cycle again and gradually move on the AuNPs surface (states IV-VIII.). When there is no UO2 2+ in the biosensing system, due to the very close proximity of BHQ1 and FAM (state I.), the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained.
[0056] Under the optimal conditions, the linear range of this method is from 0.01 nM to 1000 nM, and the detection limit is 1.8 pM. This method also shows significant selectivity for other possible analogs. The actual environmental water sample of UO2 2+ analysis shows that this method has good precision and accuracy.
[0057] Example 1: The components of the label-free fluorescence detection kit for UO2 2+ include: E1, E2, E3, UO2 2+ Dependent DNAzyme substrate strand and buffer. The buffer solution includes MES buffer solution with pH = 5.5; the sequence of the dependent DNAzyme substrate strand is shown as SEQ ID NO.1; the sequence of E1 is shown as SEQ ID NO.2; the sequence of E2 is shown as SEQ ID NO.3; the sequence of E3 is shown as SEQ ID NO.4;
[0058] Among them, SEQ ID NO.1 is:
[0059] 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3';
[0060] SEQ ID NO. 2 is:
[0061] 5'-GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3';
[0062] SEQ ID NO. 3 is:
[0063] 5'-GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3';
[0064] SEQ ID NO. 4 is:
[0065] 5'-GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3';
[0066] The method for label-free fluorescence detection of UO2 2+ using a label-free fluorescence detection kit for UO2 2+ is as follows:
[0067] Formation of the S1E1 / E2 / E3 / Assist complex: Mix E1, E2, and E3 in a ratio of 1:1:1 - 1:4:1 (nM) (different mixing ratios will result in different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental result); then mix them in MES buffer solution (300 mM NaCl, pH 5.5), heat at 95°C for 5 - 10 minutes; then slowly cool to room temperature to form the E1 / E2 / E3 / Assist complex;
[0068] S2 Y-shaped rolling circle-mediated triple Walker formation: Mix the E1 / E2 / E3 / Assist complex and the fluorescein FAM / BHQ-labeled substrate strand (FAM-S) with AuNPs at a molar ratio of 50:150:1 and shake at 4 °C for 24 h; then, centrifuge the solution at 13,000 rpm for 25 minutes and wash it 3 times with sodium phosphate buffer (PBS, 5 M NaCl, 200 mM Na2HPO4 and NaH2PO4, 0.05% Tween 20, pH 7.4); resuspend the solution in 50 mM MES buffer; add the target UO2 2+ to the above mixture and incubate the mixture for 80 minutes;
[0069] S3 UO2 2+ Detection: Measure the fluorescence signal value after incubating the Y-shaped rolling circle-mediated triple Walker with AuNPs at room temperature for 80 minutes; according to the linear relationship between the concentration of the cleaved substrate strand and the fluorescence intensity (λex = 485 nm, λem = 525 nm), the detection of UO2 2+ is achieved. The Aptamer / Catalyst, Initiator 1 / Initiator 2 / Assist, magnesium ion-dependent DNAzyme enzyme strand, magnesium ion-dependent DNAzyme substrate strand, buffer system are as described in any one of the above. In the presence of UO2 2+ , the target UO2 2+ specifically binds to the UO2 2+ -dependent DNAzyme enzyme strand and activates the Y-shaped rolling circle-mediated DNA Walker. This activation triggers the synchronous binding of the Walker to the triple adjacent UO2 2+ -dependent DNAzyme substrate strand track (state II.); the activated Walker can hydrolyze the phosphodiester bond on the UO2 2+ -dependent DNAzyme substrate strand track, resulting in the broken substrate strand separating the fluorophore FAM (λex = 485 nm, λem = 525 nm; λex is the excitation light wavelength, λem is the emission light wavelength peak) from the quenching group BHQ1 and releasing it from the surface of AuNPs simultaneously, generating strong fluorescence (state III.). By binding to the triple new trajectory, the released Y-shaped DNA Walker can restart the triple DNAzyme cleavage cycle and gradually move on the surface of AuNPs (states IV.-VIII.). When there is no UO2 in the biosensing system2+ When BHQ1 and FAM are very close (State I.), the Y-shaped rolling circle-mediated DNA walker is not activated and a low background signal is obtained.
[0070] Example 2: Label-free fluorescence detection of UO2 2+ using a label-free fluorescence detection kit for UO2 2+ to detect different concentrations of UO2 2+ The specific steps are as follows:
[0071] First, prepare UO2 2+ standard solutions with concentrations of 0, 0.1 nM, 0.5 nM, 1 nM, 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 700 nM, 900 nM, 1000 nM, 2000 nM, and 5000 nM, and store them at 4 °C;
[0072] Add solutions of different concentrations of UO2 2+ to the reaction system described in Example 1. After sufficient reaction, observe the fluorescence intensity. As Figure 2 shown in Figure 2 A in 2+ : the emission light spectra corresponding to different UO2 Figure 2 concentrations under the condition of λex = 485 nm; λem B in 2+ : the fluorescence standard curve obtained at F 2+ = 525 nm), 1.8 pM of UO2
[0073] can produce an obvious fluorescence change, indicating that its detection limit is 1.8 pM. As the concentration of UO2 2+ increases, the fluorescence intensity also increases and gradually tends to saturation. 2+ Example 3: Specific detection of different concentrations of UO2 2+ using a label-free fluorescence detection kit for UO2
[0074] Prepare standard solutions of 0, 100 nM, 200 nM, 500 nM of other metal ions and small molecules that may coexist in the water environment. They are strontium ions (Sr 2+ ), cesium ions (Cs 2+ ), cadmium ions (Cd 2+ ), manganese ions (Mn 2+ ), copper ions (Cu 2+ ), zinc ions (Zn 2+ ), chromium ions (Cr 3+ ), lead ions (Pb2+ ), thiamethoxam (TMX), atrazine (AT) and penicillin (PCN);
[0075] Standard solutions of different concentrations of interferents at 0, 100 nM, 200 nM, and 500 nM and UO2 2+ solutions were respectively added to the reaction system of the method in Example 1. After sufficient reaction, the change in fluorescence intensity was observed. The change in fluorescence intensity is as Figure 3 shown, where Figure 3 A in is the standard fluorescence curve, Figure 3 B in is Figure 3 the fluorescence value of A in at 525 nm. From Figure 3 both A and B in, it can be seen that for strontium ions (Sr 2+ ), cesium ions (Cs 2+ ), cadmium ions (Cd 2+ ), manganese ions (Mn 2+ ), copper ions (Cu 2 + ), zinc ions (Zn 2+ ), chromium ions (Cr 3+ ), lead ions (Pb 2+ ), thiamethoxam (TMX), atrazine (AT) and penicillin (PCN), the fluorescence intensities are far lower than those of UO2 2+ , which proves that the method has good specificity for the detection of UO2 2+ .
[0076] For those of ordinary skill in the art, the above embodiments are only exemplary descriptions of the present invention, and the above embodiments are the preferred embodiments of the present invention. Obviously, the specific implementation of the present invention is not limited by the above methods. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all within the protection scope of the present invention.
Claims
1. A biosensor for rapid detection of uranyl ions, characterized in that, The uranyl ion rapid detection biosensor uses Y-shaped rolling circle-mediated triple Walker as a signal amplifier to achieve signal amplification for the detection of UO2 2+ ; The Y-shaped rolling circle-mediated triple Walker includes an E1 / E2 / E3 / Assist complex, a UO2 2+ -dependent DNAzyme substrate strand Substrate strand, AuNPs, and a buffer solution. The UO2 2+ The sequence of the dependent DNAzyme substrate strand Substrate strand is shown in SEQ ID NO.1; SEQ ID NO.1 is: 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'; The sequence of the said E1 is as shown in SEQ ID NO.2, and SEQ ID NO.2 is: 5'- GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'; The sequence of the said E2 is as shown in SEQ ID NO.3, and SEQ ID NO.3 is: 5'- GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'; The sequence of the said E3 is as shown in SEQ ID NO.4, and SEQ ID NO.4 is: 5'- GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'; The rA in SEQ ID NO.1 is the cleavage site, and T(FAM) represents the T base labeled with the fluorescent group FAM; T(BHQ1) in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represents the T base labeled with the quenching group BHQ1.
2. The uranyl ion rapid detection biosensor according to claim 1, characterized in that, The said buffer solution comprises a 50 mM MES buffer solution, and the 50 mM MES buffer solution contains 300 mM NaCl, and its pH is 5.
5.
3. A label-free fluorescence detection kit for UO2 2+ , characterized in that The reagent kit for label-free fluorescence detection of UO2 2+ comprises: E1, E2, E3, UO2 2+ -dependent DNAzyme substrate strand Substrate strand, AuNPs and a buffer solution. The buffer solution includes MES buffer solution with pH = 5.
5. The sequence of the -dependent DNAzyme substrate strand Substrate strand is as shown in SEQ ID NO.
1. The sequence of E1 is as shown in SEQ ID NO.
2. The sequence of E2 is as shown in SEQ ID NO.
3. The sequence of E3 is as shown in SEQ ID NO.
4. Among them, SEQ ID NO.1 is: 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'; SEQ ID NO.2 is: 5'- GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'; SEQ ID NO.3 is: 5'- GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'; SEQ ID NO.4 is: 5'- GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'; rA in SEQ ID NO.1 is the cleavage site, and T(FAM) represents the T base labeled with the fluorescent group FAM; T(BHQ1) in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represents the T base labeled with the quenching group BHQ1.
4. A method for label-free fluorescence detection of UO2 2+ using a label-free fluorescence detection kit for UO2 2+ , characterized in that The specific steps are as follows: S1, Formation of the E1 / E2 / E3 / Assist complex: Mix E1, E2 and E3 in proportion; then mix them in MES buffer solution and heat at 95 °C for 5 - 10 minutes; subsequently cool slowly to room temperature to form the E1 / E2 / E3 / Assist complex; S2, Y-shaped rolling circle-mediated triple Walker formation: Mix the E1 / E2 / E3 / Assist complex and the UO2 2+ -dependent DNAzyme substrate strand Substrate strand with AuNPs and shake at 4 °C for 24 h; then, centrifuge the solution at 13,000 rpm for 25 minutes and wash three times with sodium phosphate buffer solution; Resuspend the solution in 50 mM MES buffer solution to obtain a mixture; S3, UO2 2+ Detection: Add the target UO2 2+ to the above mixture, incubate for 60 - 120 minutes, and then measure the fluorescence signal value; according to the linear relationship between the concentration of the cleaved substrate strand and the fluorescence intensity, the detection of UO2 is achieved 2+ for the purpose; The UO2 2+ The sequence of the dependent DNAzyme substrate strand Substrate strand is shown in SEQ ID NO.1; wherein, SEQ ID NO.1 is: 5'-TCACT(FAM)ATrAGGAAT(BHQ1)AGATGGACGTGAAAAAAAAAA-3'; The sequence of E1 is as shown in SEQ ID NO.2; the sequence of E2 is as shown in SEQ ID NO.3; the sequence of E3 is as shown in SEQ ID NO.4; SEQ ID NO.2 is: 5'- GAGTACTAGAGGAAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAAACACGCAGCATTCAAAAAAAA-3'; SEQ ID NO.3 is: 5'- GAATGCTGCGTGTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCGA CCTTCAGACAT(BHQ1)AGTGAAAAAAATCCGTCTGTCCAAAAAAAAA-3'; SEQ ID NO.4 is: 5'- GGACAGACGGATTAAAACACGTCCATCTCAGCAGTCGGGTAGTTAAACCG ACCTTCAGACAT(BHQ1)AGTGAAAAATCCTCTAGTACTCAAAAAAAA-3'; rA in SEQ ID NO.1 is the cleavage site, and T(FAM) represents the T base labeled with the fluorescent group FAM; T(BHQ1) in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 all represents the T base labeled with the quenching group BHQ1.
Citation Information
Patent Citations
Nanogold-DNA reticular structure electrochemical biosensor for detecting uranyl ions, and preparation method and application thereof
CN110702760A
Detection method for uranyl ion
CN109946279A
Label-free functional nucleic acid sensors for detecting target agents
US20120252128A1