Application of TCF7L2 gene in the preparation of drugs for preventing or treating coronavirus infection

Abstract

The application of TCF7L2 gene in the preparation of drugs for preventing or treating coronavirus infection belongs to the field of biological genetic engineering technology. The present invention solves the technical problems of low flexibility, low efficiency and narrow applicability of traditional host factors in the prior art, provides the application of TCF7L2 gene in the preparation of drugs for preventing or treating coronavirus infection, and uses CRISPR screening technology to screen and obtain the key gene TCF7L2 that affects the infection and invasion of coronavirus in human host cells. The TCF7L2 gene provided by the present invention can be used to prepare expression inhibitors to inhibit the replication of coronavirus; it can be used to prepare TCF7L2 gene expression enhancers, prepare coronavirus replication enhancers or vaccine production enhancers.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological genetic engineering, and specifically relates to the application of TCF7L2 gene in preparing medicine for preventing or treating coronavirus infection. Background Art

[0002] During the reproduction process, coronavirus needs to go through the processes of adsorption, penetration, uncoating, biosynthesis, assembly and release, and this reproduction process needs the help of host cells. Host factors refer to the molecules or mechanisms that play a role in the infection process of host cells, which can affect the entry, replication, spread of the virus and the host's immune response. Coronaviruses are RNA viruses, which are very prone to mutation during the replication process. Compared with the easily mutated viral proteins, host genes involved in the process of viral infection of cells rarely mutate, and the key genes of the host play an important role in the invasion of the virus. For example, the binding of the spike protein to its receptor angiotensin-converting enzyme 2 (ACE2) and the subsequent membrane fusion are very important. At the same time, the host protease transmembrane serine protease 2 (TMPRSS2) also plays a promoting role in this process. Therefore, focusing on the research on host factors for coronaviruses, screening key genes that efficiently target the entry of viruses into host cells, and analyzing the pathogenic mechanism of virus entry into host cells not only help researchers to have a deeper understanding of how viruses interact with host cells, but also provide important ideas for the development of new treatment strategies.

[0003] CRISPR screen technology is a high-throughput screening tool based on the CRISPR-Cas9 system. It is often used to conduct systematic studies on gene functions at the genome level. It plays an important role in exploring the functions of genes in cells, identifying disease-related genes and drug targets, and in-depth studies of the interaction between viruses and hosts.

[0004] The CRISPR-Cas9 system was originally discovered in bacteria as a naturally acquired immune system used to resist the invasion of foreign DNA (such as phage DNA). The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) sequence can capture and store invading foreign DNA fragments to form a CRISPR fragment library; when the same foreign DNA invades again, Cas proteins (such as Cas9) can use the RNA generated by these fragments to recognize and cut the foreign DNA, thereby achieving an immune effect.

[0005] CRISPR-Cas9 gene editing technology was developed based on the principles of this system. Its core mechanisms include: (1) single-stranded guide RNA (sgRNA), which guides the Cas9 protein to accurately identify and bind to specific sites of the target gene in the genome; (2) Cas9 nuclease, under the guidance of sgRNA, Cas9 will cut at the target DNA sequence to form a double-strand break; (3) Gene editing: cells will repair double-strand breaks through non-homologous end joining (NHEJ) or homologous recombination (HDR), thereby generating insertion, deletion or substitution mutations, thereby achieving editing of the target gene.

[0006] CRISPR screening technology is based on gene editing and uses high-throughput methods to knock out, knock down or activate thousands of genes in order to observe the phenotypic changes of cells under different genetic changes. CRISPR screening is generally divided into two categories: (1) CRISPR Knockout Screen: Using Cas9 nuclease to cut the target gene, resulting in loss of gene function (knockout), suitable for identifying genes that are important for certain phenotypes (such as cell survival, differentiation or proliferation); (2) CRISPR interference screening and activation screening (CRISPRi and CRISPRa Screen): Using the inactivated variant of Cas9 dCas9 combined with transcriptional repressor / activator factors to achieve the effect of inhibiting (interfering) or activating the target gene without causing genome breakage.

[0007] Traditional host factors in the prior art have the disadvantages of low flexibility, low efficiency and narrow applicability, for example: (1) RNA interference can non-specifically inhibit the expression of other non-target genes, leading to false positive or false negative results, and RNAi mainly inhibits gene expression at the post-transcriptional level, and the inhibition efficiency is often not thorough, which may lead to residual target gene expression and affect the detection results; (2) Mass spectrometry analysis and protein interaction screening can identify host proteins that directly interact with viral proteins, but cannot identify host factors that do not directly interact, such as factors involved in indirect processes such as regulation and signal transduction; (3) Small molecule compound screening is not highly targeted and often produces extensive off-target effects. It is also difficult to accurately determine the specific host protein on which the drug acts. It may also be limited by factors such as drug permeability and cytotoxicity, affecting the experimental results. Summary of the invention

[0008] In order to solve the technical problems of low flexibility, low efficiency and narrow applicability of traditional host factors in the prior art, the present invention provides the use of TCF7L2 gene in the preparation of drugs for preventing or treating coronavirus infection.

[0009] One of the purposes of the present invention is to provide an application of the TCF7L2 gene in the preparation of a drug for preventing or treating coronavirus infection, wherein the nucleotide sequence of the TCF7L2 gene is shown in SEQ ID NO.1.

[0010] In a preferred embodiment of the present invention, the drug targets the TCF7L2 gene and inhibits or silences the expression of the TCF7L2 gene.

[0011] The second object of the present invention is to provide the use of the TCF7L2 gene in the preparation of a coronavirus expression inhibitor or a replication inhibitor, wherein the nucleotide sequence of the TCF7L2 gene is shown in SEQ ID NO.1.

[0012] In a preferred embodiment of the present invention, the expression inhibitor or replication inhibitor is an RNA fragment that interferes with the expression of the TCF7L2 gene, or a shRNA that targets the TCF7L2 gene, or a small molecule compound that downregulates the expression of the TCF7L2 gene.

[0013] In a preferred embodiment of the present invention, in the shRNA sequence targeting the TCF7L2 gene, TCF7L2-shRNA#1-F is shown in SEQ ID NO.2, TCF7L2-shRNA#1-R is shown in SEQ ID NO.3; TCF7L2-shRNA#2-F is shown in SEQ ID NO.4, and TCF7L2-shRNA#2-R is shown in SEQ ID NO.5.

[0014] The third object of the present invention is to provide a shRNA specifically targeting the TCF7L2 gene, wherein the shRNA sequence targeting the TCF7L2 gene is TCF7L2-shRNA#1-F as shown in SEQ ID NO.2, TCF7L2-shRNA#1-R as shown in SEQ ID NO.3; TCF7L2-shRNA#2-F as shown in SEQ ID NO.4, and TCF7L2-shRNA#2-R as shown in SEQ ID NO.5.

[0015] A fourth object of the present invention is to provide the use of the above-mentioned shRNA in the preparation of a drug for preventing or treating coronavirus infection.

[0016] The fifth object of the present invention is to provide the use of the TCF7L2 gene in the preparation of a coronavirus expression enhancer, a replication enhancer or a vaccine production enhancer.

[0017] In a preferred embodiment of the present invention, the nucleotide sequence of the TCF7L2 gene is shown in SEQ ID NO.1.

[0018] In a preferred embodiment of the present invention, the expression enhancer, replication enhancer or vaccine production enhancer targets the TCF7L2 gene and promotes the expression of the TCF7L2 gene.

[0019] Beneficial effects of the present invention: The present invention provides an application of the TCF7L2 gene in the preparation of a drug for preventing or treating coronavirus infection. The present invention constructs a coronavirus-infected host cell system and a mutant cell library, uses CRISPR screening technology to screen coronavirus-infected mutant cell strains, and finally screens out the key gene TCF7L2 that affects the infection and invasion of coronavirus in human host cells.

[0020] Compared with traditional gene knockout screening methods, the CRISPR screening technology used in the present invention has higher screening efficiency and can quickly discover potential therapeutic targets; combined with the CRISPR-Cas9sgRNA with good specificity provided by the present invention, it can achieve precise targeting of specific sites in the genome, achieve precise knockout of target genes at the DNA level, and directly and thoroughly interfere with gene function; this high-precision screening method reduces the possibility of false positive or false negative results, ensuring that the screened host factors do play an important role in viral infection; and the above-mentioned CRISPR screening technology has low cost, simplified screening process, and fewer requirements for experimental materials and steps, which is suitable for large-scale research needs.

[0021] The present invention has been verified by WB experiments and immunofluorescence, and it is found that compared with the shControl control cell line, the expression levels of coronavirus Np protein, XBB, JN.1, BF.7 three subtypes and human coronavirus HCOV-043 protein in the shTCF7L2 stable cell line with knockdown of the TCF7L2 gene are significantly reduced. It can be seen that the TCF7L2 gene provided by the present invention is highly correlated with the survival and replication of coronavirus in host cells, and the knockdown of the TCF7L2 gene has the effect of inhibiting the survival and replication of coronavirus in host cells.

[0022] The TCF7L2 gene provided by the present invention overcomes the shortcomings of traditional host factors such as low flexibility, low efficiency and narrow applicability. The drug for preventing or treating coronavirus infection prepared by using the TCF7L2 gene avoids drug failure caused by viral mutation. Coronavirus will suppress the host's immune response during the infection process, thereby prolonging its replication time in the host. The TCF7L2 gene-related research provided by the present invention can reveal how coronavirus circumvents or suppresses the host's innate immune response, which is of great significance for understanding the chronicity of viral infection and the complications caused by it. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1This is the Western Blot result of A549-Cas9 cell line in Example 1;

[0024] Figure 2 The peak graph of the sequencing results of A549-Cas9 cells and control cell lines in Example 1; wherein the red arrow indicates the base mutation (C→A) 3 bp upstream of the PAM sequence N(T)GG;

[0025] Figure 3 This is a bubble chart of the coronavirus CRISPR screening results in Example 3;

[0026] Figure 4 The Western Blot results of shTCF7L2 and shControl stably transfected cell lines after coronavirus infection in Example 4 are shown;

[0027] Figure 5 This is a graph showing the immunofluorescence results of Np protein in shTCF7L2 and shControl stable cell lines after coronavirus infection in Example 4. DETAILED DESCRIPTION

[0028] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0029] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. The test methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0030] Example 1: Preparation and verification of stable cell lines

[0031] (1) Preparation of A549-Cas9-EGFP stable transgenic cell line

[0032] The A549-Cas9-Luc2-tdT cell line used in this example was provided by the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences. Subsequently, an ACE2 overexpression plasmid containing a green fluorescent protein EGFP tag was constructed on this basis, and an A549-Cas9-EGFP overexpressing ACE2 stable cell line was constructed by lentiviral transfection.

[0033] Specifically, the following steps were included: pLVX-ACE2(human)-IRES-tdTomato plasmid was purchased from the market. Since the A549-Cas9-Luc2-tdT cell line contained a tdTomato fluorescent tag, the tdTomato in the plasmid was replaced with EGFP using the All-in-One Gold Seamless Cloning Kit (CU201) to successfully construct the pLVX-ACE2(human)-IRES-EGFP plasmid; Lipofectamine TM The lentiviral packaging was performed with Lipo3000 transfection reagent (L3000075). The successfully constructed pLVX-ACE2(human)-IRES-EGFP plasmid, VSV-G 2 and psPAX2 were added to a 10 cm dish at a ratio of 10 μg: 2 μg: 5 μg for culture. The amount of Lipo3000 added was as described in the instruction manual. The virus liquid cultured for 48 h and 72 h was collected, concentrated by centrifugation at 4 °C, and resuspended in double-antibody-free DMEM medium. The A549-Cas9 cell line was infected with the virus liquid. Subsequently, the A549-Cas9 cell line not infected with the virus was used as a control, and the A549-Cas9-EGFP stable transfection cell line was obtained by flow cytometry screening.

[0034] (2) Western Blot (WB) verification of Cas9 expression

[0035] The A549-Cas9 cell line and the control cell line (Control A549) obtained in Example (1) were plated in a six-well plate, and three replicates were performed for each cell line. When the cells were fully grown, the supernatant was aspirated, and the cells were washed twice with PBS. Subsequently, 100 μl of RIPA (Biyuntian) lysis buffer was added to each well, pipetted several times, and then transferred to a 1.5 ml centrifuge tube, placed on ice for lysis for 15 min, and then centrifuged at 4°C and 12,000 rpm for 10 min. Then, SDS protein loading buffer was added, and the cells were boiled at 95°C for 5 min for subsequent WB experiments.

[0036] WB experiments were performed on three replicates of each cell line. After electrophoresis, transfer, blocking, primary and secondary antibodies, and development, the WB results were as follows: Figure 1 As shown, the Cas9 protein in the A549-Cas9 cell line is significantly expressed compared to the control cell line (Control A549).

[0037] (3) Design sgRNA to verify Cas9 cleavage activity

[0038] The sgRNA sequence and IL1RN primer were designed for the human IL1RN gene, wherein the sgRNAF nucleotide sequence in the sgRNA sequence was shown in SEQ ID NO.6 (CACCGTGTACTCTCTGAGGTGCTC), and the sgRNA R nucleotide sequence was shown in SEQ ID NO.7 (AAACGAGCACCTCAGAGAGTACAC); the IL1RN-F nucleotide sequence in the IL1RN primer was shown in SEQ ID NO.8 (CTTACGCAGATAAGAACCAGTTT), and the IL1RN-R nucleotide sequence was shown in SEQ ID NO.9 (CCAGACTCTAACTCAACTGAGC). The above sgRNA was introduced into the pSpCas9(BB)-2A-GFP(PX458) plasmid, and then stably transferred into the A549-Cas9-EGFP stable cell line obtained in Example (1). A549-Cas9 was cultured in a six-well plate in advance, and 2 μg was transfected per well. Genomic DNA was extracted 72 hours after transfection, and PCR amplification was performed using IL1RN primers (shown in SEQ ID NO.8 and SEQ ID NO.9), and agarose gel electrophoresis was performed, and the gel recovery product was sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0039] The sequencing results of this example are as follows Figure 2 As shown, the A549-Cas9 cell line underwent a base mutation (C→A) approximately 3 bp upstream of the PAM sequence N(T)GG, and a double peak appeared, while the control cell line (Control A549) maintained a single peak and did not send out base mutations. The results showed that the Cas9 cutting activity of the A549-Cas9 cell line was good and could be used for subsequent experiments.

[0040] Example 2: Construction of coronavirus-infected host cell system and mutant cell library

[0041] The Brunello whole-genome CRISPR library was used, which consists of 86,441 targeted single guide RNAs (sgRNAs), with an average of 4 sgRNAs per gene, and 1,000 non-targeted control sgRNAs; a CRISPR screening and evaluation system, i.e., quality control, was established.

[0042] In this example, psPAX2 and VSV-G plasmids were used on 293T cells, and Lipo3000 transfection reagent was used to perform lentiviral packaging on the whole genome CRISPR library plasmid. The addition ratio of library plasmid: psPAX2: VSV-G was 10 μg: 5 μg: 2 μg. After 72 hours of culture, the virus liquid was collected and the A549-Cas9-EGFP overexpressing ACE2 stable cell line obtained in Example 1 (MOI 2.0) was transfected with the virus liquid collected above. 0.3) lentiviral infection was performed, and the medium was changed 8 hours after infection to ensure that each cell was infected with only one sgRNA. The cells were screened at a Puromycin screening concentration of 3 μg / ml for 3 days to obtain a mutant cell library of A549-Cas9-EGFP overexpressing ACE2 randomly introduced into the whole genome CRISPR library, and the genome of the above cells was extracted for sgRNA second-generation sequencing (Annuouda Gene Technology Co., Ltd.). Later bioinformatics data analysis showed that the number of sgRNAs transfected into the cell line accounted for 99.6% of the total library, and the quality control results were good. It can be seen that the mutant cell library for virus-infected host cells in this embodiment was successfully constructed.

[0043] Example 3: Screening of key genes targeting coronavirus entry into host cells

[0044] In the mutant cell library obtained in Example 2, mutant cell strains infected with coronavirus are screened, mutant cells resistant to coronavirus are screened, and candidate genes targeting coronavirus entry into host cells are obtained; CRISPR Screen quality control is performed on the candidate genes targeting coronavirus entry into host cells, and after the quality control is qualified, a coronavirus CRISPR screening experiment is performed, which specifically includes the following steps:

[0045] In this example, psPAX2 and VSV-G plasmids were used on 293T cells, and Lipo3000 transfection reagent was used to perform lentiviral packaging on the whole genome CRISPR library plasmid. The mixing mass ratio of plasmid: psPAX2: VSV-G was 10:5:2. The virus liquid was collected after culturing for 72 hours, and the A549-Cas9-EGFP stably transfected cell line overexpressing ACE2 obtained in Example 1 was infected with lentivirus using the collected virus liquid. The stably transfected cell line was then screened at a Puromycin screening concentration of 3 μg / ml for 3 days. The screened stably transfected cell line was then expanded and divided into 3 equal parts. The Omicron BF.7 strain of coronavirus was used at MOI 0.1 and MOI 0. 0.3 was used to infect two of the cells, and the other one was used as a negative control without virus infection; surviving cells were collected 6 days after infection, genomic DNA was extracted from the above cells, and then sgRNA second-generation sequencing was performed, and then the sequencing results were analyzed using the MAGeCK-RRA algorithm to obtain enriched genes and depleted genes.

[0046] In this example, TCF7L2 (T-cell factor 7-like 2) gene was found in the enriched genes, and the results were as follows: Figure 3 As shown, transcription factor 7-like protein 2, also known as transcription factor 7-like protein 2, is a gene that encodes a transcription factor regulated by the Wnt / β-catenin signaling pathway. The gene is located at human chromosome 10q25.2-q25.3; the gene is involved in a variety of biological processes, such as cell proliferation, differentiation and metabolic regulation, and plays an important role in complex diseases such as diabetes and cancer.

[0047] Example 4: Application of TCF7L2 gene in the preparation of drugs for preventing or treating coronavirus infection

[0048] The three subtypes of coronavirus XBB, JN.1, and BF.7 and human coronavirus HCOV-043 used in this example are derived from Sinopharm Biotechnology Research Institute Co., Ltd.

[0049] (1) Construction of a stable cell line with knockdown of TCF7L2 gene

[0050] In this example, the TCF7L2 gene (nucleotide sequence is shown in SEQ ID NO.1) is used as the target, and shRNA targeting the TCF7L2 gene is designed. Among the shRNA sequences targeting the TCF7L2 gene, TCF7L2-shRNA#1-F is shown in SEQ ID NO.2, and TCF7L2-shRNA#1-R is shown in SEQ ID NO.3; TCF7L2-shRNA#2-F is shown in SEQ ID NO.4, and TCF7L2-shRNA#2-R is shown in SEQ ID NO.5.

[0051] In this example, the positive and negative strands corresponding to the above-mentioned TCF7L2-shRNA#1 and TCF7L2-shRNA#2 were complementary paired into double strands, and the pairing conditions were: 95°C-4min, 70°C-10min gradient annealing; the pLKO.1 vector was double-digested with EcoRI and AgeI enzymes, and the linear vector after the above-mentioned enzyme digestion and the TCF7L2-shRNA#1 and TCF7L2-shRNA#2 double strands after complementary pairing annealing were connected using T4 Ligase at 25°C and 1h, and the transformation was plated, and a single clone was picked, the bacteria were shaken, and the plasmid was extracted and sent to (Qingke Biotechnology Co., Ltd.) for sequencing and sequence identification; the above-mentioned successfully constructed shRNA plasmid was packaged by lentivirus using lipo3000 transfection reagent, and then the A549-Cas9 cell line was infected with the above-mentioned virus to successfully construct a shTCF7L2 stable cell line, and the stable cell line without knocking down the TCF7L2 gene was used as the control group (shControl).

[0052] In this example, WB experiments were performed on the shTCF7L2 stable transfected cell line obtained above and the shControl control cell line. The results are as follows: Figure 4 As shown, the knockdown effect of TCF7L2 gene in the stable cell line with knockdown of TCF7L2 gene constructed in this example is good.

[0053] (2) Western blot experiment and immunofluorescence verification

[0054] In this example, the shTCF7L2 stable cell line and shControl control cell line obtained above were plated in a six-well plate (WB) and a twelve-well plate (IF) one day in advance, and a cell slide with a diameter of 20 mm was placed in the twelve-well plate. The next day, the shTCF7L2 stable cell line and the shControl control cell line were infected with three subtypes of coronavirus XBB, JN.1, and BF.7 and human coronavirus HCOV-043 (MOI 0.1), respectively, and the medium was replaced 24 hours after infection. After 48 hours of liquid replacement, the supernatant culture medium was discarded, 100 μL (Biyuntian) lysis solution was added to each well, pipetted several times, and then transferred to a 1.5 ml centrifuge tube, placed on ice for lysis for 15 minutes, and then centrifuged at 4°C and 12000 rpm for 10 minutes, and then SDS protein loading buffer was added, boiled at 95°C for 5 minutes, and the shTCF7L2 stable cell line and shControl control cell line to be tested were obtained for subsequent experiments.

[0055] In this example, WB experiments were performed on the shTCF7L2 stable transfected cell line and the shControl control cell line obtained above. After electrophoresis, membrane transfer, blocking, primary and secondary antibodies, and subsequent development, the results were as follows: Figure 4 As shown, compared with the shControl control cell line, the expression level of coronavirus Np protein in the shTCF7L2 stable cell line with TCF7L2 gene knockdown was significantly reduced, and the expression levels of coronavirus XBB, JN.1, BF.7 three subtypes and human coronavirus HCOV-043 protein in the shTCF7L2 stable cell line with TCF7L2 gene knockdown were significantly reduced; it can be seen that the TCF7L2 gene provided by the present invention has a certain inhibitory effect on the replication of coronavirus.

[0056] In this example, immunofluorescence experiments were performed on the shTCF7L2 stable cell line and shControl control cell line obtained above. The liquid in the 12-well plate was removed, rinsed twice with PBS, fixed with 4% paraformaldehyde fixative for 15 minutes, and then the cell slides were taken out with tweezers and placed on a glass slide, blocked, incubated with primary and secondary antibodies, washed, stained and sealed, and then observed under a fluorescence microscope.

[0057] The results are as follows Figure 5 As shown, compared with the shControl control cell line, the fluorescence intensity of the coronavirus Np protein in the shTCF7L2 stable cell line with TCF7L2 gene knockdown was significantly reduced, further verifying that the TCF7L2 gene provided by the present invention has a certain inhibitory effect on the replication of coronavirus and can be used to prepare drugs for preventing or treating coronavirus infection.

[0058] The contents not described in detail in the specification of the present invention are well-known technologies for those skilled in the art. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be based on the definition of the claims.

Claims

1. The use of TCF7L2 gene in the preparation of a drug for preventing or treating coronavirus infection, characterized in that: The nucleotide sequence of the TCF7L2 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug targets the TCF7L2 gene and inhibits or silences the expression of the TCF7L2 gene.

3. The use of TCF7L2 gene in the preparation of coronavirus expression inhibitor or replication inhibitor, characterized in that: The nucleotide sequence of the TCF7L2 gene is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The expression inhibitor or replication inhibitor is an RNA fragment that interferes with the expression of the TCF7L2 gene, or a shRNA that targets the TCF7L2 gene, or a small molecule compound that downregulates the expression of the TCF7L2 gene.

5. The use according to claim 4, characterized in that: Among the shRNA sequences targeting the TCF7L2 gene, TCF7L2-shRNA#1-F is shown in SEQ ID NO.2, and TCF7L2-shRNA#1-R is shown in SEQ ID NO.3; TCF7L2-shRNA#2-F is shown in SEQ ID NO.4, and TCF7L2-shRNA#2-R is shown in SEQ ID NO.

5.

6. A shRNA specifically targeting the TCF7L2 gene, characterized in that: Among the shRNA sequences targeting the TCF7L2 gene, TCF7L2-shRNA#1-F is shown in SEQ ID NO.2, and TCF7L2-shRNA#1-R is shown in SEQ ID NO.3; TCF7L2-shRNA#2-F is shown in SEQ ID NO.4, and TCF7L2-shRNA#2-R is shown in SEQ ID NO.

5.

7. Use of the shRNA described in claim 6 in preparing a drug for preventing or treating coronavirus infection.

8. Application of TCF7L2 gene in the preparation of coronavirus expression enhancer, replication enhancer or vaccine production enhancer.

9. The use according to claim 8, characterized in that: The nucleotide sequence of the TCF7L2 gene is shown in SEQ ID NO.

1.

10. The use according to claim 8, characterized in that: The expression enhancer, replication enhancer or vaccine production enhancer targets the TCF7L2 gene and promotes the expression of the TCF7L2 gene.

Images