High-yield lipase strain and application thereof

Abstract

The invention relates to a high-yield lipase strain and application thereof, and belongs to the technical field of bioengineering. According to the invention, grease-rich samples from different sources are subjected to enrichment treatment, a strain with lipase activity reaching 80.8 + / -1.8 U / mL is obtained through neutral red grease plate screening, the strain is identified as Burkholderia cepacia OCRI-Lip100 through sequencing and sequence comparison, the Burkholderia cepacia OCRI-Lip100 is named as Burkholderia cepacia OCRI-Lip100, and the Burkholderia cepacia OCRI-Lip100 is preserved in China Center for Type Culture Collection on July 3, 2024 with a preservation number of CCTCC M20241369. Lipase obtained by fermentation of the strain is sequenced, enzymatic properties, catalytic activity and substrate preference of the lipase are studied, the optimum catalytic temperature is 60 DEG C, the specific enzyme activity is higher than that of commercial lipase, the catalytic activity is further improved to 116 + / -0.5 U / mL when a C14 substrate is catalyzed, and triglyceride can be hydrolyzed into diglyceride. The strain provided by the invention and the lipase produced by the strain enrich the resource library of the existing lipase, and provide a basis for improving the industrial application of the lipase and realizing the high utilization rate of resources.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, in particular to a strain with high lipase production and application thereof. Background Art

[0002] Lipase (EC 3.1.1.3) belongs to the hydrolase family and can catalyze the hydrolysis of triglycerides (TAG) and other esters to generate glycerol, fatty acids, monoglycerides (MAG) and diglycerides (DAG). DAG is a generally recognized as safe (GRAS) food ingredient. In recent years, it has been found that dietary DAG has the effects of reducing visceral fat, inhibiting weight gain, and lowering blood lipids, and has therefore received widespread attention. Under certain conditions, lipase can also catalyze non-hydrolysis reactions such as esterification, transesterification and racemization. This bifunctional catalytic property makes it show important application value in multiple industrial fields. It plays an important role in the traditional papermaking industry, food industry and oil production and processing, and shows broad application prospects in emerging fields such as biopharmaceuticals, health foods and biodiesel. For example, in the food baking industry, lipase can improve the baking quality of flour products, improve the texture of bread, and extend the shelf life of products. In the oil processing industry, lipase can catalyze fat to generate fatty acids and glycerol, promote the hydrolysis reaction of oils and fats, and improve the properties of oils and fats. In addition, lipase also has important applications in the dairy industry, where it can enhance the flavor of cheese and milk powder and improve the nutritional value of dairy products.

[0003] Lipases are widely found in animals, plants and microorganisms, and the catalytic properties of lipases from different sources are significantly different. Lipases from microorganisms (such as Bacillus subtilis, Aspergillus niger and Pseudomonas, etc.) have become the main source of industrial lipases due to their low cost, high yield, strong enzyme activity and easy genetic modification, showing significant potential for industrial application. Therefore, further exploration of the separation, screening and enzymatic properties of high-yield lipase strains, and systematic study of the effects of different conditions on the catalytic activity of lipases can not only improve the resource utilization efficiency of lipases in industrial applications, but also provide theoretical basis and technical support for actual production, which has important academic value and application prospects.

[0004] In addition, most of the existing lipases from microbial sources are mesophilic lipases, whose enzymatic properties are closely related to the host. The optimum temperature is 30-40°C, the catalytic performance is poor in high temperature environments, and the acid-base tolerance range is narrow, which greatly limits the industrial application of lipases that catalyze reactions under high temperature conditions. Screening, developing and applying microbial strains that can produce high-yield and high-activity lipases is of great value to industrial production. Summary of the invention

[0005] In order to solve the above technical problems, the present invention enriched samples rich in oil from different sources (including Guangxi Zhuang Autonomous Region, Zhejiang Province, Henan Province and Sichuan Province), and screened a strain with high lipase production using a neutral red oil plate, which was identified as Burkholderia cepaciaOCRI-Lip100 after sequencing and sequence alignment, and was deposited in the China Center for Type Culture Collection on July 3, 2024, with a deposit number of CCTCC M20241369. The lipase obtained by fermentation of the bacteria was sequenced, and the enzymatic properties, catalytic activity and substrate preference of the lipase were studied.

[0006] The first object of the present invention is to provide a Burkholderia strain with high lipase production, named Burkholderia cepacia OCRI-Lip100, which was deposited in the China Center for Type Culture Collection on July 3, 2024, with a deposit number of CCTCC M 20241369.

[0007] Furthermore, the 16S rRNA sequence of the Burkholderia is shown as SEQ ID NO.1.

[0008] Furthermore, the Burkholderia were screened from different regions containing oil and fat areas, including: rapeseed soil, peanut oil cake, sewage near restaurants, and grease in household kitchens in Pubei County, Qinzhou City, Guangxi Zhuang Autonomous Region; tea oil tree soil and sewage near restaurants in Cangnan County, Wenzhou City, Zhejiang Province; rapeseed field soil and sewage near restaurants in Xiangcheng City, Henan Province; sewage near restaurants and grease in household kitchens in Zizhong County, Neijiang City, Sichuan Province.

[0009] Furthermore, the screening process of Burkholderia includes the following steps:

[0010] Step S1: dilute the samples collected from different areas, take 1 mL of the sample and inoculate it into a triangular shake flask containing enriched culture medium, and dilute it to 10 -3 -10 -7 And spread on neutral red grease plate;

[0011] Step S2, a single colony secreting lipase will undergo a color reaction on a neutral red oil plate to form a red color circle, and the strain forming the red color circle on the plate is inoculated into a liquid antibiotic-free culture medium to obtain a seed solution;

[0012] Step S3, transferring the cultured seed liquid to a fermentation medium containing an olive oil polyvinyl alcohol emulsion for fermentation production, and determining the lipase activity of the fermentation liquid using the p-nitrophenol method;

[0013] Step S4, identifying the strain type of the strain with higher lipase activity in the fermentation broth by 16S and ITS.

[0014] A second object of the present invention is to provide a culture of Burkholderia, which is obtained by culturing the above-mentioned Burkholderia in a microbial culture medium.

[0015] The third object of the present invention is to provide a microbial agent comprising the above-mentioned Burkholderia.

[0016] The fourth object of the present invention is to provide the use of the above-mentioned Burkholderia or the above-mentioned microbial agent in the fermentation production of lipase.

[0017] The fifth object of the present invention is to provide a fermentation production method of lipase, wherein the above-mentioned Burkholderia or the above-mentioned microbial agent is inoculated into a fermentation medium, and the lipase is obtained through culture and purification.

[0018] The sixth object of the present invention is to provide a lipase obtained by fermentation of the above-mentioned Burkholderia or the above-mentioned microbial agent, wherein the amino acid sequence of the lipase is shown in SEQ ID NO.2.

[0019] Furthermore, the lipase is from the α / β hydrolase superfamily.

[0020] Furthermore, the lipase prefers substrates with a carbon chain length of 14.

[0021] A seventh object of the present invention is to provide use of the above-mentioned Burkholderia, the above-mentioned microbial agent or the above-mentioned lipase in hydrolyzing triglycerides into diglycerides.

[0022] The eighth object of the present invention is to provide a method for producing diglyceride, using triglyceride as a substrate and adding the above-mentioned Burkholderia, the above-mentioned microbial agent or the above-mentioned lipase.

[0023] Furthermore, the reaction temperature is 40-70°C.

[0024] Preferably, the reaction temperature is 60°C.

[0025] Furthermore, the reaction pH is 7-10.

[0026] Preferably, the reaction pH is 9.

[0027] Beneficial effects of the present invention:

[0028] The present invention screened a strain with a lipase activity of 80.8±1.8U / mL from oil-rich samples from different sources, named Burkholderia cepacia OCRI-Lip100, and sequenced the lipase obtained by fermentation of the strain. The optimum catalytic temperature is 60°C, which is higher than the optimum temperature of the lipase in the prior art, and can be applied to a wider range of industrial production conditions. The optimum catalytic pH is 9, and the catalytic activity is further increased to 116±0.5U / mL when catalyzing C14 substrates, which can increase the content of diglyceride in the substrate from 4% to 33.5%. The strain provided by the present invention and the lipase produced by the strain enrich the existing lipase resource library, realize the efficient production of lipase, and have important industrial application value.

[0029] Biomaterial Deposit

[0030] Burkholderia cepacia OCRI-Lip100, the Burkholderia cepacia OCRI-Lip100 was deposited in the China Center for Type Culture Collection on July 3, 2024, with the deposit number CCTCC M 20241369, and the deposit address is Wuhan University. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0032] Figure 1 This is a p-NP standard curve diagram in an embodiment of the present invention;

[0033] Figure 2 This is a plate color diagram of the lipase-producing strains from different sources screened in Example 1 of the present invention;

[0034] Figure 3 This is the lipase activity diagram obtained by screening in Example 1 of the present invention;

[0035] Figure 4 This is the SDS protein gel image of E12C in Example 1 of the present invention;

[0036] Figure 5 This is the gel image of lip-12c nucleic acid in Example 1 of the present invention;

[0037] Figure 6 This is a phylogenetic tree analysis diagram of the lipase Lip-12c in Example 1 of the present invention;

[0038] Figure 7This is an analysis diagram of the temperature range and optimum temperature of the hydrolysis substrate of the lipase Lip-12c in Example 2 of the present invention;

[0039] Figure 8 The pH range and optimum pH analysis of the hydrolysis substrate of lipase Lip-12c in Example 2 of the present invention are shown in FIG.

[0040] Fig. 9 The selectivity and catalytic activity of lipase for substrates of different chain lengths in Example 3 of the present invention are shown in FIG.

[0041] Fig.10 This is an identification diagram of the lipase hydrolysis product in Example 4 of the present invention. DETAILED DESCRIPTION

[0042] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0043] 1. The materials involved in the embodiments are as follows:

[0044] PrimeSTAR Max DNA polymerase was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0045] 5000bp DNA Marker, 2000bp DNA Marker, 10000bp DNA Marker and Gold Mix Ver2 polymerase were purchased from Beijing Qingke Biotechnology Co., Ltd.;

[0046] Phanta UniFi Master Mix polymerase was purchased from Nanjing Novozyme Biotechnology Co., Ltd.;

[0047] Gel recovery kit, plasmid extraction kit and protein standard marker were purchased from Thermo Fisher Scientific;

[0048] The bacterial total DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;

[0049] p-Nitrophenol (p-NP), p-nitrophenyl palmitate (p-NPP) and others were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.;

[0050] Various analytically pure reagents were purchased from Sinopharm Group;

[0051] Primer synthesis and sequencing were performed at Beijing Qingke Biotechnology Co., Ltd.

[0052] Second, the culture medium involved in the embodiment is as follows:

[0053] LB solid medium (g / L): peptone 10, yeast powder 5, sodium chloride 10, agar powder 15.

[0054] LB liquid medium (g / L): peptone 10, yeast powder 5, sodium chloride 10.

[0055] Enrichment medium (g / L): peptone 10-12, glucose 10-15, beef extract 5-8, NaCl 2-4, pH 7.0-7.5.

[0056] Neutral red oil solid culture medium (g / L): peptone 10-12, beef extract 5-8, NaCl 5-7, MgSO4 0.5-0.8, agar 15-20, olive oil polyvinyl alcohol emulsion 40-50ml / L, 1.6-2.0% neutral red solution 1mL / L, pH=7.0-7.5.

[0057] Shake flask fermentation medium (g / L): peptone 10-12, yeast powder 5-6, NaCl 2-3, (NH4)2SO42-3, K2HPO41-1.5, MgSO4 0.5-1, olive oil polyvinyl alcohol emulsion 40-50mL / L, pH=7.0-7.5.

[0058] 3. The detection method involved in the embodiment is as follows:

[0059] 1. Lipase activity detection

[0060] (1) Preparation of p-NPP reaction substrate solution: 1 g of p-NPP was dissolved in 0.1 L of isopropanol solution, and the p-NPP was completely dissolved in the isopropanol solution by ultrasonic cleaning with a 240 W ultrasonic cleaner for 5 min (after complete dissolution, it was a uniformly distributed transparent liquid, liquid A); 2 g of gum arabic and 25 g of Triton-X100 were dissolved in 0.8 L of ultrapure water, and they were completely dissolved by ultrasonic cleaning with a 240 W ultrasonic cleaner for 15 min (liquid B). Liquid A and liquid B were fully mixed in a ratio of 1:4 to obtain a p-NPP substrate solution (after uniform mixing, it was a milky white liquid), and stored at 4°C away from light.

[0061] (2) Plotting the p-NP standard curve: Weigh 0.696 g of p-NP and dissolve it in a small amount of ethanol. Add Tris-HCl (50 mM, pH = 8.0) to a fixed volume of 1 L to prepare a 5 μM / mL stock solution. Use Tris-HCl (50 mM, pH = 8.0) to dilute (specific concentrations such as 2.5 μM / mL, 1.25 μM / mL, 1 μM / mL, and 0.5 μM / mL). Perform the same reaction with the nitrophenol standard and plot the standard curve, such as Figure 1 As shown, the standard curve equation is: Y = 8.45564X + 0.00521, R 2=0.99995, where Y is the p-NP concentration in the sample (μM / mL), X is the absorbance A 410 .

[0062] (3) Lipase Lip-12c enzyme activity measurement: Enzyme activity is defined as the enzyme required to catalyze the production of 1 μmol of p-nitrophenol within 1 min at 40°C and pH = 8. Add 1.35 mL of lipase detection mixture (p-NPP substrate mixture: 50 mM Tris-HCl: isopropanol 5:4:1) to a 5 mL centrifuge tube and preheat at 40°C for 5 min. Add 150 μL of appropriately diluted sample (samples in a 95°C water bath for 10 min as a control) to the 5 mL test tube, mix well and incubate at 40°C for 5-10 min. After the reaction is completed, add 150 μL of 0.6 M trichloroacetic acid to terminate the reaction, add 150 μL of 0.6 M sodium carbonate solution to adjust the pH to color development, centrifuge at 12000 × g for 5 min, and take 200 μL of supernatant to measure the absorbance at 410 nm.

[0063]

[0064] Where C is the p-NP concentration in the detection system (μmoL / mL), V is the total volume of the detection system (mL), n is the sample dilution factor, T is the reaction time (min), and v is the sample addition amount (mL).

[0065] 2. Content of each component in triolein hydrolyzate:

[0066] (1) Take 20 μL of the above hydrolysis product and add 1 mL of analytical grade n-hexane sample to mix well, and filter through a 0.22 μm organic membrane to remove impurities.

[0067] (2) A gas chromatograph (GC2030, Shimadzu, Japan) was used, with a DN-5HT column (15m×0.320mm, 0.10μm), a hydrogen flame ionization (FID) detector, and an initial column temperature of 170°C, which was maintained for 2 min, then raised to 380°C at a temperature rate of 5°C / min and maintained for 6 min. 1μL of sample was injected at a split ratio of 1:50. The carrier gas was 2mL / min high-purity helium, and the air flow rate was 200mL / min. The injector and detector temperatures were both maintained at 380°C. The formulas for each component are as follows:

[0068] Content (wt%) = (corresponding component content / total glyceride content (FFA+MAG+DAG+TAG)) × 100%

[0069] 4. The primer sequences involved in the examples are shown in the following table (the underlined parts are restriction enzyme cutting sites):

[0070] Table 1 Primer sequences

[0071] Primer name Sequence (5'-3') 16-F CGTGCTTCACTCCGCATT 16-R GAGCGCATCGAGATACGC ITS-F TCCGTAGGTGAACCTGCGG ITS-R TCCTCCGCTTATTGATATGC F CGTGCTTCACTCCGCATT R GACCGGGTCTTCCGCA 12B-F TTCGTCAATGTATTCGGCA R11 GAGCGCATCGAGATACGC KZ-F CAAATGGGTCGCGGATCCGAATTCATGGCGAGTGCGCCCGCCGAC KZ-R TCGAGTGCGGCCGCAAGCTTTCACACGCCCGCGAGCTTCA

[0072] Example 1: Collection of oil-rich samples and screening of lipase-producing strains

[0073] 1. Sampling and processing of oil-rich samples

[0074] Oil-rich samples were selected from rapeseed soil, peanut oil cake, sewage near restaurants, and grease in household kitchens in Pubei County, Qinzhou City, Guangxi Zhuang Autonomous Region; tea oil tree soil and sewage near restaurants in Cangnan County, Wenzhou City, Zhejiang Province; rapeseed field soil and sewage near restaurants in Xiangcheng City, Henan Province; sewage near restaurants and grease in household kitchens in Zizhong County, Neijiang City, Sichuan Province. After collection, the samples were placed in ziplock bags and stored in a refrigerator at 4°C.

[0075] Weigh 5g of samples collected from the above 10 different regions rich in oil and fat, dissolve in 50mL of distilled water, add 15 glass beads (2mm in diameter) to each bottle, shake in a constant temperature shaker at 220rpm and 30℃ for 10min to mix the samples thoroughly. After standing for 15min, draw 1mL of the upper liquid into a triangular flask containing 50mL of enrichment culture medium, and culture at 220rpm and 30℃ for 2-3 days.

[0076] Dilute the above enriched culture medium to 10% with sterile water. -5 , 10 -6 , 10 -7 Gradient, and take 0.1mL to spread on neutral red grease plate, culture at 30℃ for 1-2 days, select colonies with red color circle as the primary screening strains, the results are as follows Figure 2 shown.

[0077] 2. Lipase strain rescreening and enzyme activity detection

[0078] The target strain obtained from the initial screening was transferred into the fermentation medium and cultured at a constant temperature of 32°C and 220rpm in a shaker for 2-3 days. After the fermentation, the sample in the shake flask was centrifuged at 6000rpm and 4°C for 5min to separate the bacteria and the supernatant. The supernatant was the crude enzyme solution of lipase secreted by the screened strain and was stored in a 4°C refrigerator.

[0079] The supernatant of the fermentation broth cultured in the shake flask was used to determine the lipase activity by lipase hydrolysis p-NPP detection method. The enzyme activity detection result was as follows: Figure 3As shown, the lipase activity of the screened strain E12C was the highest, about 80.8±1.8U / mL, and the lipase activity of the strain E15B was lower than that of E12C, at 41.1±1.4U / mL. However, the lipase activities of the strains D8, A37 and F3 were significantly lower than those of the strain E12C, at 10.4±0.7U / mL, 4.9±0.1U / mL and 1.3±0.2U / mL, respectively. Through SDS-PAGE analysis, the protein electrophoresis of the E12C screened strain can be seen ( Figure 4 ), the lipase protein size is approximately 33.4 kDa.

[0080] 3. Identification of E12C strain and acquisition of lipase gene

[0081] Primers 16F / R and ITSF / R were used to perform PCR amplification with the E12C genome as a template. The target band information obtained by sequencing the PCR product was compared in NCBI. The E12C strain belongs to the Burkholderia cepacia bacterium. The strain is classified and named: B.cepacia OCRI-Lip100. The strain has been deposited in the China Center for Type Culture Collection (CCTCC) on July 3, 2024, with a deposit number of CCTCC M 20241369, and the 16S rRNA sequence is shown in SEQ ID NO. 1. In addition, E15B is also Burkholderia, D8 is Bacillus cereus, A37 is Serratia marcescens, and F3 is Klebsiella pneumoniae.

[0082] Using the reported lipase sequence from B. cepacia in the NCBI database (GenBank: DQ075249.2) as the initial template, universal primers F / R were designed to obtain the pre-sequence bclip-F ( Figure 5 a), and further designed primer pair 12B-F / R11 based on the existing sequence to obtain the posterior segment sequence of lipase gene bclip-R ( Figure 5 a), and finally the complete sequence of the lipase gene obtained using primer pair KZ-F / R ( Figure 5 b) and named it lip-12c.

[0083] (3) The amino acid sequence of the lipase Lip-12c obtained above (as shown in SEQ ID NO.2) was used to predict the protein structure using the Alphafold3 online software, and the glycerol ester hydrolase information was obtained and the classification was downloaded from the Uniprot database. Furthermore, the conserved domains of the above glycerol ester hydrolase were obtained from the NCBI database, and a phylogenetic tree diagram of the lipase Lip-12c was made using the MAGE11 software, as shown in FIG. Figure 6 shown.

[0084] Example 2: Analysis of the enzymatic properties of lipase Lip-12c produced by strain B.cepacia OCRI-Lip100

[0085] 1. Temperature range and optimal temperature detection of substrate hydrolysis by lipase Lip-12c

[0086] The shake flask culture supernatant obtained in Example 1 and the lipase Lip-12c detection mixture (p-NPP substrate mixture: 50mM Tris-HCl: isopropanol is 5:4:1) were preheated at 40°C for 5min, 150μL of the appropriately diluted sample was added to a 5mL test tube and mixed, and then water bathed at 20°C, 30°C, 40°C, 50°C, 60°C, 70°C and 80°C for 10-15min, respectively. After the color reaction was completed, 150μL of 0.6M trichloroacetic acid was added to terminate the reaction, 150μL of 0.6M sodium carbonate solution was added to adjust the pH for color development, and after centrifugation at 12000×g for 5min, 200μL of supernatant was aspirated to determine the absorbance at a wavelength of 410nm, and finally the activity of lipase Lip-12c in hydrolyzing the substrate at different temperatures was calculated.

[0087] The results are as follows Figure 7 As shown, the enzyme activity of lipase Lip-12c is above 40% in the range of 40-70°C, and the highest enzyme activity is at 60°C. However, the enzyme activity decreases significantly at 20°C, 30°C and 80°C, indicating that the optimal catalytic temperature range of lipase Lip-12c is 40-70°C, and the optimal catalytic temperature is 60°C.

[0088] 2. pH range of substrate hydrolysis by lipase Lip-12c and optimal pH detection

[0089] Prepare 50mM buffers of different pH values ​​(citric acid buffer of pH=3-8, Tis-HCl buffer of pH=8-9, glycine-NaOH buffer of pH=9-11), repeat the above steps, and the lipase Lip-12c detection mixture is (p-NPP substrate mixture: 50mM buffers of different pH values: isopropanol of 5:4:1), and detect the enzyme activity of lipase Lip-12c in hydrolyzing substrates at different pH values. The results are shown in Figure 8 As shown, the enzyme activity of lipase Lip-12c is above 60% in the pH range of 5-10, and the enzyme activity is highest at pH = 9. However, the enzyme activity decreases significantly at pH = 3 and pH = 11, indicating that the optimal catalytic pH of lipase Lip-12c is 5-10, and the optimal catalytic pH is 9.

[0090] 3. Comparison of Lipase Lip-12c Activity with Commercial Enzymes

[0091] According to the above enzyme activity detection method, the specific enzyme activity of Lip-12c and commercially available lipase was calculated. The calculation results are shown in Table 2. It can be seen that the specific enzyme activity of the lipase Lip-12c provided by the present invention is significantly improved compared with the currently commercially available lipase.

[0092] Table 2 Calculation results of the relative enzyme activity of Lip-12c and some commercially available lipases

[0093]

[0094] Example 3: Analysis of catalytic preference of lipase Lip-12c for hydrolysis of substrates of different chain lengths

[0095] The B. cepacia obtained in the above example was The supernatant of the fermentation broth of OCRI-Lip100 strain was catalyzed and hydrolyzed with substrates 4-nitrophenylbutyrate (C4, CAS: 2635-84-9, molecular weight: 209.20), 4-nitrophenyloctanoate (C8, CAS: 1956-10-1, molecular weight: 265.30), 4-nitrophenyldodecanoate (C12, CAS: 1956-11-2, molecular weight: 321.41), 4-nitrophenyl myristate (C14, CAS: 14617-85-7, molecular weight: 349.46), 4-nitrophenyl palmitate (C16, CAS: 1492-30-4, molecular weight: 377.52) and 4-nitrophenyl stearate (C8, CAS: 14617-86-8, molecular weight: 405.57), respectively, and the reaction conditions were temperature 60°C and pH 9.

[0096] Referring to the above method, lipase Lip-12c was subjected to hydrolysis reaction with substrates of different chain lengths, and the results showed that Fig. 9 As shown, lipase Lip-12c has a preference for 4-nitrophenylmyristate (C14) substrate, and the enzyme activity is increased from 80.8±1.8 U / mL to 116±0.5 U / mL, and the activity of lipase Lip-12c is increased by 43%.

[0097] Example 4: Identification and analysis of triolein hydrolysis products by lipase Lip-12c

[0098] In a 20mL reaction bottle, add 2mL of triolein, 5mL of solution B (see the detection method section), and 1mL of fermentation broth supernatant, mix well, and stir with a magnetic stirrer at 500rpm for 4h in a 40℃ water bath. After the reaction, take 20μL of the hydrolysis product of triolein (unreacted triolein is used as the control group), add 1mL of analytical grade n-hexane sample, mix well, filter with a 0.22μm organic membrane to remove impurities, and place in a gas phase injection bottle for detection.

[0099] Gas phase detection results such as Fig.10 As shown, the main component of the substrate is TAG, with a content of 96%, and the remaining less than 4% is DAG. The TAG content in the product is reduced to 56%, and about 40% of TAG is hydrolyzed by lipase Lip-12c into FFA (8%), MAG (2.5%), and DAG (33.5%). Among them, DAG is a food ingredient generally recognized as safe (GRAS). In recent years, it has been found that dietary DAG has the effects of reducing visceral fat, inhibiting weight gain, and lowering blood lipids, and has therefore received widespread attention.

[0100] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A Burkholderia strain that produces high lipase, characterized in that: It was named Burkholderia cepacia OCRI-Lip100 and was deposited in the China Center for Type Culture Collection on July 3, 2024, with the deposit number CCTCC M 20241369.

2. A culture of Burkholderia, characterized in that: The culture is obtained by culturing the Burkholderia described in claim 1 in a microbial culture medium.

3. A microbial agent comprising the Burkholderia according to claim 1.

4. Use of the Burkholderia described in claim 1 or the microbial agent described in claim 3 in fermentation production of lipase.

5. A fermentation production method of lipase, characterized in that: The Burkholderia described in claim 1 or the microbial agent described in claim 3 is inoculated into a fermentation medium, and the lipase is obtained through culture and purification.

6. A lipase, characterized in that: The lipase is obtained by fermentation of the Burkholderia described in claim 1 or the microbial agent described in claim 3, and the amino acid sequence of the lipase is shown in SEQ ID NO.

2.

7. Use of the Burkholderia according to claim 1, the culture according to claim 2, the microbial agent according to claim 3 or the lipase according to claim 6 in hydrolyzing triglycerides to diglycerides.

8. A method for producing diglycerides, characterized in that: Using triglyceride as a substrate, the Burkholderia described in claim 1, the culture described in claim 2, the microbial agent described in claim 3 or the lipase described in claim 6 is added.

9. The method according to claim 8, characterized in that: The reaction temperature is 40-70°C.

10. The method according to claim 8, characterized in that: The reaction pH is 7-10.

Images