An imine reductase mutant with improved enantioselectivity and its application in the production of S-nicotine

Abstract

The present invention belongs to the technical field of enzyme engineering, and particularly relates to an imine reductase mutant with improved enantioselectivity and its application in the production S of (-)-nicotine. The imine reductase mutant is obtained by single-point or multi-point mutations at positions 118, 168, 169, 172, 234, and 238 of the imine reductase with the amino acid sequence shown in SEQ ID NO.2. The present invention mutates the imine reductase derived from Pseudomonas Pseudomonas sp.RC4D1 and the imine reductase with the accession number WP_213665450.1 in NCBI to obtain a series of mutants, which improve the enantioselectivity in the catalytic preparation S of (-)-nicotine while maintaining the high enzyme activity of the wild-type imine reductase. Compared with the prior art, the production process of the present invention is simple, the reaction conditions are mild, the selectivity of the imine reductase is high, and the optical purity of the product is high, having good industrial application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of enzyme engineering, and particularly relates to an imine reductase mutant with improved enantioselectivity and its application in the production of S S-nicotine. Background Art

[0002] S S-nicotine, with the chemical name of 1-methyl-2-(3-pyridyl)pyrrolidine and the common name of nicotine, mainly exists in solanaceous plants and has strong physiological activity. In the medical field, S S-nicotine can be used to treat diseases such as attention deficit hyperactivity disorder, depression, and Alzheimer's disease; in the agricultural field, it can be used as a highly effective and low-toxic broad-spectrum pesticide; in addition, S S-nicotine is also an important raw material for cosmetics, functional health products, etc. There are three ways to obtain nicotine, namely extraction from plants such as tobacco leaves, chemical synthesis, and enzymatic synthesis. Direct extraction from tobacco leaves is the main way to obtain nicotine, but this method has cumbersome processes, a long cycle, is easily interfered by impurities, and has limited purity. Chemical synthesis requires resolution to obtain S S-nicotine, thus having a high cost, and also having the common problems of high consumption, high pollution, and low conversion rate, with many limitations in actual production.

[0003] Enzymatic catalytic synthesis of chiral compounds has attracted much attention due to advantages such as low cost and environmental friendliness. Imine reductase (IRED) is an effective catalyst for preparing various chiral amines. In 2010, Mitsukura and his colleagues first applied IRED to the synthesis of imines, and they identified R enantioselective and S diastereoselective IREDs from Streptomyces GF3587 and Streptomyces GF3546, respectively. Since then, a large number of naturally occurring IREDs have been identified and characterized for the synthesis of chiral amines. However, natural IREDs have brought inconvenience to their industrial applications because their stereoselectivity does not meet the production requirements, or the selectivity changes with the structural differences of substrate molecules. In 2016, the Turner team found that Amycolatopsis orientali IREDs from [[source]] showed mixed stereopreference, which indicates that the stereoselectivity mechanism of IREDs is complex and must be studied according to specific situations.

[0004] Therefore, it is of great significance to further explore imine reductases with high catalytic efficiency and use protein engineering technology to construct imine reductase mutants with better enantioselectivity for the catalytic synthesis of S-nicotine. Summary of the Invention

[0005] In view of the prior art S- Defects in the nicotine synthesis process, the present invention provides an imine reductase mutant with improved enantioselectivity and its application in the production S - of nicotine. The specific technical solutions are as follows:

[0006] In the first aspect, the present invention provides an imine reductase mutant, which is obtained by single-point or multi-point mutations at positions 118, 168, 169, 172, 234, and 238 of the imine reductase with the amino acid sequence shown in SEQ ID NO. 2.

[0007] Furthermore, the mutation form of the imine reductase mutant is one of the following mutation forms:

[0008] (1) Alanine at position 118 is mutated to serine;

[0009] (2) Serine at position 168 is mutated to arginine;

[0010] (3) Alanine at position 169 is mutated to threonine;

[0011] (4) Cysteine at position 172 is mutated to tyrosine;

[0012] (5) Alanine at position 234 is mutated to serine;

[0013] (6) Threonine at position 238 is mutated to methionine;

[0014] (7) Alanine at position 118 is mutated to serine, and at the same time serine at position 168 is mutated to arginine;

[0015] (8) Alanine at position 118 is mutated to serine, and at the same time alanine at position 169 is mutated to threonine;

[0016] (9) Alanine at position 169 is mutated to threonine, and at the same time cysteine at position 172 is mutated to tyrosine;

[0017] (10) Alanine at position 118 is mutated to serine, alanine at position 169 is mutated to threonine, and at the same time threonine at position 238 is mutated to methionine;

[0018] (11) Alanine at position 118 is mutated to serine, alanine at position 169 is mutated to threonine, alanine at position 234 is mutated to serine, and at the same time threonine at position 238 is mutated to methionine.

[0019] The present invention uses Pseudomonas PseudomonasBased on the imine reductase with the accession number WP_213665450.1 in sp. RC4D1, NCBI, this enzyme has relatively high enzyme activity and low enantioselectivity in the wild-type enzyme. In the present invention, the residues around the substrate of the imine reductase are mutated to change the interaction between the enzyme molecule and the substrate. The obtained imine reductase mutant can achieve good, even 99.9% optical purity in the reaction of catalyzing the preparation of S -nicotine.

[0020] In a second aspect, the present invention provides a gene encoding the above-mentioned imine reductase mutant.

[0021] In a third aspect, the present invention provides a recombinant vector, and the recombinant vector contains the above-mentioned gene.

[0022] In a fourth aspect, the present invention provides a genetically engineered bacterium, and the genetically engineered bacterium contains the above-mentioned gene.

[0023] In a fifth aspect, the present invention provides the use of the above-mentioned imine reductase mutant, or the above-mentioned recombinant vector, or the above-mentioned genetically engineered bacterium in the preparation of S -nicotine.

[0024] In a sixth aspect, the present invention provides a method for preparing S -nicotine. Under a coenzyme recycling system, using the crude enzyme solution, pure enzyme or immobilized enzyme of the above-mentioned imine reductase mutant, or the wet cells or whole cells of the above-mentioned genetically engineered bacterium as a catalyst to carry out the reaction for preparing S -nicotine.

[0025] Furthermore, the coenzyme recycling system includes a coenzyme, glucose and glucose dehydrogenase, and the coenzyme is NADP+ or NAD+.

[0026] Even further, the glucose dehydrogenase is Bc GDH from Bacillus cereus (accession number EEL32290.1 in NCBI), Bm GDH from Bacillus megaterium (accession number WP_013055759.1 in NCBI) or Ba GDH from Bacillus amyloliquefaciens (accession number QKN90487.1 in NCBI).

[0027] Furthermore, in the reaction, the reaction temperature is 15 - 35 °C, the pH value is 5.5 - 8.5, and the substrate concentration is 50 - 500 mM.

[0028] Even further, the catalytic reduction reaction is carried out in 100 mM phosphate buffer, and the coenzyme concentration is 0.01 - 0.1 mM.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention mutates the imine reductase derived from Pseudomonas Pseudomonas sp. RC4D1 and the imine reductase with the accession number WP_213665450.1 in NCBI to obtain a series of mutants. While maintaining the high enzyme activity of the wild-type imine reductase, the enantioselectivity in the catalytic preparation of S -nicotine reaction is improved. Compared with the prior art, the production process of the present invention is simple, the reaction conditions are mild, the selectivity of the imine reductase is high, the optical purity of the product is high, and it has good industrial application prospects. Description of the Drawings

[0031] Figure 1 The reaction equation for the imine reductase to catalyze the formation of S -nicotine from pseudooxynicotine.

[0032] Figure 2 The achiral high-performance liquid chromatography detection spectrum of the reaction solution.

[0033] Figure 3 For S The achiral liquid chromatography of the -nicotine standard.

[0034] Figure 4 The chiral high-performance liquid chromatography detection spectrum of the reaction solution.

[0035] Figure 5 For S The chiral high-performance liquid chromatography detection spectrum of the -nicotine standard.

[0036] Figure 6 For the reaction progress diagram of the preparation of S -nicotine in Example 7. Detailed Embodiments

[0037] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and only a part of the embodiments of the present invention, rather than all of the embodiments.

[0038] Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0039] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the art and can be obtained through commercial channels. The experimental methods without specified detailed conditions are carried out according to conventional experimental methods or the operation manuals recommended by the suppliers. For specific gene cloning operations, reference can be made to "Molecular Cloning: A Laboratory Manual" edited by J. Sambrook et al.

[0040] Reagents used in upstream genetic engineering operations: The restriction endonucleases, PrimerSTAR, DNA polymerase, DNA ligase, and recombinase used in the embodiments of the present invention are all purchased from TaKaRa; the genomic DNA extraction kit, plasmid extraction kit, and DNA recovery and purification kit are purchased from Axygen; E. coli BL21(DE3), plasmids, etc. are purchased from Novagen; DNA marker, low molecular weight standard protein, and agarose electrophoresis reagents are purchased from Beijing TransGen Biotech Co., Ltd.; primer synthesis and gene sequencing work are completed by Hangzhou Qingke Zixi Biotechnology Co., Ltd. The usage methods of the above reagents refer to the product manuals.

[0041] Reagents used in the catalytic process: Nornicotine (4-(methylamino)-1-(pyridin-3-yl)butanone), NADPH, disodium hydrogen phosphate, sodium dihydrogen phosphate, etc. are all commercially available analytical pure reagents.

[0042] The structural formula of nornicotine is shown in Formula (1), S The structural formula of -nicotine is shown in Formula (2).

[0043]

[0044] The preparation of S -nicotine reaction equation is as Figure 1 shown.

[0045] In the present invention, the concentrations of substrates and products in the reaction solution are analyzed by high performance liquid chromatography (HPLC) to monitor the progress of the reaction.

[0046] The enzyme activity is analyzed using a reverse system, and the analysis method is as follows: The chromatographic column model is YMC-Triart C18, 3 μm, 4.6×150 mm. The mobile phase is K 2 HPO 4 (10 mM): acetonitrile = 65:35, pH = 10; the detection wavelength is 260 nm, the flow rate is 1.0 mL / min, and the column temperature is 30°C. The elution peaks are as Figure 2 shown, and the elution peak of the product nicotine (standard) is as Figure 3 shown.

[0047] Chirality was analyzed using a positive system, and the analysis method was as follows: The chromatographic column model was Daicel OD-H chromatographic column, 5 μm, 4.6×250 mm; the mobile phase was n-hexane: isopropanol: diethylamine = 98:2:0.1, the flow rate was 0.6 mL / min, the detection wavelength was 260 nm, and the column temperature was 25 °C. The peak emergence situation of the sample was as Figure 4 shown, and the peak emergence situation of the product nicotine (standard product) was as Figure 5 shown.

[0048] The calculation method of enzyme activity was:

[0049] Enzyme activity ( (1)

[0050] In formula (1), k 1 : the slope of the nicotine standard curve; b 1 : the intercept of the nicotine standard curve; k 2 : the dilution factor of the detected sample; V 1 : the volume of the reaction system, in L; V 2 : the volume of the enzyme solution added to the reaction system, in L; k 3 : the dilution factor of the enzyme solution; S 1 : the peak area of nicotine, T: the reaction time, in min.

[0051] The amino acid sequence of the wild-type enzyme of imine reductase used in the present invention is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.1.

[0052] SEQ ID NO.1:

[0053] ATGCAAAGTGAAGTAACAGTTATAGGACTAGGGGCGATGGGTAGCGCGCTGGCGCACGTACTGTTGAGAGCGGGTAAACGTGTTACCGTTTGGAACCGCTCTCTCTCTCGTACTGAAAGCGCTGCGGGTGCGGGTGCCCACGTGTCTGAGACATTTATCAGCGCCATCTCCGCGAGTCCAGTGTGCCTGTTTTGTGTTGACAACTATGCAGTCACCAATGCACTGCTTACCGCAAATGATATCGAGGGCGTGTTGTCCGGCAAACTGTTAGTTCAGCTGTCCACCGGTGACCCGCAGGAGGCGCGTGATAGCGAGGAATGGGCATTGTCACGTGGTGCGGACTACCTGGATGCAGCGATTCTGGCGTTCCCGGCTCAAATGGGTACGCAAGAGGCGACCATTATTGTTAGCGGCGCGTTAGCCTCCTTTGAACGCGGTGCCTCGATCCTCAAGCTGCTGGCTCCGAACCTGTCGTACCTGGGCGACCGCGTTGGTGCTGCTTCGGCGCAGGATTGTGCGGTGGCCGCGTATTTCAGCGGCGCGCTGTTGGGCGCGTTACATGGTGCTCGTATTTGCGAAGTGGAAGGCCTGCCGGTGGACGAATACTGCAGCTTGCTGGCTGATATCTCCCCGGTTCTGGGCGGTGACATCCAGCACATGGGCGCTATGATTCATAGCGAGAGCTACAGCACCCCGCAGGCGAGCCTTAAGACGTGGGCGGCGGCGATCAGCCGTCTGGAACGTCACGCAAAAGCAGTCAAAATCAACCACGAATTTCCGGCATTCGCCTCTGCATTGTTCCGCTTGGGCGTTGATGCCGGCTATGGTAGCGAGGAGGTTGCAGCGCTGATTAAGGTGTTACGTGCGGTCAGCGAGGTGCGTTAA

[0054] SEQ ID NO.2:

[0055] MQSEVTVIGLGAMGSALAHVLLRAGKRVTVWNRSLSRTESAAGAGAHVSETFISAISASPVCLFCVDNYAVTNALLTANDIEGVLSGKLLVQLSTGDPQEARDSEEWALSRGADYLDAAILAFPAQMGTQEATIIVSGALASFERGASILKLLAPNLSYLGDRVGAASAQDCAVAAYFSGALLGALHGARICEVEGLPVDEYCSLLADISPVLGGDIQHMGAMIHSESYSTPQASLKTWAAAISRLERHAKAVKINHEFPAFASALFRLGVDAGYGSEEVAALIKVLRAVSEVR

[0056] Example 1 Construction of wild enzyme engineering bacteria

[0057] Search for imine reductase in the National Coalition Building Institute (NCBI) database and select the one derived from Pseudomonas Pseudomonas sp. RC4D1 ( Ps IRED, the accession number in the NCBI database is WP_213665450.1, the base sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2); the amino acid sequence is converted into a nucleotide sequence by codon optimization. The nucleotide sequence is chemically synthesized in full (Yixin Biology) and integrated into the multiple cloning site of the expression vector pET-28a(+); finally, the constructed plasmid is introduced into Escherichia coli BL21(DE3) host cells to construct wild imine reductase engineering bacteria.

[0058] Example 2 Construction of imine reductase mutants

[0059] I. Activation of engineering bacteria and plasmid extraction

[0060] The engineering bacteria constructed in Example 1 were activated and cultured using LB medium.

[0061] The formula of LB medium is: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, dissolved in deionized water and made up to volume, sterilized at 121 °C for 20 min for use. The solid medium is LB medium added with 2% (mass percentage) agar.

[0062] Inoculate the glycerol tube of the preserved engineered bacteria into a test tube containing 10 mL of LB medium and culture at 37°C and 200 rpm for 12 h. After obtaining the cultured bacteria, extract the plasmid according to the operation manual of the Axygen plasmid extraction kit. The obtained plasmid can be directly used for site-directed mutagenesis or stored at -80°C for long term.

[0063] II. Site-directed mutagenesis of genes

[0064] For gene mutation, the whole plasmid PCR method is used. When only a small range of mutations are needed, the mutations can be designed in the upstream and downstream primers, and PCR is carried out using the plasmid as the template to obtain the target plasmid.

[0065] Table 1 PCR amplification system

[0066]

[0067] PCR amplification program: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 55 - 58°C (adjusted according to the primer Tm value) for 15 s, extension at 72°C for 75 s (adjusted according to the gene length, 10 s / 1 kb), for a total of 30 cycles; then extension at 72°C for 10 min; storage at 4°C at low temperature.

[0068] After the PCR amplification is completed, the amplification product is detected by 0.9% (mass percentage) agarose gel electrophoresis. The result shows that the amplification product is a single band. The amplification product is purified and recovered using a DNA recovery kit, and the specific steps refer to the purification kit instruction manual.

[0069] The mutation sites of the mutants and the primers designed according to the mutation sites are shown in Table 2.

[0070] Table 2 Mutation sites and primers

[0071]

[0072] III. Construction of mutant engineered bacteria

[0073] Digest the purified gene fragment with Dpn I to remove the template, and then perform recombination with recombinase; transform the recombination product into E.coil BL21(DE3) competent cells, spread on plates, pick single colonies into LB liquid culture, identify the positive transformants successfully constructed by PCR method, and verify the correctness of the mutation sites by sequencing. After verification, add sterile glycerol with a final concentration of 20% (volume percentage), label and store at -80°C for standby.

[0074] Example 3 Cultivation of imine reductase bacteria and preparation of its enzyme powder

[0075] After the engineering bacteria containing the imine reductase gene were activated by streaking on a petri dish, a single colony was picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured with shaking at 37 °C for 10 h. Then, it was transferred to 50 mL of fresh LB liquid medium containing 50 μg / mL Kan at an inoculation amount of 2%, and cultured with shaking at 37 °C until the OD 600 reached about 0.6 - 0.8. IPTG was added to a final concentration of 0.25 mM, and the culture was induced at 18 °C for 18 h. After the culture was completed, the culture broth was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the cells were collected. The collected cells were resuspended in 2 volumes of 100 mM Tris-HCl buffer at pH 7.5, sonicated, and then centrifuged at 12000 rpm at 4 °C for 10 min to remove the precipitate. The obtained supernatant was freeze-dried to obtain imine reductase enzyme powder.

[0076] Example 4 Cultivation of Glucose Dehydrogenase Bacteria and Preparation of Enzyme Powder

[0077] After the engineering bacteria containing the glucose dehydrogenase gene were activated by streaking on a petri dish, a single colony was picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured with shaking at 37 °C for 8 h. Then, it was transferred to 50 mL of fresh LB liquid medium containing 50 μg / mL Kan at an inoculation amount of 2%, and cultured with shaking at 37 °C until the OD 600 reached about 0.6 - 0.8. IPTG was added to a final concentration of 0.5 mM, and the culture was induced at 18 °C for 16 - 18 h. After the culture was completed, the culture broth was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the cells were collected. The collected cells were resuspended in 2 volumes of 100 mM Tris-HCl buffer at pH 7.5, sonicated, and the lysate was centrifuged at 12000 rpm at 4 °C for 10 min to remove the precipitate. The obtained supernatant was freeze-dried to obtain glucose dehydrogenase enzyme powder.

[0078] Example 5 Purification of Imine Reductase and Its Mutants

[0079] The crude enzyme solution of imine reductase and its mutants was obtained in the manner of Example 3. Imine reductase has a 6×His fusion tag at the N-terminus. Since the imidazole group of histidine can chelate with Ni ions, a Ni-NTA protein purification column was used for protein purification.

[0080] The specific operation steps are as follows:

[0081] Pretreatment of protein sample and Ni-NTA protein purification column: Filter the obtained crude imine reductase solution through a 0.22 μm filter membrane to further remove impurities. Rinse the Ni-NTA protein purification column with 10 column volumes of ultrapure water to ensure that 20% (v / v) ethanol in the column is rinsed clean, and equilibrate the Ni-NTA protein purification column with 10 column volumes of 25 mM imidazole solution.

[0082] Protein purification and elution: Load the filtered imine reductase protein sample onto the column repeatedly 2 times. Rinse the Ni-NTA affinity column with 10 column volumes of 25 mM imidazole solution to remove unbound impurity proteins. Elute the target protein by rinsing the Ni-NTA affinity column with 10 column volumes of 250 mM imidazole, and collect the eluted target protein and store it on ice.

[0083] Protein ultrafiltration and desalting: Concentrate the collected target protein using a Millipore ultrafiltration tube with a molecular weight cut-off of 10 kDa by centrifugation at 4000 rpm for 30 min at 4°C. After concentration, wash and replace with 0.1 M phosphate buffer to remove imidazole, and finally concentrate to about 1 mL, add glycerol with a final concentration of 20% (v / v), measure its protein concentration by Bradford method, and store it at -80°C in the refrigerator for later use.

[0084] Example 6 Enzyme activity of imine reductase and its mutants and ee Value determination

[0085] Obtain the wild-type and mutants of imine reductase Ps IRED pure enzymes according to the method of Example 5. Establish a 400 μL reaction system, in which the final concentration of imine reductase is 0.1 mg / mL, the concentration of substrate pseudooxynicotine is 10 mM, and the final concentration of coenzyme NADPH is 10 mM. The reaction is carried out in 0.1 M phosphate buffer at pH 6.5. Control the reaction temperature and rotation speed with a shaker. After reacting the reaction solution at 25°C and 220 rpm for 16 h, add 400 μL of n-hexane, shake and extract, take the supernatant after centrifugation for chiral analysis, and calculate the relative enzyme activity and ee Value. The results are shown in Table 3. Among them, the enzyme activities and ee Values of mutants A118S, S168R, A169T, C172Y, A234S, T238M, A118S / S168R, A118S / A169T, A169T / C172Y, A118S / A169T / T238M, A118S / A169T / T238M / A234S are all improved compared with the wild-type.

[0086] Table 3 Specific enzyme activities of imine reductase and its mutants catalyzing pseudooxynicotine and ee Value

[0087]

[0088] Example 7 Preparation of (-)-nicotine using imine reductase and glucose dehydrogenase Bc Preparation of GDH S -nicotine

[0089] Obtain imine reductase and glucose dehydrogenase according to the methods of Example 3 and Example 4 Bc Enzyme powder of GDH. Prepare a mixed solution of 0.5 M substrate pseudooxynicotine and 0.5 mM coenzyme NADP+ with pH 7.0, 0.1 M Tris-HCl solution for standby. Add 20 mL of pH 7.5, 0.1 M Tris-HCl buffer solution to a 50 mL three-necked flask, then add 0.1 g of imine reductase, 0.02 g Bc GDH, and 30 mL of the pre-prepared mixed solution of substrate and coenzyme. Control the reaction temperature at 20 °C by water bath, stir magnetically, take samples at regular intervals, and detect the concentration and ee value of the product by liquid chromatography, where the reaction process is as Figure 6 shown, and the detection results after 8 h of reaction are shown in Table 4

[0090] Table 4 Yield of (-)-nicotine and S value prepared by imine reductase and its mutants ee value

[0091]

[0092] Example 8 Preparation of (-)-nicotine using imine reductase and glucose dehydrogenase Bm Preparation of GDH S -nicotine

[0093] Obtain imine reductase and glucose dehydrogenase according to the methods of Example 3 and Example 4 Bm Enzyme powder of GDH. Prepare a mixed solution of 0.3 M substrate pseudooxynicotine and 0.3 mM coenzyme NAP+ with pH 8.0, 0.1 M Tris-HCl solution for standby. Add 20 mL of pH 8.0, 0.1 M Tris-HCl buffer solution to a 50 mL three-necked flask, then add 0.1 g of imine reductase, 0.02 g Bm GDH, and 30 mL of the pre-prepared mixed solution of substrate and coenzyme. Control the reaction temperature at 25 °C by water bath, stir magnetically, and detect the concentration and ee value of the product by liquid chromatography after 8 h of reaction. The results are shown in Table 5

[0094] Table 5 Yield of (-)-nicotine and S- Yield of nicotine and ee value

[0095]

[0096] Example 9 Preparation using imine reductase and glucose dehydrogenase Ba GDH S - Nicotine

[0097] Obtain imine reductase and glucose dehydrogenase according to the methods of Example 3 and Example 4 Ba Enzyme powder of GDH. Prepare a mixed solution of 0.4 M substrate pseudooxynicotine and 0.4 mM coenzyme NAD+ with pH 8.5, 0.1 M Tris-HCl solution for standby. Add 20 mL of pH 6.5, 0.1 M Tris-HCl buffer solution to a 50 mL three-necked flask, then add 0.1 g of imine reductase, 0.02 g Ba GDH, and 30 mL of the pre-prepared mixed solution of substrate and coenzyme. Control the reaction temperature at 30 °C by water bath, stir magnetically, and after reacting for 8 h, detect the concentration of the product and ee value by liquid chromatography. The results are shown in Table 6.

[0098] Table 6 Preparation of imine reductase and its mutants S - Yield of nicotine and ee value

[0099]

Claims

1. An imine reductase mutant, characterized in that: The imine reductase with the amino acid sequence as shown in SEQ ID NO.2 is mutated, and the mutant form is one of the following mutant forms: (1) Alanine at position 118 mutated to serine; (2) Alanine at position 118 mutated to serine, and serine at position 168 mutated to arginine; (3) Alanine at position 118 mutated to serine, and alanine at position 169 mutated to threonine; (4) Alanine at position 118 mutated to serine, alanine at position 169 mutated to threonine, and threonine at position 238 mutated to methionine; (5) Alanine at position 118 mutated to serine, alanine at position 169 mutated to threonine, alanine at position 234 mutated to serine, and threonine at position 238 mutated to methionine.

2. A gene encoding the imine reductase mutant according to claim 1.

3. A recombinant vector, characterized in that: The recombinant vector comprises the gene according to claim 2.

4. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria comprises the gene as claimed in claim 2.

5. The imine reductase mutant according to claim 1, or the recombinant vector according to claim 3, or the genetically engineered bacterium according to claim 4 in the preparation of S -Application of nicotine.

6. Preparation S - Nicotine method, characterized in that In a coenzyme circulation system, the crude enzyme solution, pure enzyme or immobilized enzyme of the imine reductase mutant as claimed in claim 1, or the wet bacteria or whole cells of the genetically engineered bacteria as claimed in claim 4 are used as catalysts to prepare the reaction. S -Nicotine.

7. The method according to claim 6, characterized in that The coenzyme circulation system includes coenzymes, glucose and glucose dehydrogenase, and the coenzyme is NADP+ or NAD+.

8. The method according to claim 6, characterized in that In the reaction, the reaction temperature is 15-35° C., the pH value is 5.5-8.5, and the substrate concentration is 50-500 mM.

Images