Construction and marking method of outer body protein II proximity marker vector

Abstract

The invention provides a construction method and a marking method of an outer body protein II proximity marker vector. According to the invention, fusion expression is carried out on a COP II coated vesicle component Sar1b protein and biotin ligase BioID2 to construct an outer body protein II proximity marker vector, and a proximity marker method for successfully constructing the COP II coated vesicle on a PK-15 cell is used for marking the component and cargo protein of the COP II. The constructed high-sensitivity instantaneous labeling method can be used for screening COP II labeled proteins under different cell states and test conditions, so that the functions of COP II in time and space are dynamically analyzed. According to the proximity marker method for successfully obtaining the COP II coated vesicles on the PK cells, a powerful tool is provided for exploring direct or indirect interaction between COP II and cargo protein.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the construction of a coat protein II proximity marker vector and a marking method thereof. Background Art

[0002] In eukaryotic cells, information communication and material exchange between organelles are mainly responsible for vesicle transport. Vesicles coated with coatomer protein II (COP II) are formed at the endoplasmic reticulum exit sites (ERES), mediating anterograde transport from the endoplasmic reticulum (ER) to the Golgi apparatus (Golgi), where ERES is a long-standing subdomain on the ER. The COP II complex consists of a small GTPase (Sar1) and two heterodimers (Sec23 / Sec24 and Sec13 / Sec31). After the GTPase activity is activated, Sar1 inserts into the ER membrane to bend it and recruits Sec23 / Sec24 dimers to form the inner layer of the vesicle membrane. Sec24 is the main regulatory molecule of the COP II pathway, which captures cargo by recognizing specific sorting signals in cargo. The Sar1-Sec23 / Sec24 complex forms nascent vesicles and recruits Sec13 / Sec31. Sec13 / Sec31 forms a cage-like structure around the vesicle, thus maintaining the curvature of the vesicle membrane. Sec13 / Sec31 can inactivate Sar1 GTPase, resulting in the separation of COPⅡ vesicles from the ER and the formation of a complete vesicle structure. As a classic secretory pathway for ER export, COPⅡ-coated vesicles are often hijacked for viral genome replication and transport of viral particles. For example, poliovirus uses the budding mechanism of COPⅡ vesicles to form a complex in the endoplasmic reticulum for genome replication. Other studies have found that during Ebolavirus infection, the virus interacts with the host COPⅡ component protein Sec24C through the matrix protein VP40, thereby mediating the transport of viruses within cells.

[0003] All proteins in cells work together by interacting with other cellular components, including proteins and nucleic acids. These protein complexes constitute the basic units of cellular life activities and participate in various life processes, including biological signal transduction, gene expression, cell metabolism, cell cycle regulation, etc. Proteins play a central role in these different processes, so the development of methods to identify proteins in various complexes is very important for further studying their functional characterization. Currently, several traditional methods are used to screen protein-protein interactions (PPIs), including co-immunoprecipitation (co-IP), mass spectrometry (MS) analysis, and yeast two-hybrid (Y2H) assays. However, in most cases, co-IP can only detect high-affinity interactions, not weak or transient interactions, and has low detection efficiency in identifying interactions with insoluble proteins, especially membrane-associated proteins. Y2H is another common method for determining PPIs. However, the construction of cDNA libraries suitable for Y2H is labor-intensive and cumbersome, and some proteins, such as transcription factors, are not suitable for Y2H assays. In addition, both traditional co-IP and Y2H assays are limited to the identification of PPIs in vitro or under non-physiological conditions. The recently developed proximity labeling (PL) method overcomes some of the inherent limitations of traditional methods. PL is usually performed by fusing the catalytic enzyme to the bait protein or immobilizing it in a subcellular compartment. The addition of the corresponding substrate activates the covalent labeling of active small molecules with the proximal proteins of the bait protein in living cells. Therefore, abundant soluble proteins and insoluble membrane proteins that are difficult to obtain by conventional methods can be effectively enriched, thereby combining MS to identify proteins close to the bait protein or organelles.

[0004] PL has irreplaceable advantages in detecting transient and weak interactions between proteins in living cells. The labeling method is based on a biotin ligase BirA that is widely expressed in microorganisms. BirA can mediate the biotinylation of specific lysine residues in the target protein by the acetyl-CoA carboxylase subunit. In 2004, Choi-Rhee et al. screened out the BirA mutant R118G (BirA*), and the biotinylation method mediated by it was called BioID. The biotinylation efficiency of BirA* is significantly higher than that of wild-type BirA. It does not require a specific substrate and can add biotin to proteins within a range of 10 nm. Therefore, it is widely used in the subcellular localization analysis of proteins and the identification of protein interactions. In 2016, Kim et al. further studied and screened out another mutant of BirA, R40G, called BioID2. Compared with BioID, BioID2 has a wider range of biotinylation, significantly improved labeling efficiency, and a smaller molecular weight, so it can achieve more precise protein targeting. The disadvantage of BioID and BioID2 is that the biotin treatment time is long, generally longer than 12 hours. In 2018, Branon et al. designed another mutant of biotin ligase, TurboID, which can label the target protein within 10 minutes of biotin treatment. PL can reveal unprecedented spatial protein interaction networks, thereby better understanding specific biological processes.

[0005] The present invention fuses Sar1b with biotin ligases BioID, BioID2 and TurboID, combines streptavidin blotting test, streptavidin fluorescence test and streptavidin pull-down experiment to optimize the proximity labeling conditions and verify its specificity, and successfully captures the labeling method of COPⅡ component proteins and cargo proteins in PK cells. Summary of the invention

[0006] The purpose of the present invention is to provide a construction of a proximity marker vector for coat protein II and a marking method thereof.

[0007] The method for constructing the coat protein II proximity marker vector of the present invention comprises the following steps: (1) Construction of biotin ligase expression vector pCDH-BioID2: The gene fragment of biotin ligase BioID2 was ligated into a eukaryotic expression vector to construct the biotin ligase expression vector pCDH-BioID2; the eukaryotic expression vector was pCDH-CMV-513B-1; the nucleotide sequence of biotin ligase BioID2 was shown in SEQ ID NO.2.

[0008] Biotin ligase BioID2 adds restriction sites and protective bases at both ends of the sequence: N'- Eco RI-BioID2- Bam HⅠ-C'; then the synthesized target fragment and the corresponding eukaryotic expression vector pCDH-CMV-513B-1 were double-digested with enzymes, the enzyme digestion system was 10×QuickCut Buffer 3.0μL, enzyme Ⅰ 1.5μL, enzyme Ⅱ 1.5μL, target fragment / vector 1.0μg, add ddH2O to 30μL, and the enzyme digestion program was 37℃, 1.5h; After enzyme digestion, the purified target fragment and the vector were connected using T4 ligase to form a recombinant plasmid. The connection system was 10×T4 Ligase buffer 1.0μL, T4 Ligase 0.2μL, target fragment 6.6μL, and vector 2.2μL.

[0009] (2) Construction of COPⅡ proximity marker vector pCDH-Sar1b-BioID2: Amplify the Sar1b sequence, and amplify the Sar1b sequence and biotin ligase expression vector pCDH-BioID2 by XB Ⅰ and Eco After double digestion with RⅠ, the digested fragments were connected to construct the COPⅡ proximity marker vector pCDH-Sar1b-BioID2; The nucleotide sequence of Sar1b sequence is shown in SEQ ID NO. 4. The enzyme digestion system is 10×QuickCutBuffer 3.0 μL, enzyme I 1.5 μL, enzyme II 1.5 μL, target fragment / vector 1.0 μg, add ddH2O to 30 μL, and the digestion program is 37°C, 1.5 h.

[0010] After enzyme digestion, the purified Sar1b target fragment was connected to the biotin ligase expression vector pCDH-BioID2 using T4 ligase. The connection system was 10×T4 Ligase buffer 1.0μL, T4 Ligase 0.2μL, target fragment 6.6μL, vector 2.2μL; the connection procedure was 22℃, 2h.

[0011] The proximity labeling method for the vesicles coated with vesicles of PK cells based on the proximity labeling vector of vesicle protein II comprises the following steps: Opti-MEM and vesicle protein II proximity labeling vector are vortexed and mixed, and then TurboFect transfection reagent is added and vortexed and mixed, and the transfection complex is obtained after standing, and the transfection complex is added to the PK-15 cells to be analyzed and mixed and cultured for 20 to 25 hours, and biotin is added, and the culture is continued for 12 to 18 hours to complete the labeling. The concentration of biotin is 50 μmol / L.

[0012] In summary, the present invention constructs a proximity labeling vector of coat protein II by fusion expression of Sar1b protein, a component of COPⅡ coated vesicles, with biotin ligase BioID2, and successfully constructs a proximity labeling method of COPⅡ coated vesicles on PK-15 cells, which is used to label components and cargo proteins of COPⅡ. The highly sensitive transient labeling method constructed can screen COPⅡ labeled proteins under different cell states and experimental conditions, and then dynamically analyze the function of COPⅡ in time and space, providing a powerful tool for exploring the direct or indirect interaction between COPⅡ and cargo proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Construction of recombinant expression plasmid of biotin ligase; A. Double restriction digestion of biotin ligase M.DNA standard DL5000; 1.BioID; 2.BioID2; 3.TurboID; B. Double restriction digestion identification of recombinant plasmid M.DNA standard DL8000; 1.pCDH-BioID; 2.pCDH-BioID2; 3.pcDNA-TurboID; Figure 2 Construction of COPⅡ proximity marker plasmid; A. PCR amplification of Sar1b M. DNA standard DL5000; 1-3. Sar1b; B. Double restriction enzyme digestion identification of recombinant plasmid M. DNA standard DL8000; 1. pCDH-Sar1b-BioID; 2. pCDH-Sar1b-BioID2; 3. pcDNA-Sar1b-TurboID Figure 3 Optimization of proximity labeling of COPⅡ; A. Schematic diagram of proximity-dependent biotinylation of COPⅡ components and cargo by Sar1-BirA (BioID); B. Streptavidin blot analysis of the time course of biotinylation; C. Streptavidin blot comparison of biotinylation efficiency of different ligases; D. Streptavidin pull-down analysis of biotin dose dependence of Sar1b-BioID2 Figure 4 Specificity of Sar1b-BioID2-mediated biotin labeling; A. Streptavidin pull-down analysis of Sar1b-BioID2 capturing COPⅡ components and cargo proteins; B. Streptavidin fluorescence analysis of co-localization of biotinylated proteins and COPⅡ proteins (scale bar: 10μm) DETAILED DESCRIPTION

[0014] The present invention is described in detail below through specific embodiments.

[0015] The materials and reagents used in the present invention are as follows: 1. Cells HEK293T cells (Human embryonic kidney-derived cell line, HEK-293T cells) and PK-15 cells (Porcine Kidney-15, PK-15) were maintained by our laboratory.

[0016] 2. Main Reagents DMEM cell culture medium, fetal bovine serum (FBS) and trypsin for cell culture were purchased from Gibco; protein loading buffer, protein dual-color pre-stained indicator Marker and skim milk powder for Western blot were purchased from Thermo Fisher; RIPA cell lysis buffer, 40g / L paraformaldehyde fixative for immunofluorescence, TritonX-100, blocking buffer, primary antibody dilution buffer, secondary antibody dilution buffer and cell nucleus DAPI staining solution were purchased from Beyotime; Anti-Sar1b, Anti-Sec31A and Anti-Sec23 were purchased from Abcam; Anti-Sec13, Anti-Sec24A and Anti-ERGIC53 were purchased from Proteintech; HRP-labeled Anti-Mouse and Anti-Rabbit antibodies were purchased from Kangwei Century Biotechnology; fluorescent antibodies Alexa Fluor® 488 Anti-Mouse and Alexa Fluor® 594 Anti-Rabbit was purchased from Yisheng Biotechnology Co., Ltd. Water-soluble cholesterol, egg yolk lecithin, polybrene, biotin and HRP-streptavidin were all purchased from Sigma-Aldrich; streptavidin magnetic particles were purchased from Roche; Streptavidin / SAlexa Fluor 647 was purchased from Beijing Solebao Technology Co., Ltd.; PrimeSTAR® MaxDNA polymerase and nucleic acid restriction endonuclease were purchased from Takara; DNA Marker was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; AdvancedDMEM and Chemically defined lipid concentrate (CD) were purchased from Thermo Fisher; Anti-TOM20 was purchased from Proteintech; L-glutamine was domestically produced analytical grade.

[0017] Example 1 Construction of COPⅡ proximity marker vector 1. Construction of biotin ligase expression vectors pCDH-BioID, pCDH-BioID2, and pcDNA-TurboID According to the sequences published on the Addgene website (https: / / www.addgene.org / ), Wuhan Jinkairui Bioengineering Co., Ltd. was commissioned to synthesize the DNA coding sequences of biotin ligases BioID, BioID2, and TurboID, and to add restriction sites and protective bases at both ends of the sequences: N'- Eco RI-BioID- Bam HⅠ-C', N'- Eco RI-BioID2- Bam HⅠ-C', N'- Eco RⅠ-TurboID- XOt Ⅰ-C'. Then the synthesized target fragment and the corresponding empty vector (pCDH-CMV-513B-1 and pcDNA3.1) were double-digested. The digestion system was 10×QuickCut Buffer 3.0μL, enzyme Ⅰ1.5μL, enzyme Ⅱ1.5μL, target fragment (vector) 1.0μg, add ddH2O to 30μL. The digestion program was 37℃, 1.5h. The digested target fragment and vector were subjected to agarose gel electrophoresis and purified by gel recovery kit. Then the purified target fragment and vector were connected by T4 ligase to form a recombinant plasmid. The connection system was 10×T4 Ligase buffer 1.0μL, T4 Ligase 0.2μL, target fragment 6.6μL, vector 2.2μL (BioID and BioID2 were connected to pCDH-CMV-513B-1, TurboID was connected to pcDNA3.1). The connection program was 22℃, 2h. The recombinant plasmid was transformed into E. coli DH5α competent cells, the specific operation is to incubate the competent cells and the pre-cooled connection products on ice for 30 minutes, and flick them every 5 minutes to mix them. Prepare a 42℃ water bath, put the incubated competent connection product mixture into the water bath for heat shock for 90s, and immediately put it back on ice for 3 minutes. Then add 500μL LB culture medium, culture at 37℃ and 180r / min for 1h to revive the bacteria and express resistance. After the end, the culture mixture is centrifuged at 25℃ and 3000r / min for 5min to precipitate the bacteria, discard 400μL supernatant in the clean bench, resuspend the bacteria and evenly spread them on the LB agar culture plate with ampicillin resistance, and culture them upside down in a 37℃ bacterial incubator for 16h. Pick a single colony into 5 mL of LB medium with ampicillin resistance, culture at 37°C and 220 r / min for 12 h, then take 500 μL of bacterial solution and send it to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The remaining bacterial solution is used to extract the recombinant plasmid using a plasmid extraction kit. The plasmid that is sequenced correctly is saved for later use.

[0018] Since there were no nucleic acid templates for biotin ligases BioID, BioID2 and TurboID, we commissioned a gene synthesis company to synthesize gene fragments expressing BioID, BioID2 and TurboID.

[0019] The DNA coding sequence of biotin ligase BioID is (SEQ ID NO.1):5’-AAGGACAACACCGTGCCCCTGAAGCTGATCGCCCTGCTGGCCAACGGCGAGTTCCACTCTGGCGAGCAGCTGGGAGAGACCCTGGGAATGAGCAGAGCCGCCATCAACAAGCACATCCAGACACTGAGAGACTGGGGAGTGGACGTGTTCACCGTGCCTGGCAAGGGCTACAGCCTGCCTGAGCCTATCCAGCTGCTGAACGCCAAGCAGATCCTGGGACAGCTGGATGGCGGAAGCGTGGCCGTGCTGCCTGTGATCGACTCCACCAATCAGTACCTGCTGGACAGAATCGGAGAGCTGAAGTCCGGCGACGCCTGCATCGCCGAGTACCAGCAGGCTGGCAGAGGAGGCAGAGGACGGAAGTGGTTCAGCCCATTCGGAGCCAACCTGTACCTGTCCATGTTCTGGAGACTGGAGCAGGGACCTGCTGCTGCCATCGGACTGAGTCTGGTGATCGGAATCGTGATGGCCGAGGTGCTGAGAAAGCTGGGAGCCGACAAGGTGAGAGTGAAGTGGCCTAATGACCTGTACCTCCAGGACCGCAAGCTGGCTGGCATCCTGGTGGAGCTGACAGGCAAGACAGGCGATGCCGCTCAGATCGTGATCGGAGCCGGAATCAACATGGCCATGAGAAGAGTGGAGGAGAGCGTGGTGAACCAGGGCTGGATCACCCTGCAGGAGGCTGGCATCAACCTGGACCGGAACACCCTGGCCGCCATGCTGATCAGAGAGCTGAGAGCCGCTCTGGAGCTGTTCGAGCAGGAGGGACTGGCTCCTTACCTGAGCAGATGGGAGAAGCTGGACAACTTCATCAACAGACCTGTGAAGCTGATCATCGGCGACAAGGAAATCTTCGGCATCTCCAGAGGAATCGACAAGCAGGGAGCTCTGCTGCTGGAGCAGGACGGAATCATCAAGCCCTGGATGGGCGGAGAAATCTCCCTGAGAAGCGCAGAGAAG-3’;. The DNA coding sequence of BioID2 (SEQ ID NO.2) is: 5’-TTCAAGAACCTGATCTGGCTGAAGGAGGTGGACAGCACCCAGGAGAGACTGAAGGAGTGGAACGTGAGCTACGGCACCGCCCTGGTGGCCGACAGACAGACCAAGGGCAGAGGCGGCCTGGGCAGAAAGTGGCTGAGCCAGGAGGGCGGCCTGTACTTCAGCTTCCTGCTGAACCCCAAGGAGTTCGAGAACCTGCTGCAGCTGCCCCTGGTGCTGGGCCTGAGCGTGAGCGAGGCCCTGGAGGAGATCACCGAGATCCCCTTCAGCCTGAAGTGGCCCAACGACGTGTACTTCCAGGAGAAGAAGGTGAGCGGCGTGCTGTGCGAGCTGAGCAAGGACAAGCTGATCGTGGGCATCGGCATCAACGTGAACCAGAGAGAGATCCCCGAGGAGATCAAGGACAGAGCCACCACCCTGTACGAGATCACCGGCAAGGACTGGGACAGAAAGGAGGTGCTGCTGAAGGTGCTGAAGAGAATCAGCGAGAACCTGAAGAAGTTCAAGGAGAAGAGCTTCAAGGAGTTCAAGGGCAAGATCGAGAGCAAGATGCTGTACCTGGGCGAGGAGGTGAAGCTGCTGGGCGAGGGCAAGATCACCGGCAAGCTGGTGGGCCTGAGCGAGAAGGGCGGCGCCCTGATCCTGACCGAGGAGGGCATCAAGGAGATCCTGAGCGGCGAGTTCAGCCTGAGAAGAAGC-3’; The DNA coding sequence of TurboID is (SEQ ID NO.3): 5’-AAAGACAATACTGTGCCTCTGAAGCTGATCGCTCTCCTGGCTAATGGCGAGTTCCATAGTGGCGAACAGCTGGGAGAAACCCTGGGCATGTCCAGGGCCGCTATCAACAAGCACATTCAGACTCTGCGCGACTGGGGCGTGGACGTGTTCACCGTGCCCGGAAAGGGCTACTCTCTGCCCGAGCCTATCCCGCTGCTGAACGCTAAACAGATTCTGGGACAGCTGGACGGCGGGAGCGTGGCAGTCCTGCCTGTGGTCGACTCCACCAATCAGTACCTGCTGGATCGAATCGGCGAGCTGAAGAGTGGGGATGCTTGCATTGCAGAATATCAGCAGGCAGGGAGAGGAAGCAGAGGGAGGAAATGGTTCTCTCCTTTTGGAGCTAACCTGTACCTGAGTATGTTTTGGCGCCTGAAGCGGGGACCAGCAGCAATCGGCCTGGGCCCGGTCATCGGAATTGTCATGGCAGAAGCGCTGCGAAAGCTGGGAGCAGACAAGGTGCGAGTCAAATGGCCCAATGACCTGTATCTGCAGGATAGAAAGCTGGCAGGCATCCTGGTGGAGCTGGCCGGAATAACAGGCGATGCTGCACAGATCGTCATTGGCGCCGGGATTAACGTGGCTATGAGGCGCGTGGAGGAAAGCGTGGTCAATCAGGGCTGGATCACACTGCAGGAAGCAGGGATTAACCTGGACAGGAATACTCTGGCCGCTACGCTGATCCGAGAGCTGCGGGCAGCCCTGGAACTGTTCGAGCAGGAAGGCCTGGCTCCATATCTGCCACGGTGGGAGAAGCTGGATAACTTCATCAATAGACCCGTGAAGCTGATCATTGGGGACAAAGAGATTTTCGGGATTAGCCGGGGGATTGATAAACAGGGAGCCCTGCTGCTGGAACAGGACGGAGTTATCAAACCCTGGATGGGCGGAGAAATCAGTCTGCGGTCTGCCGAAAAG-3’。

[0020] The biotin ligase expression vector is constructed by connecting the biotin ligase to the eukaryotic expression vector. Figure 1 , the DNA band after enzyme digestion is single and the size is consistent with the length of the target fragment (BioID 1005 bp, BioID 2741 bp and TurboID 1002 bp) ( Figure 1 A); The results of double enzyme digestion of the recombinant plasmid showed specific vector bands and target gene bands, and the fragment size was consistent with expectations ( Figure 1 B). The biotin ligase expression vectors pCDH-BioID, pCDH-BioID2 and pcDNA-TurboID were successfully constructed after sequencing verification.

[0021] 2. Construction of COPⅡ proximity marker vectors pCDH-Sar1b-BioID, pCDH-Sar1b-BioID2, and pcDNA-Sar1b-TurboID Using the pCDH-Sar1b vector constructed by our team earlier as a template (see Wang Tao. Effects of coat protein II on classical swine fever virus replication [D]. Northwest A&F University, 2018.), the Sar1b sequence was amplified. The amplified Sar1b sequence was double-digested with the above-mentioned biotin ligase expression vector (pCDH-BioID, pCDH-BioID2, pcDNA-TurboID). Sar1b was double-digested with two groups of enzymes, one of which was XB Ⅰ and Eco RI, used to construct pCDH-Sar1b-BioID and pCDH-Sar1b-BioID2; the other group is Bam HI and Eco RI, used to construct pcDNA-Sar1b-TurboID. The vectors pCDH-BioID and pCDH-BioID2 were used XB Ⅰ and Eco RⅠ double restriction enzyme digestion, pcDNA-TurboID Bam HI and EcoRⅠ double digestion. The digestion system 6 is 10×QuickCutBuffer3.0μL, enzymeⅠ1.5μL, enzymeⅡ1.5μL, target fragment (vector) 1.0μg, add ddH2O to 30μL. The digestion program is 37℃, 1.5h. The target fragment and vector after digestion are subjected to agarose gel electrophoresis and purified by gel recovery kit. Then, Sar1b with different sticky ends is connected to the corresponding biotin ligase expression vector using T4 ligase. The connection system is 10×T4 Ligase buffer 1.0μL, T4 Ligase 0.2μL, target fragment 6.6μL, vector 2.2μL. The connection program is 22℃, 2h. The ligation product is transformed according to the above steps and the monoclonal colony is picked, expanded and cultured, and sent for sequencing. The plasmid with correct sequencing is saved for later use.

[0022] The Sar1b expression sequence was inserted into the biotin ligase expression vector to construct the COPⅡ proximity labeling vector. First, the Sar1b sequence was amplified using primers with different restriction sites and then purified by gel recovery, such as Figure 2 A, the purified fragment is single and consistent with the length of Sar1b (612bp). Then the purified Sar1b band was connected with pCDH-BioID, pCDH-BioID2 and pcDNA-TurboID after restriction digestion. Figure 2 B, The recombinant plasmid double enzyme digestion can cut out a fragment of the same size as Sar1b. After sequencing verification, COPII proximity marker vectors pCDH-Sar1b-BioID, pCDH-Sar1b-BioID2 and pcDNA-Sar1b-TurboID were successfully constructed.

[0023] The nucleotide sequence of Sar1b sequence is (SEQ ID NO.4): 5'--3' Example 2 Establishment of proximity labeling method for COPⅡ-coated vesicles on PK cells 1. COPⅡ proximity marker vector transient transfection labeling method PK-15 cells were cultured at 1×10 6Inoculate into a 6-well cell culture plate and add culture medium to 1.6 mL. Take a 1.5 mL centrifuge tube, add 400 μL Opti-MEM, then add 4 μg COPⅡ proximity labeling vector (pCDH-Sar1b-BioID, pCDH-Sar1b-BioID2 or pcDNA-Sar1b-TurboID), and vortex to mix. Then add 6 μL TurboFect transfection reagent to the tube and vortex to mix. After standing for 20 minutes, add the above transfection complex dropwise to the inoculated cells, shaking while adding to mix. After culturing in the incubator for 24 hours, change the culture medium and add biotin to it. After continuing to culture for 12 to 18 hours, the biotin-labeled protein can be detected using streptavidin.

[0024] 2. Construction and labeling methods of COPⅡ proximity marker cell lines First, the proximity marker plasmids pCDH-Sar1b-BioID and pCDH-Sar1b-BioID2 constructed above were used to package lentivirus. HEK293T cells were prepared and inoculated into 6-well cell culture plates for culture. When the cell confluence reached 70% to 80%, the transfection mixture for lentivirus packaging was added dropwise. The transfection mixture was prepared as follows: Take a 1.5mL centrifuge tube, add 400μL Opti-MEM, then add 2μg COPⅡ proximity marker vector, 0.67μg pLP1, 0.67μg pLP2, 0.67μg pLP / VSVG, and vortex to mix. Then add 6μL TurboFect transfection reagent to the tube and vortex to mix, and let it stand for 20min. After transfection, the cells were placed in an incubator for continued culture. Prepare Advanced DMEM culture medium, add 20mL / LFBS, 4mmol / LL-Glu, 1×CD, 0.01mmol / L cholesterol, 0.01mmol / L egg yolk lecithin in sequence, mix well and set aside. Take out the HEK293T cells from the incubator 16h after transfection, discard the culture medium, wash once with PBS, add 2mL of the above-prepared Advanced DMEM culture medium, and continue to culture in the incubator. The packaged lentiviral particles will be released into the culture medium. After 48h, collect the cell culture medium, centrifuge at 4℃ and 12000r / min for 10min, collect the supernatant into a new centrifuge tube, and store at -80℃ for later use. When measuring the lentiviral titer, inoculate PK-15 cells in a 96-well cell culture plate, dilute the virus solution gradiently with DMEM containing 6.0μg / mL polybrene and 50mL / LFBS and inoculate it on the cells separately, 100μL / well, and repeat 8 cell wells for each gradient. After 24 hours, the culture medium was replaced with DMEM containing 50mL / L FBS. 72 hours after virus infection, the virus-infected plaques were recorded under an inverted fluorescence microscope, and the TCID50 of the virus was calculated. When constructing a proximity marker cell line, PK-15 cells with good growth status were inoculated into a 6-well cell culture plate. When the cell confluence reached 60% to 80%, 1 MOI of recombinant lentivirus was inoculated into each well, and polybrene was added to make the final concentration 6.0 μg / mL. After continuing to culture at 37°C for 16 hours, the culture medium was replaced with DMEM containing 50mL / L FBS and continued to culture. After 48 hours, the cell luminescence was observed under an inverted fluorescence microscope, and positive cells were selected with puromycin until the positive cells reached more than 90%. The constructed cell line was frozen in liquid nitrogen. When using cell lines for labeling, inoculate adjacent labeled cell lines into 6-well cell culture plates, wait until the cells are stable and reach 80% confluence, add biotin to the culture medium, and continue to culture in the incubator for 12 to 18 hours. Biotin-labeled proteins can be detected using streptavidin.

[0025] 3. Optimization results of neighboring labeling conditions In the COPⅡ proximity labeling method constructed by the present invention, Sar1b is fused with biotin ligase and expressed to participate in the assembly and cargo transport of COPⅡ. When cells are treated with biotin, biotin ligase can biotinylate proteins within a range of 10nm. Therefore, this method can not only label proteins that directly interact with Sar1b, but also label proteins that indirectly bind to and transiently approach Sar1b, thereby capturing cargo molecules of COPⅡ ( Figure 3 A). In order to analyze the effect of different biotin treatment times on PL efficiency, PL cells were treated with biotin for short periods of time (0.1h, 0.5h, 1h) and long periods of time (12h, 18h, 24h), and the labeled proteins were analyzed by affinity streptavidin blotting. The results showed that when the biotin treatment time was less than 1h, BioID2 only labeled a small amount of protein, while BioID and TurboID hardly labeled any protein ( Figure 3 B), indicating that these three biotin ligases are not suitable for capturing cargo proteins of the COPⅡ pathway in a short time. When the biotin treatment time exceeds 12h, these three biotin ligases can label more proteins ( Figure 3 B), in order to reduce non-specific labeling, the subsequent biotin treatment time of the present invention is 12 hours. Comparison of the labeling efficiency of BioID, BioID2 and TurboID after 12 hours of biotin treatment shows that the number of labeled proteins of BioID2 is significantly higher than that of BioID and TurboID ( Figure 3 C). Considering that the relative molecular mass of BioID2 is relatively small and the effect on the localization and function of Sar1b is relatively small, the subsequent COPⅡ proximity labeling vectors of the present invention all use pCDH-Sar1b-BioID2. Finally, the effect of different concentrations of biotin treatment on the labeling efficiency of Sar1b-BioID2 was analyzed by streptavidin pull-down test. The results showed that the labeling intensity of COPⅡ proteins Sec24 and Sec13 increased with the increase of biotin concentration. When the biotin concentration was higher than 10μmol / L, the biotin labeling could be detected. When it was higher than 50μmol / L, the biotinylation of Sec24A and Sec13 could be clearly detected ( Figure 3 D), so the subsequent biotin treatment concentration of the present invention is 50 μmol / L. Based on the above results, the present invention uses pCDH-Sar1b-BioID2 transfection and 50 μmol / L biotin treatment for 12 hours to label the cargo protein of the COPⅡ pathway.

[0026] 4. Streptavidin Blot Assay The biotinylated adjacent labeled cells were washed three times with PBS, collected into a 1.5 mL centrifuge tube, and lysed at 4°C for 30 min by adding 100 μL of ice-cold RIPA cell lysis buffer (containing PMSF). The lysate mixture was then collected into a centrifuge tube, centrifuged at 4°C, 12,000 r / min for 10 min, the supernatant was transferred to a new centrifuge tube, 25 μL of 5× protein loading buffer was added, and the protein was denatured in a boiling water bath for 10 min. The protein samples were immediately used for SDS-PAGE electrophoresis or stored at -80°C. After SDS-PAGE electrophoresis, the whole gel was cut out and transferred to a PVDF membrane under the transfer conditions of 200 mA and 90 min. After the transfer, the PVDF membrane was washed once in TBST, and then placed in 50 g / L skim milk powder and blocked at 25°C for 2 h. After blocking, the membrane was directly transferred to the diluted HRP-streptavidin (1:3000, diluted in TBST) and incubated at 25°C for 2 h. Finally, the membrane was washed 5 times in TBST, 5 min each time. ECL luminescent solution was prepared according to the ratio of solution A to solution B in a ratio of 1:1, mixed thoroughly, and evenly applied on the cleaned PVDF membrane surface, and exposed in a gel imaging instrument.

[0027] 5. Streptavidin fluorescence assay Take the biotin-treated adjacent labeled cells out of the incubator, wash them three times with PBS to remove dead cells, quickly add 40g / L paraformaldehyde fixative, and let them stand at 25℃ for 10min to fix. Discard the paraformaldehyde and wash them three times with PBS, 5min each time. Add 5mL / L Triton X-100 (diluted with PBS) to the fixed cells and let them stand at 25℃ for 15min to penetrate the cells. Discard the penetration solution and wash them three times with PBS, 5min each time. Add immunostaining blocking solution to the permeated cells and incubate them on a shaker at 25℃ for 2h to block the cells. Then discard the blocking solution, add diluted Streptavidin / S Alexa Fluor 647 (diluted with secondary antibody diluent, 1:200), and incubate at 25℃ in the dark for 1.5h. After incubation, wash them three times with PBS in the dark for 5min each. Add DAPI nuclear staining solution to the cells, let them stand at 25℃ in the dark for 10min to stain the nuclei, and wash them three times with PBS, 5min each time. Finally, PBS was replaced with ddH2O, and the cells were observed and photographed using a laser confocal microscope.

[0028] 6. Streptavidin pull-down collection Place the biotin-treated adjacent labeled cells in a 1.5 mL centrifuge tube, add 1 mL IP protein lysate (containing PMSF), incubate on ice for 30 min, and vortex mix once every 5 min. Then centrifuge the cell lysate at 4°C and 12000 r / min for 10 min, and take the supernatant for later use. Take 50 μL of streptavidin magnetic particles into a 2 mL centrifuge tube, wash with TBST 3 times, add the cell lysate supernatant to the magnetic particles, and incubate overnight at 4°C in a vertical flip oscillator. After the incubation, wash the magnetic particles 3 times with TBST, then collect the magnetic particles through a magnetic rack, add 100 μL 1× protein loading buffer, and denature the proteins on the magnetic particles in a boiling water bath for 10 min. After cooling to room temperature, place the centrifuge tube on the magnetic rack for 2 min, collect the supernatant into a new centrifuge tube, and use it immediately for Western blot analysis or store at -80°C for later use.

[0029] 7. Specificity analysis results of Sar1b-BioID2 markers The biotin labeling of COPⅡ component proteins, COPⅡ cargo proteins and mitochondrial proteins in Sar1b-BioID2-expressing cells was analyzed by streptavidin pull-down assay and streptavidin fluorescence co-localization assay to verify the specificity of Sar1b-BioID2 for labeling the COPⅡ secretory pathway. Among them, ERGIC53 is a marker protein dependent on COPⅡ transport, and TOM20 is a mitochondrial synthesis protein. The results showed that the COPⅡ component proteins Sec23 and Sec24A, which directly bind to Sar1b, and the indirect binding proteins Sec31A and Sec13, can be detected by streptavidin ( Figure 4 A, B), indicating that Sar1b-BioID2 can label COPⅡ components. The cargo protein ERGIC53 can be detected to be significantly biotinylated, while the mitochondrial protein TOM20 can hardly be detected to be biotinylated ( Figure 4 A, B) indicate that Sar1b-BioID2 can specifically mark cargo proteins in the COPⅡ secretion pathway.

[0030] In summary, the present invention uses the proximity labeling method to fuse the Sar1b protein, a component of COPⅡ-coated vesicles, with the biotin ligase BioID, BioID2 and TurboID, and optimizes the proximity labeling conditions and verifies its specificity through streptavidin blotting test, streptavidin fluorescence test and streptavidin pull-down test. The results show that compared with BioID and TurboID, after 12 hours of treatment with 50μmol / L biotin, Sar1b-BioID2 has the highest efficiency in labeling cargo proteins in the COPⅡ pathway, and can specifically label cargo proteins in the COPⅡ secretory pathway. Therefore, the present invention successfully obtains a proximity labeling method for COPⅡ-coated vesicles on PK cells, which provides a powerful tool for exploring the direct or indirect interaction between COPⅡ and cargo proteins.

Claims

1. A method for constructing a proximity marker vector of coat protein II, comprising the following steps: (1) Construction of biotin ligase expression vector pCDH-BioID2: The gene fragment of biotin ligase BioID2 was connected to the eukaryotic expression vector to construct the biotin ligase expression vector pCDH-BioID2; (2) Construction of the coat protein II proximity marker vector pCDH-Sar1b-BioID2: Amplify the Sar1b sequence, and amplify the Sar1b sequence and the biotin ligase expression vector pCDH-BioID2 by XB Ⅰ and Eco After double digestion with RⅠ, the digested fragments were connected to construct the coat protein Ⅱ proximity marker vector pCDH-Sar1b-BioID2.

2. The method for constructing the coat protein II proximity marker vector according to claim 1, characterized in that: In step (1), the eukaryotic expression vector is pCDH-CMV-513B-1.

3. The method for constructing the coat protein II proximity marker vector according to claim 1, characterized in that: In step (1), the nucleotide sequence of biotin ligase BioID2 is shown in SEQ ID NO.

2.

4. The method for constructing the coat protein II proximity marker vector according to claim 1, characterized in that: In step (1), the biotin ligase BioID2 adds restriction sites and protective bases at both ends of the sequence: N'- Eco RI-BioID2- Bam HⅠ-C'; then the synthesized target fragment and the eukaryotic expression vector were double-digested with enzymes, the enzyme digestion system was 10×QuickCutBuffer 3.0μL, enzyme Ⅰ 1.5μL, enzyme Ⅱ 1.5μL, target fragment / vector 1.0μg, add ddH2O to 30μL, and the enzyme digestion program was 37℃, 1.5h; After enzyme digestion, the purified target fragment and the vector were connected using T4 ligase to form a recombinant plasmid. The connection system was 10×T4Ligase buffer 1.0μL, T4 Ligase 0.2μL, target fragment 6.6μL, and vector 2.2μL.

5. The method for constructing the proximity marker vector of coat protein II according to claim 1, characterized in that: In step (2), the nucleotide sequence of Sar1b sequence is shown as SEQ ID NO.

4.

6. The method for constructing the coat protein II proximity marker vector according to claim 1, characterized in that: In step (2), the enzyme digestion system is 10× QuickCut Buffer 3.0 μL, enzyme I 1.5 μL, enzyme II 1.5 μL, target fragment / vector 1.0 μg, add ddH2O to 30 μL, and the digestion program is 37°C, 1.5 h; After enzyme digestion, the purified Sar1b target fragment was connected to the biotin ligase expression vector pCDH-BioID2 using T4 ligase. The connection system was 10×T4 Ligase buffer 1.0μL, T4 Ligase 0.2μL, target fragment 6.6μL, vector 2.2μL; the connection procedure was 22℃, 2h.

7. A method for proximity labeling of coat protein-coated vesicles on PK cells using a coat protein II proximity labeling vector constructed according to the method of claim 1, comprising the following steps: vortexing Opti-MEM and a coat protein II proximity labeling vector, adding TurboFect transfection reagent and vortexing, standing to obtain a transfection complex, adding the transfection complex to the PK-15 cells to be analyzed, mixing and culturing for 20 to 25 hours, adding biotin, and continuing to culture for 12 to 18 hours to complete labeling.

8. The method for proximity labeling of the coat protein II proximity labeling vector on the coat protein coated vesicles on PK cells according to claim 7, characterized in that: The biotin concentration was 50 μmol / L.

Images