Molecular target spot for specifically detecting vibrio fluvialis, detection method and application

Abstract

The invention provides a molecular target spot for specifically detecting vibrio fluvialis, a detection method and application, a primer group capable of specifically detecting vibrio fluvialis is designed by taking a gene segment with a nucleotide sequence as shown in SEQ ID NO: 1 or a gene segment with a nucleotide sequence as shown in SEQ ID NO: 2 as a molecular target. A new molecular target is provided for detection of vibrio fluvialis, meanwhile, the established detection method can rapidly identify vibrio fluvialis in a to-be-detected sample, and the method has wide application prospects in detection, prevention and treatment of vibrio fluvialis.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and in particular to a molecular target, a detection method and an application for specifically detecting river Vibrio. Background Art

[0002] V. fluvialis is a halophilic, Gram-negative bacterium with a slightly curved rod-shaped cell morphology that can move by polar flagella. V. fluvialis is an important cause of cholera-like bloody diarrhea and is most likely to cause wound infections and primary sepsis in developed and underdeveloped countries, especially in areas with poor sanitation. The bacterium was first identified in 1975 as group F Vibrio in a patient with diarrhea and was later named V. fluvialis. V. fluvialis is detected with very high frequency in marine animals, such as oysters, blue crabs, and retail fish. V. fluvialis is naturally present in warm, salty and brackish waters and can survive temperatures between 9 and 31°C, but it will multiply when the water temperature rises above 18°C, with most clinical illnesses showing a seasonal pattern of V. fluvialis infection when temperature and salinity factors are favorable for bacterial proliferation. In general, clinical signs of the disease include mild to moderate dehydration, vomiting, fever, abdominal pain, and diarrhea. In Zhejiang Province, China, V. fluvialis has been identified as the second most common pathogen in acute diarrheal cases, but second only to Vibrio parahaemolyticus. Therefore, this pathogen has become not only a major food safety issue but also a serious medical and public health problem.

[0003] At present, the national standard method for the detection of river Vibrio is still the traditional plate culture method. It has the advantages of low cost and strong specificity, but the plate culture counting method also has some disadvantages, such as long culture time and strict requirements on operators and operation process. In order to make up for the shortcomings of the plate detection method, molecular detection methods based on nucleic acid amplification have been applied to the detection of river Vibrio in food.

[0004] The specificity and sensitivity of molecular detection methods based on nucleic acid amplification mainly depend on the selection of corresponding detection targets. At present, PCR detection method is one of the most commonly used molecular detection methods. Its primers are designed based on the specific conservative sequence of the target bacterial genomic DNA (detection target). Therefore, the detection target and primers are crucial to the accuracy and sensitivity of PCR detection. In the early stage of research, many scholars used the toxR gene sequence as the PCR target gene to detect river Vibrio, and its sensitivity was 9.3×10 2CFU / mL (Establishment of a rapid PCR detection method for river Vibrio based on toxR gene, published on October 25, 2009), but there are few reports on molecular detection technologies for other targets of river Vibrio, which makes PCR technology relatively simple in practical applications. Therefore, it is urgent to systematically and comprehensively explore new targets for specific detection, so as to improve the accuracy of PCR detection technology for river Vibrio. Summary of the invention

[0005] In order to overcome the above-mentioned defects and shortcomings in the prior art, the present invention provides molecular targets, detection methods and applications for specific detection of Vibrio fluviatilis.

[0006] The first object of the present invention is to provide a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 for use as a detection target for Vibrio fluviatilis.

[0007] The second object of the present invention is to provide a use of a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 2 in the preparation of a detection product for Vibrio fluviatilis.

[0008] The third object of the present invention is to provide a reagent for detecting a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2 for use in preparing a detection product for Vibrio fluviatilis.

[0009] The fourth object of the present invention is to provide a primer set for detecting a gene fragment having a nucleotide sequence as shown in SEQ ID NO:1.

[0010] A fifth object of the present invention is to provide a primer set for detecting a gene fragment having a nucleotide sequence as shown in SEQ ID NO:2.

[0011] The sixth object of the present invention is to provide a kit for detecting river Vibrio.

[0012] The seventh object of the present invention is to provide a method for detecting river Vibrio.

[0013] Therefore, the present invention claims the following:

[0014] The use of a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 as a detection target for Vibrio fluviatilis.

[0015] Application of a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 in the preparation of a detection product for river Vibrio.

[0016] Application of a reagent for detecting a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2 in the preparation of a detection product for Vibrio fluviatilis.

[0017] Preferably, the reagent for detecting the gene fragment having a nucleotide sequence as shown in SEQ ID NO: 1 is a primer having a nucleotide sequence as shown in SEQ ID NO: 3-4;

[0018] The reagent for detecting the gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 is a primer with a nucleotide sequence as shown in SEQ ID NO: 5-6.

[0019] A primer set for detecting a gene fragment whose nucleotide sequence is shown in SEQ ID NO: 1, the primer set consists of a forward primer F1 and a reverse primer R1, the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO: 4.

[0020] A primer set for detecting a gene fragment whose nucleotide sequence is shown in SEQ ID NO: 2, the primer set consists of a forward primer F2 and a reverse primer R2, the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO: 5, and the nucleotide sequence of the reverse primer R2 is shown in SEQ ID NO: 6.

[0021] A kit for detecting river Vibrio, the kit comprising reagents for detecting a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2, wherein the detection is for the purpose of non-disease treatment diagnosis.

[0022] Preferably, the reagent is the above-mentioned primer set for detecting a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 1 or a primer set for detecting a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2.

[0023] Preferably, the kit further contains PCR reaction reagents, positive control reference substances and / or negative control reference substances.

[0024] More preferably, the positive control reference substance is a plasmid DNA containing a gene fragment with a nucleotide sequence such as that shown in SED ID NO: 1 or a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2, and the negative control reference substance is ddH2O.

[0025] A method for detecting river Vibrio, using any of the above-mentioned kits to detect a sample to be detected, wherein the detection is for the purpose of non-disease treatment diagnosis.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention provides a molecular target, a detection method and an application for specifically detecting river Vibrio. The present invention uses a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 as a molecular target to design a primer set capable of specifically detecting river Vibrio. The present invention provides a new molecular target for the detection of river Vibrio, and the detection method established can quickly identify river Vibrio in a sample to be tested, and has broad application prospects in the detection and prevention of river Vibrio. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the annealing temperature optimization result of the VF-1 and VF-2 primer pairs in Example 2; Lane 1 is the Marker, Lanes 2 to 7 are the amplification results when the annealing temperatures are 50°C, 52°C, 54°C, 56°C, 58°C, and 60°C, respectively, and Lane 8 is the negative control.

[0029] Figure 2 The sensitivity test results of VF-1 primer pair in pure culture samples; Lane 1 is the marker, and lanes 2 to 8 are respectively the concentration of bacterial solution of 6.3×10 7 , 6.3×10 6 , 6.3×10 5 , 6.3×10 4 , 6.3×10 3 , 6.3×10 2 , 6.3×10 1 CFU / mL amplification results, lane 9 is the negative control.

[0030] Figure 3 The sensitivity test results of VF-2 primer pair in pure culture samples; Lane 1 is the marker, and lanes 2 to 8 are respectively the concentration of bacterial solution of 6.3×10 7 , 6.3×10 6 , 6.3×10 5 , 6.3×10 4 , 6.3×10 3 , 6.3×102 , 6.3×10 1 CFU / mL amplification results, lane 9 is the negative control.

[0031] Figure 4 The sensitivity test results of VF-1 primer pair in artificially contaminated fish samples; Lane 1 is the marker, and lanes 2 to 8 are respectively the concentration of bacterial solution of 6.3×10 7 , 6.3×10 6 , 6.3×10 5 , 6.3×10 4 , 6.3×10 3 , 6.3×10 2 , 6.3×10 1 CFU / mL amplification results, lane 9 is the negative control.

[0032] Figure 5 The sensitivity test results of VF-2 primer pair in artificially contaminated fish samples; Lane 1 is the marker, and lanes 2 to 8 are respectively the concentration of bacterial solution of 6.3×10 7 , 6.3×10 6 , 6.3×10 5 , 6.3×10 4 , 6.3×10 3 , 6.3×10 2 , 6.3×10 1 CFU / mL amplification results, lane 9 is the negative control.

[0033] Figure 6 is the specific detection result of the VF-1 primer pair; lane 1 is the Marker, lanes 2 to 16 are the amplification results of Vibrio fluviatilis, Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio vulnificus, Bacillus cereus, Escherichia coli CICC 10411, Escherichia coli CICC10412, Escherichia coli CICC 10662, Escherichia coli CICC 10667, Escherichia coli CICC 24189, Pseudomonas aeruginosa ATCC 15442, Pseudomonas aeruginosa ATCC 27853, Cronobacter sakazakii, Salmonella Enteritidis, and Salmonella Typhimurium, and lanes 17 to 25 are the amplification results of isolated strains of Vibrio parahaemolyticus.

[0034] Figure 7is the specific detection result of the VF-2 primer pair; lane 1 is the Marker, lanes 2 to 16 are the amplification results of Vibrio fluviatilis, Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio vulnificus, Bacillus cereus, Escherichia coli CICC 10411, Escherichia coli CICC10412, Escherichia coli CICC 10662, Escherichia coli CICC 10667, Escherichia coli CICC 24189, Pseudomonas aeruginosa ATCC 15442, Pseudomonas aeruginosa ATCC 27853, Cronobacter sakazakii, Salmonella Enteritidis, and Salmonella Typhimurium, and lanes 17 to 25 are the amplification results of isolated strains of Vibrio parahaemolyticus. DETAILED DESCRIPTION

[0035] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0036] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0037] Example 1 Screening of specific molecular targets of Vibrio fluviatilis

[0038] The genome sequences of Vibrio and non-Vibrio were downloaded from the NCBI database, and Prokka and Roary software were used for annotation and pan-genome analysis, respectively. The results of the analysis were statistically analyzed, and specific targets were screened in the core genome region. The core region screening requirement was that it existed in more than 95% of all genome sequences of river Vibrio strains and did not exist in the genome sequences of other non-target strains (or existed in less than 5%). The obtained target genes were compared in the BLAST database, and finally the specific molecular targets of river Vibrio were screened out, and their nucleotide sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2:

[0039] ATGATTCGTAAAGCTTCATGGCTATTGATCGGATGTTTTGTCGTGTCTCTGCCCGCTTATGCTGCAGGAAACGCCACTGGGAATGGTATGGGGAAAGGCAATGGCGGAATGGGGCCCACGCAGATGCCAACCTTTACTGAGATCGATGTCGATCACGACGGTGCAATTACTCAGCAAGAGTT TGTGGCATTTCAACAAGCCAGACAAGCGGAGCGTGCCGCGGATGGTCGCATGATGAAAAATGCCGCAAATAGCGATGGCATGTTTGAGCAGATCGATGCTGATGGCAATGGCTTAATCGATGAACAAGAATTTCTCGCTCATCGTGGCAGCATGAGATACGCCAAACCGCAACAATGA(SEQ ID NO: 1);

[0040] ATGGCGGTGATTTTATATGTGCGGATTAAGTCTGGATTGGATCCCGATGAGCTGGAAAGAAGGGCTCTTGAGCGTAAACCTCGGTTTAAAGAAATCCCTGGATTGATACAAAAGGTTTATGGTCGCGACCCGCAAACTGGCGAGGTGTGTGGTATCTA TTTCTTCAAAGATCTGCCATCCATGCAAGCCTTCAAAGAGACTGAACTGGCAAAAACCATCCCATCAGCTTATGAAGCGCTAGACGTGAGAAGGGAGGTGTATGAGCTTATGTTCCCGCTTTATGAAGAGCGCGGGCCTTTTAGTTACTCATGA(SEQ ID NO: 2).

[0041] Example 2 Establishment of a PCR detection method for Vibrio virulentus based on specific molecular targets

[0042] 1. Experimental Methods

[0043] 1. Primer Design

[0044] Primers were designed according to different molecular targets to obtain specific primers for Vibrio fluviatilis (Table 1).

[0045] Table 1 Specific primer sequences of Vibrio fluvialis

[0046]

[0047]

[0048] 2. Bacterial culture and DNA extraction

[0049] The river Vibrio was inoculated in 2216E medium for activation and subculture. The river Vibrio cultured to the logarithmic phase was diluted with sterile saline, spread on 2216E solid medium for plate counting, and then inoculated in 2216E liquid medium and cultured at 37°C until the logarithmic phase of growth. The DNA of the bacterial liquid was extracted using the Novozyme DNA extraction kit as a template for subsequent PCR amplification and stored at -20°C for long-term storage.

[0050] 3. PCR system and reaction conditions

[0051] PCR system: 2×Multiplex Buffer 25 μL, template DNA 2 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, ddH2O to 50 μL.

[0052] PCR reaction conditions: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, annealing for 90s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 10min. The annealing temperatures were set at 50℃, 52℃, 54℃, 56℃, 58℃, and 60℃, respectively.

[0053] 2. Experimental Results

[0054] The annealing temperature affects the amplification efficiency and specificity of the primers to a certain extent, so the annealing temperature was optimized within the range of 50℃~60℃. Figure 1 As shown in the figure, when the annealing temperature is 50℃ and 52℃, the clarity of the amplified band is affected. When the annealing temperature is continuously increased, the amplification ability of the VF-1 primer pair and the VF-2 primer pair gradually stabilizes, and the best is at the annealing temperature of 58℃. Therefore, the annealing temperature of the subsequent amplification conditions is determined to be 58℃. That is, the PCR reaction conditions are determined as follows: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 58℃ annealing for 90s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 10min.

[0055] Example 3 Sensitivity Experiment

[0056] 1. Experimental Methods

[0057] 1. Pure culture samples

[0058] The culture of Vibrio fluvibrios cultured to the logarithmic growth phase was diluted with sterile physiological saline to obtain different concentrations of culture solution (6.3×10 7 , 6.3×10 6, 6.3×10 5 , 6.3×10 4 , 6.3×10 3 , 6.3×10 2 , 6.3×10 1 CFU / mL), and then DNA extraction was performed. DNA of different concentrations was used as template, and PCR amplification was performed using the method established in Example 2 to investigate the detection sensitivity of different primer pairs in pure culture of Vibrio fluvialis.

[0059] 2. Artificially contaminated fish samples

[0060] 25g of fish sample was added to 225mL of sterile saline and ground and mixed. 1mL of different concentrations of river Vibrio liquid (6.3×10 7 , 6.3×10 6 , 6.3×10 5 , 6.3×10 4 , 6.3×10 3 , 6.3×10 2 , 6.3×10 1 CFU / mL) was added to 9 mL of the mixed fish sample for DNA extraction. The extracted DNA was used as a template and PCR amplification was performed using the method established in Example 2 to examine the detection sensitivity of different primer pairs in artificially contaminated fish samples.

[0061] 2. Experimental Results

[0062] Sensitivity results for pure culture samples are as follows Figure 2 and Figure 3 As shown in Figure 2, the detection limit of the VF-1 primer pair in pure culture of Vibrio fluvialis was 6.3×10 2 CFU / mL( Figure 2 ), the detection limit of primer pair VF-2 in pure culture of Vibrio fluvialis was 6.3×10 3 CFU / mL( Figure 3 ).

[0063] The sensitivity results of artificially contaminated fish samples are as follows Figure 4 and Figure 5 As shown in the figure, the detection limit of the VF-1 primer pair in the artificially contaminated fish samples of river Vibrio was 6.3×10 2 CFU / mL( Figure 4 ), the detection limit of primer pair VF-2 in river Vibrio artificially contaminated fish samples was 6.3×10 3 CFU / mL( Figure 5 ).

[0064] Example 4 Specificity Experiment

[0065] 1. Experimental Methods

[0066] Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio vulnificus, Vibrio fluvii, Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa, Cronobacter sakazakii, Salmonella, and isolated strains of Vibrio parahaemolyticus were used for specificity experiments of different primer pairs. The strains used are shown in Table 2.

[0067] Table 2 Strains used in specific experiments

[0068]

[0069]

[0070] Vibrio was inoculated into 2216E liquid medium, and non-vibrio was inoculated into LB liquid medium, and cultured at 37°C until the logarithmic phase of growth. DNA was extracted from bacterial liquid using the Novozyme DNA extraction kit, which was used as a template for subsequent PCR amplification and stored at -20°C for long-term storage.

[0071] 2. Experimental Results

[0072] Specificity test results such as Figure 6 and Figure 7 As shown in the figure. When the VF-1 and VF-2 primer pairs amplified non-target bacteria, some other fragments were amplified (band size > 300bp), but only fragments of a specific size appeared in the target bacteria (the target fragment size in the VF-1 primer pair was 259bp, and the target fragment size in the VF-2 primer pair was 114bp), but not in other non-target bacteria. Therefore, the VF-1 and VF-2 primer pairs have good specificity and can be used for the detection of river Vibrio.

[0073] Example 5 A kit for detecting river Vibrio

[0074] The kit of this example uses the gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 1 as the detection target.

[0075] 1. Composition

[0076] 1. Primers

[0077] VF-1-F: CGCCACTGGGAATGGTATG (SEQ ID NO: 3);

[0078] VF-1-R: GCCACGATGAGCGAGAAAT (SEQ ID NO: 4);

[0079] 2. PCR Reagents

[0080] Multiplex Buffer, positive control reference, negative control reference;

[0081] The positive control reference substance is a plasmid DNA containing a molecular target having a nucleotide sequence as shown in SED ID NO: 1, and the negative control reference substance is ddH2O.

[0082] 3. Usage

[0083] Extract the DNA of the sample to be tested, use the above primers to perform PCR reaction on the DNA of the sample to be tested, and perform agarose gel electrophoresis on the PCR product after the reaction;

[0084] PCR system: 2×Multiplex Buffer 25 μL, template DNA 2 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, ddH2O to 50 μL.

[0085] PCR reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 90 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min.

[0086] 4. Interpretation method

[0087] If the electrophoresis results show that the target fragment of about 259 bp appears in the amplified product, it indicates that the sample to be tested contains Vibrio fluvialis;

[0088] If the target fragment of about 259 bp does not appear, it means that the sample to be tested does not contain Vibrio fluvibrios.

[0089] Example 6 A kit for detecting river Vibrio

[0090] The kit of this example uses the gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 as the detection target.

[0091] 1. Composition

[0092] 1. Primers

[0093] VF-2-F: CTGCCATCCATGCAAGCC (SEQ ID NO: 5);

[0094] VF-2-R:TTCATAAAGCGGGAACATAAGC (SEQ ID NO: 6);

[0095] 2. PCR Reagents

[0096] Multiplex Buffer, positive control reference, negative control reference;

[0097] The positive control reference substance is a plasmid DNA containing a molecular target having a nucleotide sequence as shown in SED ID NO: 2, and the negative control reference substance is ddH2O.

[0098] 3. Usage

[0099] Extract the DNA of the sample to be tested, use the above primers to perform PCR reaction on the DNA of the sample to be tested, and perform agarose gel electrophoresis on the PCR product after the reaction;

[0100] PCR system: 2×Multiplex Buffer 25 μL, template DNA 2 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, ddH2O to 50 μL.

[0101] PCR reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 90 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min.

[0102] 4. Interpretation method

[0103] If the electrophoresis results show that the target fragment of about 114 bp appears in the amplified product, it indicates that the sample to be tested contains Vibrio fluvialis;

[0104] If the target fragment of about 114 bp does not appear, it means that the sample to be tested does not contain Vibrio fluvibrios.

[0105] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 2 as a detection target for Vibrio fluviatilis.

2. Use of a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 2 in the preparation of a detection product for Vibrio fluviatilis.

3. Use of a reagent for detecting a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 1 or a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 2 in the preparation of a detection product for Vibrio fluviatilis.

4. A primer set for detecting a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 1, characterized in that: The primer set consists of a forward primer F1 and a reverse primer R1. The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO:3, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO:

4.

5. A primer set for detecting a gene fragment having a nucleotide sequence as shown in SEQ ID NO: 2, characterized in that: The primer set consists of a forward primer F2 and a reverse primer R2. The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO:5, and the nucleotide sequence of the reverse primer R2 is shown in SEQ ID NO:

6.

6. A kit for detecting river Vibrio, characterized in that: The kit comprises a reagent for detecting a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 1 or a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2, and the detection is for the purpose of non-disease treatment diagnosis.

7. The kit according to claim 6, characterized in that The reagent is the primer set according to claim 4 or the primer set according to claim 5.

8. The kit according to claim 6, characterized in that The kit also contains PCR reaction reagents, positive control reference substances and / or negative control reference substances.

9. The kit according to claim 8, characterized in that The positive control reference substance is a plasmid DNA containing a gene fragment with a nucleotide sequence such as that shown in SED ID NO: 1 or a gene fragment with a nucleotide sequence such as that shown in SEQ ID NO: 2, and the negative control reference substance is ddH2O.

10. A method for detecting Vibrio in rivers, characterized in that: The test sample is tested using the kit according to any one of claims 6 to 9, wherein the test is for the purpose of non-disease treatment diagnosis.

Images